Apex1 translation inhibitor and application of Apex1 in senescence diseases

By developing miR-137 mimics to inhibit Apex1 translation and using siRNA to regulate its expression, the problem of insufficient precise regulation and diagnosis of osteoblast senescence has been solved, enabling precise diagnosis and treatment of bone aging diseases.

CN121575102APending Publication Date: 2026-02-27ZUNYI MEDICAL UNIV ZHUHAI CAMPUS
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511809738.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-03
Publication Date
2026-02-27

AI Technical Summary

Technical Problem

Current technologies lack specific inhibition strategies for Apex1 protein expression, making it difficult to achieve precise regulation of osteoblast senescence. Furthermore, bone aging-related diseases lack specific molecular markers, resulting in insufficient diagnostic efficiency.

Method used

miR-137 mimics were developed as Apex1 translation inhibitors. They specifically inhibit the translation of Apex1 by using the nucleotide sequence 5'-AGGGUAUUCUUGGGUGGAUAAU-3'. Combined with Western blotting to detect osteoblast senescence, siRNA was used to reduce the copy number of Apex1 to regulate its expression.

Benefits of technology

It enables precise regulation of osteoblast senescence, improves the diagnostic accuracy of bone aging diseases, provides new therapeutic targets and diagnostic methods, and slows down the cellular senescence process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention relates to an Apex1 translation inhibitor and an application of the Apex1 in senescence diseases in the technical field of biological medicines, in particular to the Apex1, a translation inhibitor miR-137 mimics of the Apex1 and a related application of the Apex1 and the translation inhibitor miR-137 mimics of the Apex1. It is found for the first time that expression of Apex1 is closely related to the aging state of osteoblasts, along with increase of the aging degree of mouse bone tissue, the expression level of Apex1 is continuously increased, the aging degree of osteoblasts in bone tissue of different parts can be identified by detecting Apex1, when the expression level of Apex1 is reduced, the aging trend of osteoblasts can be inhibited, and the aging degree of osteoblasts in bone tissue of different parts can be identified. The miR-137 mimics can be used for directly inhibiting the protein translation process of the Apex1, so that a new method is provided for solving the research of bone regeneration and metabolism.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, in particular to an Apex1 translation inhibitor and application of Apex1 in aging diseases. BACKGROUND

[0002] Aging-related diseases have become a major global health challenge, among which skeletal aging, as one of the important manifestations of body aging, is characterized by disordered bone matrix structure, abnormal mineralization and decreased mechanical properties, which seriously affects the quality of life of the elderly. Its occurrence and development are closely related to the dysfunction of osteoblasts. At present, effective treatment targets and specific intervention strategies for skeletal aging and related bone metabolism diseases are still lacking, and it is urgent to further explore the key molecular mechanisms of regulating osteoblast aging.

[0003] Apex1 is a multifunctional protein that not only participates in DNA damage repair process, but also regulates the activity of multiple transcription factors such as NF-κB and AP-1. It is highly expressed in tumor tissues and drives tumor progression through promoting tumor cell proliferation, inhibiting apoptosis and inducing chemotherapy resistance. Previous studies have suggested that Apex1 may play an important role in the process of cell aging, but its specific function and regulatory mechanism in osteoblast aging, as well as whether it can be used as a therapeutic target for bone aging-related diseases, have not been clearly confirmed.

[0004] MicroRNA (miRNA) as an endogenous gene expression regulator, mediates post-transcriptional regulation by targeting mRNA, and plays a key role in cell fate determination, development and disease progression. Whether there is a direct regulatory relationship between miR-137, a type of miRNA that has been reported to be associated with tumor occurrence, and Apex1, and whether this regulatory relationship can provide new ideas for the treatment of Apex1-related tumors and aging-related diseases (especially bone metabolism diseases), has not been reported in any literature.

[0005] In addition, there is a lack of specific inhibition strategies for the translation process of Apex1 in the prior art, and traditional intervention methods cannot achieve precise regulation of Apex1 protein expression, limiting its application potential as a therapeutic target. At the same time, the diagnosis of bone aging and related diseases lacks specific molecular markers, resulting in insufficient clinical diagnostic efficiency and accuracy. Therefore, it is of great significance to explore key targets related to osteoblast aging, develop specific targeted inhibitors, and establish efficient detection methods for the diagnosis and treatment of aging-related diseases and tumors, and it has become a technical problem to be solved in the field. SUMMARY

[0006] To address the problems existing in the prior art, this invention provides a core target closely related to osteoblast senescence and a translation inhibitor that specifically inhibits this target, providing a new technical solution for the diagnosis and treatment of aging-related diseases and tumors.

[0007] To achieve the above objectives, this invention provides the use of the target Apex1 in the preparation or screening of products that regulate osteoblast senescence, with the access number of Apex1 in the NCBI database (NM_009687).

[0008] This provides the application of the target Apex1 in the preparation or screening of drugs for the treatment of aging-related diseases, including bone metabolic diseases and bone aging.

[0009] The present invention also provides an Apex1 translation inhibitor, wherein the inhibitor is miR-137 mimics, the nucleotide sequence of which is shown in SEQ ID NO.4; the miRNA mimics sequence is: 5'-AGGGUAUUCUUGGGUGGAUAAU-3'.

[0010] This invention also provides the application of miR-137 mimics in the preparation of products that inhibit Apex1 translation.

[0011] Furthermore, the miR-137 mimics have applications in the preparation of products that regulate osteoblast senescence or in the preparation of drugs for treating aging-related diseases.

[0012] This invention also provides a method for detecting osteoblast senescence, which involves detecting the protein expression level of Apex1. An increase in Apex1 protein expression indicates osteoblast senescence. The expression level of the target protein is detected using Western blotting; an increase in expression indicates that bone tissue has already undergone senescence.

[0013] This invention also provides a method for regulating osteoblast senescence by reducing Apex1 expression: reducing the copy number of Apex1 via siRNA-mediated reduction, wherein the nucleotide sequence of the siRNA is SEQ ID NO.2 or SEQ ID NO.3. The sense strand of the Apex1 RNA oligonucleotide: 5' CUGGUAAGACUGGAAUACCTT 3' (SEQ ID NO.2); Apex1 RNA oligonucleotide antisense strand: 5' GGUAUUCCAGUCUUACCAGAC 3'(SEQ ID NO.3).

[0014] The application also provides a method for regulating the aging of osteoblasts, and the miR-137 mimics are transfected into the osteoblasts to specifically inhibit the translation process of Apex1.

[0015] The application also provides a pharmaceutical composition for treating aging-related diseases or tumors, and the miR-137 mimics are used as active ingredients, and the nucleotide sequence is shown in SEQ ID NO. 4.

[0016] Further, the aging-related diseases include bone metabolism diseases and bone aging.

[0017] The addition of the miR-137 mimics does not cause changes in the mRNA expression amount of Apex1, but the protein expression level is down-regulated, and the miR-137 mimics can be used to inhibit the translation of Apex1, thereby improving the development of target-related diseases.

[0018] Working principle and beneficial effects of the application: the application first finds that the expression of Apex1 is closely related to the aging state of osteoblasts, and with the increase of the aging degree of the mouse bone tissue, the expression level of Apex1 is continuously increased. The aging degree of the osteoblasts in different parts of the bone tissue can be identified by detecting Apex1, and when the expression level of Apex1 is reduced, the aging trend of the osteoblasts can be inhibited, and the miR-137 mimics can directly inhibit the protein translation process of Apex1, thereby providing a new method for solving the research on bone regeneration and metabolism. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 Schematic diagram for staining to observe the aging degree of the bone tissue of mice under different feeding conditions; Figure 2 Schematic diagram for detecting the expression level of Apex1 in the bone tissue of mice under different feeding conditions by immunoblotting; Figure 3 Schematic diagram for detecting the expression of Apex1 in the bone cells after different treatments by immunoblotting; Figure 4 Schematic diagram for the expression change results of related genes after the action of the expression reduction tool; Figure 5 Schematic diagram for the expression change results of related genes after the action of the expression reduction tool; Figure 6 Schematic diagram for the cell state after the induction of the miR-137 mimics by β-galactosidase staining. DETAILED DESCRIPTION

[0020] The present application is described in detail by the following examples, but this is not considered as a limitation to the present application. Any modification or change made by those skilled in the art under the core principle of the technical scheme of the present application is considered as an equivalent replacement of the present application, and is covered within the scope of the appended claims.

[0021] The present application provides a metabolic-induced aging animal model. Obesity as an environmental stress can directly trigger the process of organisms to accelerate the presentation of aging characteristics at the molecular, cellular and physiological levels. Common mouse models generally have an age of 4 weeks to 8 months, and due to individual differences, they cannot well represent mature bone tissue models or aging models. By diet to induce obesity in mice, different aging differences occur in mice of the same age. This makes the present patent not limited to elderly individuals, but is applicable to a wider range of individuals who are aging.

[0022] I. Obtaining of bone tissue staining sections Samples: leg bone tissue of mice fed with ordinary SPF feed for 5 months, and leg bone tissue of mice fed with high-fat feed for 5 months at the same age.

[0023] Reagents: 80% ethanol, 4% paraformaldehyde, EDTA decalcification solution, 1% ZnSO4 solution, methyl green, Wako TRAP / ALP double staining kit, xylene, neutral resin mounting agent.

[0024] (1) Sample acquisition: 4% paraformaldehyde was used to fix the knee joint and the leg bone tissue near the knee joint at 4°C for 2 days, and then 80% ethanol was used for secondary fixation. Decalcification was performed using EDTA decalcification solution in a low-temperature environment (0.4 mL of 1% ZnSO4 solution was added to every 100 mL of decalcification solution to supplement zinc ions to maintain ALP enzyme activity.) for 5 days. After decalcification, the sample was washed with Barbital buffer solution (pH 7.4) supplemented with glycine to prevent calcium phosphate precipitation.

[0025] (2) Paraffin embedding and sectioning: paraffin embedding was performed according to the standard program of the automatic embedding machine. Leica sectioning machine was used for sectioning, and the thickness was kept at 4-6 μm. To avoid fragmentation, the paraffin sections were flattened in 42°C warm water, and then dried at 60°C overnight.

[0026] (3) TRAP / ALP double staining: TRAP staining working solution was prepared according to the instructions of the kit. The reaction temperature was increased to 37°C, and the reaction time was extended to 45-60 minutes to ensure sufficient color development on thin sections. Then, the ALP premix solution provided by the kit was used for overnight reaction at room temperature. The nuclei were stained with methyl green for 6 seconds, and after washing with water, the sections were dried at 37°C. Xylene was used for transparency treatment, and then neutral resin mounting agent was used for mounting.

[0027] The results are as follows Figure 1As shown, the red signal is significantly increased in the leg bones of mice fed with high-fat diet for 5 months, indicating that the bone resorption rate is greater than the bone formation rate, the bone metabolism is imbalanced, and the occurrence of bone aging under obesity stress.

[0028] II. Expression characteristics of Apex1 protein Samples: leg bone tissue of mice fed with ordinary SPF diet for 5 months, leg bone tissue of mice of the same age fed with high-fat diet for 5 months; primary mouse precursor osteoblasts, and aged mouse precursor osteoblasts under obesity environmental stress; miR-137 mimics-induced aged mouse precursor osteoblasts under obesity environmental stress.

[0029] Reagents: PMSF, RIPA lysis buffer, Bic Yun Tian BCA protein concentration kit, MOPS electrophoresis buffer, membrane transfer buffer, methanol, blocking solution, antibody (Wuhan Sanying), ECL hypersensitive luminescent liquid.

[0030] (1) Total protein extraction: a. For mouse tissue, a small amount of bone tissue was immersed in RIPA lysis buffer with added PMSF (1:100), and a Savillex grinder was used to grind according to the preset program in the operation manual until no obvious precipitate was observed. Then, under ice bath conditions, ultrasonic crushing was performed at 30% power for a total of 2 min (ultrasonic 3 sec, interval 8 sec). Then, 12000 xg 4 ℃ centrifugation for 10 min, take the supernatant. b. For mouse precursor osteoblasts, after the six-well plate was cultured to the same confluence, the cells were washed with PBS, and 0.1 ml of RIPA lysis buffer with added PMSF (1:100) was added under ice bath for 30 min. The cells were scraped and collected into a 1.5 mL centrifuge tube, and ultrasonic crushing was performed under ice bath conditions at 20% power for a total of 2 min (ultrasonic 2 sec, interval 2 sec). 12,500 rpm 4 ℃ centrifugation for 10 min, take the supernatant. The subsequent operation steps are the same for tissue and cells.

[0031] (2) BCA method for determining protein concentration: prepare BCA working solution according to A liquid: B liquid = 50:1, add 16 μL PBS, 4 μL total protein sample and 200 μL BCA working solution to each well of the 96-well plate, and set standard wells and blank wells and add the reaction system, 37 ℃ incubate for 30 min, detect OD 562 nm and calculate the standard curve and sample total protein concentration. (3) Protein expression determination: According to the measured total protein concentration of the sample, dilute the protein sample to 20 μL with PBS, add 80 μL of 5x protein loading buffer to make the protein concentration of the control group and the experimental group in the same batch. Heat the metal bath to 100 ℃ for 3 min, then ice bath. Use AG precast gel, add electrophoresis buffer and load, 160 V constant voltage electrophoresis for 45 min. Soak the PVDF membrane in methanol for 15 sec, cut the precast gel at the desired band position, and sandwich it according to the order of filter paper, gel, membrane, and filter paper from top to bottom. Transfer the membrane to the transfer instrument at 300 mA for 45 min. Wash the membrane with TBST for 3x5 min. Place the membrane in blocking solution and incubate on a shaker at room temperature for 1.5 h. Wash the membrane with TBST for 3x10 min. Dilute the primary antibody according to the dilution ratio in the instructions, and incubate overnight at 4℃. The next day, wash the membrane with TBST for 3x10 min to remove unbound primary antibody. Dilute the secondary antibody according to the dilution ratio in the instructions, and incubate at room temperature for 1 h. Wash the membrane with TBST for 3x10 min to remove unbound secondary antibody. Develop with ECL luminescent solution, and expose.

[0032] The results are shown in Figure 2 p53 and p21 are both aging-related genes, and it can be seen that bone tissue under the pressure of an obese environment appears to be aging, and the expression of Apex1 in the aging bone tissue is significantly increased, indicating that Apex1 is related to the regulation of osteoblast aging.

[0033] III. Role of Apex1 in the aging process of mouse precursor osteoblasts Sample: Mouse precursor osteoblasts.

[0034] Reagents: Chemi-Trans™ Lipofectin II transfection reagent, Opti-MEM serum-free medium, RNA oligonucleotide. (1) Efficiency verification of Apex1 knockdown tool: The specific sequence of short interfering RNA is shown in SEQ ID NO. 2, SEQ ID NO. 3, to construct the Apex1 knockdown tool. It is divided into ncApex1 group and siApex1 group. Mouse precursor osteoblasts are inoculated in a 6-well plate, and when the cell density reaches about 80%, transfection is performed. 30-60 minutes before transfection, replace the fresh complete culture medium. For each well, dilute the required amount of siRNA (final concentration 50 nM) in Opti-MEM serum-free medium in the first 1.5 ml centrifuge tube. In the second 1.5 ml centrifuge tube, dilute the appropriate volume of Chemi-Trans™ Lipofectin II in Opti-MEM. After 5 minutes of standing respectively, combine them in a 1:1 ratio, mix gently, and incubate at room temperature for 15-20 minutes to form siRNA-lipid complexes. Add the complexes to the culture plate and place it in the incubator for 48-72 hours. Then, according to the method in Example 2, Western blotting is performed to detect the expression of Apex1. The expression level of Apex1 in the siApex1 transfection group is significantly lower than that in the control group (P<0.05), and the expression level is about 0.3 times or less than that of the control group, indicating that the knockdown tool can significantly reduce the expression of Apex1.

[0035] (2) Effect of Apex1 knockdown on mouse precursor osteoblast aging: Mouse precursor osteoblasts are inoculated in a 6-well plate, and when the cell density reaches about 80%, transfection is performed. 48-72 h, collect the cells; according to the method in Example 2, extract the protein from each group of samples, and according to the method in Example 2, Western blotting is performed to detect the change of aging-related gene p16.

[0036] According to the accession number (NM_009687) of the mRNA sequence of mouse Apex1 in the NCBI database, the RNA oligonucleotide sense strand of Apex1 is designed as follows: 5' CUGGUAAGACUGGAAUACCTT 3' (SEQ ID NO. 2); the RNA oligonucleotide antisense strand of Apex1 is designed as follows: 5' GGUAUUCCAGUCUUACCAGAC 3' (SEQ ID NO. 3).

[0037] The results are shown in Figure 4 The expression level of Apex1 in the siApex1 transfection group is significantly lower than that in the control group, indicating that the knockdown tool can significantly reduce the expression of Apex1. And by reducing the protein level of Apex1, the protein expression of aging-related gene p16 can be significantly inhibited, which indicates that Apex1 can regulate the aging process of mouse precursor osteoblasts.

[0038] IV. mRNA expression of Apex1 after miR-137 mimics induced cells Sample: Mouse pre-osteoblast cells under the pressure of obesity environment.

[0039] Reagent: miR-137 mimics, Lipofectamine 3000 transfection reagent, Opti-MEM serum-free medium, Trizol, chloroform substitute, isopropanol, Vazyme R111 reverse transcription kit, SYBR dye (Vazyme, Q712).

[0040] (1) miR-137 mimics induction: the cells were seeded in a six-well plate and divided into a control group and a miR-137 mimics group. An appropriate amount of miR-137 mimics or negative control reagent was added to 100 μL of Opti-MEM serum-free medium for dilution; 3 μL of Lipofectamine 3000 transfection reagent was mixed with 100 μL of Opti-MEM. The diluted miRNA solution was mixed with the transfection reagent at a volume ratio of 1:1, and incubated at room temperature for 15 minutes to form a transfection complex. The original culture medium in the well plate was aspirated, 1.5 mL of fresh complete culture medium without antibiotics was added to each well, and 200 μL of transfection complex was slowly added and gently shaken to mix. After incubation at 37 °C and 5% CO2 for 6 hours, the fresh complete culture medium was replaced. The transfection efficiency was detected by RT-qPCR and Western blotting. (2) Total RNA extraction: after 24 hours, the culture solution was aspirated and washed with PBS twice. An appropriate amount of Trizol was added, the cells were scraped with a cell scraper, and the lysate was transferred to a 1.5 mL centrifuge tube. The lysate was incubated at room temperature for 5 min to release the nucleic acids. 0.2 mL of chloroform substitute was added, and the mixture was vigorously shaken for 30 sec and centrifuged at 12,000 rpm for 10 min to separate the water phase and the organic phase. The upper water phase was carefully aspirated into a new centrifuge tube, and an equal volume of isopropanol was added, and the mixture was gently inverted and mixed, and incubated at room temperature for 10 min to precipitate the RNA. Centrifuge at 2,000 rpm for 3 min, discard the supernatant. Add 1 mL of 75% ethanol to wash the precipitate, centrifuge at 12,000 rpm for 3 min, discard the supernatant, and dry at room temperature for 3-5 min. Add 30 μL of ddH2O to dissolve the RNA. The RNA concentration and purity were determined by a micro-nucleic acid quantifier, and the qualified RNA solution was aliquoted and stored at -80 °C.

[0041] (3) Reverse transcription: use Vazyme R111 reverse transcription kit to remove genomic DNA in total RNA, 1 μg RNA and 2 μL gDNA reagent, the rest RNase free Water to 16 μL, 42 °C for 2 min; the second step is to reverse transcribe total RNA into cDNA, add 4 μL reverse transcription reagent to the above mixture to make the total volume 20 μL, 37 °C for 15 min, 85 °C for 5 s, 4 °C for short-term storage, and 20 °C for long-term storage.

[0042] (4) PCR amplification: according to 1 μL cDNA, 2 μL primer, 2 μL ultrapure water, 5 μL SYBR dye, mix into 10 μL system, and perform rapid PCR. The PCR amplification conditions are as follows: pre-denaturation at 95 °C for 2 min; 95 °C for 5 sec, 60 °C for 30 sec for 40 cycles, and the rest of the program is set according to the default parameters of Q5 machine. Each sample is technically repeated 3 times, and the results are analyzed by 2-ΔΔCT method.

[0043] miRNA mimics sequence: 5'-ACGGGUAUUCUUGGGUGGAUAAU-3' (SEQ ID NO. 4). According to the DNA sequence of Apex1, the accession number (NM_009687) of NCBI database, the amplification primer of Apex1 is designed by Primer 6 software, as follows: The upstream primer of Apex1 is: 5'-CTGCTCTTGGAATGTGGATGGG-3' (SEQ ID NO. 5); The downstream primer of Apex1 is: 5'-TCCAGGCAGCTCCTGAAGTTCA-3' (SEQ ID NO. 6).

[0044] The results are shown in Figure 3 The protein expression of Apex1 in the miR-137 mimics transfected pre-osteoblast cells under the pressure of obesity and aging is down-regulated. The results are shown in Figure 5 The mRNA expression of Apex1 in the miR-137 mimics transfected cell group and the negative control reagent group does not show obvious difference, which shows that miR-137 mimics cannot affect the transcription process of Apex1. The above results show that miR-137 mimics can affect the post-transcriptional translation process of Apex1, thereby reducing the protein expression of Apex1.

[0045] V. Improvement of cell senescence phenotype induced by miR-137 mimics ​The mice precursor osteoblast cells under the pressure of obesity environment were inoculated in six-hole plates, and miR-137 mimics transfection was carried out when the cell density reached about 80%, and the cells were collected at 72 h. According to the method in Example 2, total protein was extracted from each group of samples, and the change of aging-related gene p16 was detected. Meanwhile, the SA-β-gal kit was used to detect the aging-related β-galactosidase staining. After the induction intervention was completed, the culture medium was removed, and the cells were gently washed twice with pre-cooled PBS to remove residual culture medium and serum components. Then, 1 mL of β-galactosidase staining fixative was added to each well, and the cells were fixed at room temperature for 15 min to avoid excessive fixation and cell morphology damage. After fixation, the fixative was removed, and the cells were washed with PBS for 3 min to remove residual fixative and maintain an appropriate pH environment. Then, the staining working solution was prepared in proportion (X-Gal solution: staining solution A: staining solution B: staining solution C = 5:1:1:93), in which X-Gal (5-bromo-4-chloro-3-indole-β-D-galactoside) was used as a substrate to generate blue precipitates under the action of β-galactosidase. After the washing solution was removed, 1 mL of freshly prepared staining working solution was added to each well to ensure complete coverage of the cell layer. The 6-well plate was sealed with plastic wrap to prevent evaporation and placed in a 37 ℃ CO2-free incubator for overnight incubation in the dark. After incubation, the staining solution was removed, and the cells were washed twice with PBS to remove unreacted dye. Under an inverted optical microscope, senescent cells showed obvious blue staining due to increased SA-β-gal activity, while young cells were basically colorless.

[0046] The results are shown in Figure 3 As shown in the results, when the expression of miR-137 mimics in the cells increased, the expression level of the aging marker gene p16 of the precursor osteoblast cells decreased, indicating that cell aging was alleviated by miR-137 mimics. The results are shown in Figure 6 As shown in the results, after transfection of miR-137 mimics in cells under the pressure of obesity, the blue precipitate decreased significantly, indicating an increase in non-senescent cells, and miR-137 mimics could delay cell aging. The above results show that Apex1 promotes cell aging, and this result can be inhibited by miR-137 mimics to inhibit Apex1 translation, thereby improving aging.

[0047] The above-mentioned are only embodiments of the present application, and common technical solutions and / or common knowledge of the scheme are not described in detail. It should be pointed out that, for those skilled in the art, without departing from the technical solutions of the present application, a number of modifications and improvements can be made, which should also be considered as the protection scope of the present application, and these will not affect the effect and practicality of the patent. The protection scope claimed in the present application should be subject to the content of its claims, and the specific implementation mode and the like recorded in the specification can be used to explain the content of the claims.

Claims

1. Use of the target point Apex1 in the preparation or screening of products for regulating the aging of osteoblasts.

2. Use of the target point Apex1 in the preparation or screening of drugs for treating senile diseases, characterized in that, The aging-related diseases include bone metabolism diseases, bone aging.

3. An Apexl translation inhibitor, characterized in that, The inhibitor is miR-137 mimics, and the nucleotide sequence is shown as SEQ ID NO.

4.

4. Use of miR-137 mimics in the preparation of a product for inhibiting translation of Apex1, characterized in that, The nucleotide sequence is shown as SEQ ID NO.

4.

5. Use of miR-137 mimics in the preparation of a product for inhibiting the translation of Apex1, characterized in that, The nucleotide sequence is shown as SEQ ID NO. 4, and the miR-137 mimics have the application in the preparation of products for regulating the aging of osteoblasts or the preparation of drugs for treating aging-related diseases.

6. A method of detecting osteoblast senescence, characterized by, Detect the protein expression level of Apex1, and if the expression level of Apex1 protein is increased, it indicates that the osteoblasts are aging.

7. A method of modulating osteoblast aging, comprising, Decreased expression of Apex1: reduce the copy number of Apex1 by siRNA mediation, and the nucleotide sequence of the siRNA is SEQ ID NO. 2 or SEQ ID NO.

3.

8. A method of modulating osteoblast aging, comprising, Transfect miR-137 mimics into osteoblasts to specifically inhibit the translation process of Apex1.

9. A pharmaceutical composition for treating an aging-related disease or a tumor, characterized by, The miR-137 mimics are used as active ingredients, and the nucleotide sequence is shown as SEQ ID NO.

4.

10. The pharmaceutical composition of claim 9, wherein: The aging-related diseases include bone metabolism diseases, bone aging.