Molecular marker composition for identifying seedless character of grape and application of molecular marker composition

Abstract

The invention belongs to the technical field of genes, and particularly relates to a molecular marker composition for identifying seedless characters of grapes and application of the molecular marker composition, a seedless gene VvAGL11 is taken as an entry point, and combined molecular markers are developed for a specific insertion segment INS of a newly developed VvAGL11 gene promoter region, a key mutation segment CDS of a coding region and a seedless molecular marker P3VvAGL11. According to the molecular marker composition, the identification efficiency of seedless characters is remarkably improved, the accurate application range of the molecular marker is refined, a more accurate and efficient identification means is provided for seedless breeding of grapes, and the breeding efficiency of the grapes is improved.

Description

Technical Field

[0001] This invention belongs to the field of gene technology, specifically relating to a molecular marker composition for identifying seedless traits in grapes and its application. Background Technology

[0002] Over a long period of development, grapes have undergone mutations due to natural conditions and human activities, resulting in many new varieties and enriching grape germplasm resources. Seedless grapes are highly favored for their convenience and excellent flavor. However, naturally occurring seedless grape varieties are scarce, and seedless grape breeding is time-consuming and inefficient. Common methods for seedless grape breeding include conventional hybridization, embryo rescue breeding, bud mutation selection, and molecular marker-assisted early identification breeding. Among these, conventional hybridization is the main approach for seedless grape breeding, but its seedless rate in hybrid offspring is low and it relies on the seedless heritability of the hybrid parents. With the development of molecular marker technology, DNA molecular marker-assisted breeding can greatly improve the efficiency and accuracy of plant breeding. Therefore, screening for highly efficient seedless gene molecular markers is of great significance for seedless grape breeding. Although previous researchers have developed a number of seedless molecular markers, including SCAR markers, SSR markers, and probes, the efficiency and applicability of these markers vary in different groups of grape germplasm resources. Compared to other conventional markers, P3_VvAGL11 has higher detection efficiency in different grape populations, ploidy types, and seedless varieties. However, in actual experiments, its overall identification is still affected by European and American diploid seeded plants, as well as a small number of European and American seedless plants, resulting in significant limitations in detection. Summary of the Invention

[0003] To address the problems in existing technologies, such as the difficulty in meeting market demand for superior seedless grape varieties, the low seedlessness rate of hybrid breeding offspring, the long breeding time and low stability, and the limitations of DNA marker technology, this invention provides a highly efficient molecular marker composition for identifying the seedless trait in grapes, which can shorten the breeding cycle, and its application. The technical solution is as follows: A molecular marker composition for identifying seedless traits in grapes includes a sequence tag site (STS) molecular marker P3_VvAGL11 (PRO) of the VvAGL11 gene, a specific insertion fragment marker (INS) of the VvAGL11 promoter region, and an amino acid mutation site marker (CDS) of the coding region.

[0004] Furthermore, it includes molecular markers with sequences as shown in SEQ ID NO.1, insertion fragment markers in the promoter region with sequences as shown in SEQ ID NO.2, and amino acid mutation site markers in the coding region with sequences as shown in SEQ ID NO.3.

[0005] SEQ ID NO.1 is as follows: CTCCCTTTCCCTCTCCCTCTCCCTCCCTCTCTCTCTCTCTCTCTCAAAGTCACTTTCTACATCTGCACCACCCACTCTCTCTCTCTCTCTCTCTCATATCCGTCTCACATCTCTCCATTGTGGTATATATATATAAGGACTAAACACAAGTCTTAAGGCACTTTGGCTTCATTGGGATACGCGTTT; SEQ ID NO.2 is as follows: TGTCTTGTATCCGACTTTGGG TAATAAGCCATTCGGAAGTCTTTTTCTTCCTCAACCCCTCTCTCTCTCTCTCTCTCTTTGAAGAAGTCATTTTCTTCATCTGCACCGCCCATTCTCTCTCGCTATTGTCATCTTTCTCCTCTTCTCTCTCTCTCTCTCTCTCTCTCTCTCTATTGTACTATCTCTCTTCTCTCTCTATCTCTCTTTATTGCTCTCTCTCTCCCTTTCCCTCTCCCTCTCCCTCCCTCTCTCTCTCTCTCTCTCAAAGTCACTTTCTACATCTGCACCACCCACTCTCTCTCTCTCTCTCTCTCATATCCGTCTCACATCTCTCCATTGTGGTATATATATATAAGGACTAAACACAAGTCTTAAGGCACTTTGGCTTCATTGGGATACGCGTTTTTGCACAGCCCGAAATTTTCCGAAAGCTGAAGTCGCCGGATTTTGGAAACAAGGTGTGTAGGTGATCTTTTAACAGAAACGTTTCACCACCAAAATTTCCACAATCAACCATTCTCTCTCTGTGAAAACGTTTCGTGCATAACTGGGTAATCTTAGATCTGCTCCCCTCCACACCACAGAATCTACTTTTGCCTACATATGAACATCTGCTTTCCATTTCTTCCTCTTTCTTTTGTCAGTGCCCATCTCTC; SEQ ID NO.3 is as follows: ATGGGGAGAGGAAAGATCGAGATCAAGAGGATCGAAAACACGACCAACCGTCAGGTCACATTCTGCAAGCGAAGGAATGGGCTTTTGAAGAAGGCTTATGAATTATCAGTGCTATGTGATGCAGAAGTTGCCCTCATCGTCTTCTCCAGCCGCGGTCGAGTCTATGAGTACTCAAACAACAACATAAAATCAACCATAGATAGGTACAAGAAGGCCAGCTCAGATAGTACAAATGGAGGCTCTACCATGGAGATCAATGCCCAATACTACCAGCAAGAATCAGCAAAGCTGCGCCAGCAAATACAGATGCTGCAGAATTCTAACAGGCACTTAATGGGTGATTCCTTGGCTTCCTTGACTGTGAAGGAGCTAAAGCAGCTCGAGAACAGGCTTGAACGAGGCATCACAAGAATCAGGTCGAAGAAGCATGAGTTGCTGTTGGCTGAGATTGAGTACTTGCAGAAAAGGGAAATTGAGCTGGAAAATGAAAGCGTATATCTCCGAACCAAGATTGCAGAAGTGGAGAGGCTTCAGCAAGCAAACATGGTATCAACACATGAGTTCAATGCCATCCAGGCATTAGTTTCTCGCAATTTCTTTCAGCCCAATATGATTGAGGGTGGATCCACAGGCTACCCACTTCCTGATAAGAAGGTCCTCCATCTCGGGTAA。

[0006] Furthermore, a mutation occurs at position 197 in the coding region or mutations occur simultaneously at positions 197 and 210. The amino acid sequence before mutation is as shown in SEQ ID NO.8: MGRGKIEIKRIENTTNRQVTFCKRRNGLLKKAYELSVLCDAEVALIVFSSRGRVYEYSNNNIKSTIDRYKKASSDSTNGGSTMEINAQYYQQESAKLRQQIQMLQNSNRHLMGDSLASLTVKELKQLENRLERGITRIRSKKHELLLAEIEYLQKREIELENESVYLRTKIAEVERLQQANMVSTHEFNAIQALVS R NFFQPNMIEGGS TGYPLPDKKVLHLG.

[0007] A primer for the above-mentioned molecular marker composition, wherein the primers for amplifying the promoter region include primer pairs with sequences as shown in SEQ ID NO.4 (5'-TGTCTTGTATCCGACTTTGGG-3') and SEQ ID NO.5 (5'-GAGAGATGGGCACTGACAAA-3').

[0008] Furthermore, the primers for amplifying the coding region include primer pairs with sequences as shown in SEQ ID NO.6 (5'-CACCATGGGGAGAGGAAAGATCGAG-3') and SEQ ID NO.7 (5'-TTACCCGAGATGGAGGACCT-3').

[0009] A product containing the primers described above includes reagents, kits, or chips.

[0010] Application of the above-mentioned molecular marker composition in seedless grape breeding.

[0011] A method for identifying the seedless trait in grapes includes the following steps: preparing DNA, RNA, and cDNA samples of grapes to be tested, and amplifying them using the primer pairs described above; performing comparative analysis of promoter region labeling, insert fragment labeling, and coding region labeling on the amplified products, and identifying the seedless trait based on the consistency of the results.

[0012] Furthermore, if any two or three of the three markers show that the grapes being tested have seeds, it indicates that the grapes are seeded varieties; if any two or three of the markers show that the grapes are seedless, it indicates that the grapes being tested are seedless varieties.

[0013] Furthermore, the grape samples include one or both of hybrid or self-crossed samples.

[0014] By adopting the above scheme, the method of the present invention has the following advantages: 1. This invention is the first to apply INS markers to the identification of seedless grape traits. It integrates multi-type sequence variation information and innovatively constructs a PRO-INS-CDS combined marker system. This system not only effectively improves the detection rate, accuracy, and stability of seedless grape traits but also successfully optimizes the limitations of single-marker identification, increasing the efficiency of seedless trait identification. This innovative approach not only demonstrates its enormous potential in expanding the detection range of seedless traits but also enables its more precise and efficient application in molecular marker-assisted breeding practices, providing strong technical support for the cultivation of seedless grape varieties and potentially promoting the further development of grape breeding technology.

[0015] 2. By combining PRO marker combinations to identify the nucleus-free trait in hybrid populations and seedling offspring, it is shown that any two markers in the combination markers of this invention can accurately detect the nucleus-free trait. This not only effectively improves the accuracy of marker identification but also expands the detection range of the nucleus-free trait, making it better applicable to molecular marker-assisted breeding.

[0016] 3. Compared with single marker identification, the combined molecular markers of the present invention can effectively improve the identification efficiency of seedless grape traits, expand the prediction range of seedless grape traits, and have the ability to efficiently identify seedless plants from seeded grape samples, providing strong technical support for molecular marker-assisted breeding. Attached Figure Description

[0017] Figure 1 The image shows the identification results of the hybrid combination population in Example 1, where A is a sample image of the hybrid combination population shown in Example 1, and B is the identification result. Figure 2 The image shows the identification of the 'Kyoho' grape seedling population in Example 2, where A is the sampling process of the 'Kyoho' grape seedling population in Example 2, and B is the PRO labeling result; Figure 3 The results of sequence alignment of 37 grape germplasms with VvAGL11-specific inserted fragment marker sequences. Detailed Implementation

[0018] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0019] Preparation example: (1) Five markers with relatively high identification accuracy, namely SCF27, SCC8, P3_VvAGL11, VMC7F2, and VvVn16, were selected for screening of combined markers; then, 143 natural populations of grapes of different varieties were selected as samples to be identified, and DNA and RNA were extracted from the samples; the seedless trait of the 143 natural populations of grapes was identified using the above five types of molecular markers, and their identification rates were compared to screen out the highly efficient seedless molecular marker P3_VvAGL11; (2) Using cDNA from grape population samples as templates, PCR amplification of the VvAGL11 coding region and sequence alignment revealed two specific amino acid mutation patterns in the seedless variety: (1) only the 197 site was mutated, changing from arginine (R) to leucine (L); (2) both the 197 and 210 sites were mutated simultaneously, with arginine (R) at the 197 site changing to leucine (L) and threonine (T) at the 210 site changing to alanine (A). Further validation was then performed using population samples, and the efficiency of CDS markers in identifying the seedless trait was statistically analyzed.

[0020] (3) Based on the grape VvAGL11 gene sequence and PRO marker primer location information published in the NCBI database, specific primers were designed. Through PCR amplification and sequence alignment analysis, a 6 bp insertion sequence was found in the VvAGL11 promoter region (located in the 250–270 bp interval) of all seedless varieties. This insertion segment was named INS. The marker was further validated using population samples, and its efficiency in seedless trait identification was statistically analyzed.

[0021] (4) Develop PRO-INS-CDS combined markers, that is, the three markers should be given priority for two or more identical results as the final identification result.

[0022] Example 1: (1) Nine pairs of hybrid parent lines were used, and samples of the hybrid offspring were collected after they emerged. They were grouped according to Table 1. Note: Since the hybrid offspring of groups c and g were few and not statistically significant, the identification results of the remaining 7 parent combinations, totaling 260 hybrid offspring, were used for statistical analysis.

[0023] Table 1: Parental Combinations of Hybrid Populations serial number Parent Group 1-49 Shaoxing No. 7 × Deep Red Seedless a 50-77 Shaoxing No. 8 × Deep Red Seedless b 78-90 Shaoxing No. 7 × Shaoxing No. 9 c 91-121 Red No. 9 × Red Rose d 122-149 Shaoxing No. 1 × Sapphire e 150-198 Shaoxing No. 8 × Sapphire f 199-210 Red No. 9 × Shaoxing No. 9 g 211-241 Shaoxing No. 7 × Black Extreme Fragrance h 247-285 Shaoxing No. 7 fragrance × Sapphire i (2) Extract DNA, RNA and cDNA from the sample; amplify the products using PCR. The PCR reaction system is a 25 μL system, which includes: 12.5 μL of PCR reaction enzyme; 1 μL each of forward and reverse primers; 1 μL of diluted DNA; and 9.5 μL of sterilized deionized water. The PCR reaction conditions are: 94℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 59℃ for 30 s, 72℃ extension for 30 s, 30 cycles; 72℃ extension for 10 min; and storage at 16℃.

[0024] (3) Validation analysis of the high-efficiency molecular marker P3_VvAGL11: A heterozygous site was amplified at 184 bp / 194 bp, denoted as BC; a homozygous site was amplified only at 194 bp, denoted as C; a site was amplified only at 174 bp, denoted as A; a site was amplified only at 184 bp, denoted as B; a heterozygous site was amplified at 174 bp / 184 bp, denoted as AB; a heterozygous site was amplified at 174 bp / 184 bp, denoted as AB.

[0025] (4) INS marker and CDS region cloning analysis of nucleus-free genes in different samples: Using the primer pairs shown in SEQ ID NO.4 and SEQ ID NO.5, PCR amplification and sequence alignment analysis were performed using sample DNA as a template. It was found that the nucleus-free variety had a higher INS marker and CDS region cloning analysis than the nucleated variety. vAGL11 A 6 bp base insertion exists in the 250-270 bp region of the promoter sequence, where 1 / 0 indicates the presence / absence of the corresponding INS base insertion segment in the promoter region, respectively. Using the primer pair shown in SEQ ID NO.6 and SEQ ID NO.7, and with the sample's cDNA as a template, PCR amplification of the VvAGL11 coding region was performed. Sequence alignment revealed two specific amino acid mutation patterns in the nucleus-free variety: (1) mutation only at position 197; (2) simultaneous mutations at positions 197 and 210.

[0026] (5) The nucleus-free characteristics of the sample were finally determined by combining the results of the three identifications.

[0027] Comparative Example 1: The difference from Example 1 is that only PRO labeling analysis was performed to determine the nucleus-free trait of the sample.

[0028] Comparative Example 2: The difference from Example 1 is that only INS marker analysis was performed to determine the nucleus-free morphology of the sample.

[0029] Comparative Example 3: The difference from Example 1 is that only CDS labeling analysis was performed to determine the nucleus-free morphology of the sample.

[0030] The results of Example 1 and Comparative Examples 1-3 are as follows Figure 1 As shown in Table 2: Table 2: Statistical analysis of amplification results of different nucleoside molecular markers in natural populations Serial Number PRO Seed type INS CDS a-1 C Nucleus-free 0 197 210 a-2 BC Nucleus-free 1 197 a-3 A Nucleus 1 none a-4 A Nucleus 0 197 a-5 AB Nucleus 0 none a-6 BC Nucleus-free 1 197 210 a-7 BC Nucleus-free 1 none a-8 AC Nucleus 1 none a-9 AB Nucleus 0 none a-10 AB Nucleus 1 none a-11 AB Nucleus 0 197 210 a-12 BC Nucleus-free 1 197 a-13 AB Nucleus 0 none a-14 BC Nucleus-free 1 197 a-15 AC Nucleus 1 197 a-16 AB Nucleus 0 197 a-17 BC Nucleus-free 1 197 a-18 AB Nucleus 0 none a-19 BC Nucleus-free 0 none a-20 B Nucleus 0 none a-21 BC Nucleus-free 0 197 a-22 BC Nucleus-free 1 197 a-23 AC Nucleus 1 197 210 a-24 AC Nucleus 0 none a-25 C Nucleus-free 1 none a-26 BC Nucleus-free 1 197 a-27 B Nucleus 0 none a-28 AC Nucleus 0 none a-29 AB Nucleus 0 none a-30 B Nucleus 0 none a-31 BC Nucleus-free 1 none a-32 B Nucleus 0 197 210 a-33 BC Nucleus-free 1 none a-34 B Nucleus 1 none a-35 BC Nucleus-free 0 197 210 a-36 BC Nucleus-free 1 197 a-37 AC Nucleus 0 none a-38 AC Nucleus 0 none a-39 AB Nucleus 0 197 a-40 AB Nucleus 0 197 210 a-41 BC Nucleus-free 1 none a-42 AB Nucleus 0 none a-43 AC Nucleus 0 none a-44 AC Nucleus 1 none a-45 BC Nucleus-free 1 none a-46 A Nucleus 0 none a-47 AB Nucleus 0 none a-48 BC Nucleus-free 0 197 a-49 AB Nucleus 0 197 210 b-50 AB Nucleus 1 none b-51 A Nucleus 0 197 b-52 A Nucleus 0 none b-53 A Nucleus 0 none b-54 AB Nucleus 0 none b-55 AB Nucleus 1 197 210 b-56 A Nucleus 0 none b-57 AB Nucleus 0 none b-58 BC Nucleus-free 1 none b-59 A Nucleus 0 none b-60 A Nucleus 0 none b-61 AC Nucleus 0 none b-62 AB Nucleus 0 none b-63 A Nucleus 1 none b-64 A Nucleus 1 none b-65 A Nucleus 0 none b-66 BC Nucleus-free 0 197 b-67 BC Nucleus-free 1 197 b-68 BC Nucleus-free 1 197 b-69 BC Nucleus-free 1 none b-70 BC Nucleus-free 0 197 b-71 BC Nucleus-free 1 197 b-72 BC Nucleus-free 1 none b-73 B Nucleus 0 197 b-74 B Nucleus 0 197 b-75 BC Nucleus-free 0 197 210 b-76 B Nucleus 0 197 b-77 BC Nucleus-free 0 197 c-78 B Nucleus 1 none c-79 BC Nucleus-free 0 197 c-80 AC Nucleus 0 197 c-81 A Nucleus 0 none c-82 AB Nucleus 1 none c-83 AB Nucleus 0 none c-84 AB Nucleus 0 none c-85 BC Nucleus-free 1 197 c-86 B Nucleus 0 none c-87 BC Nucleus-free 0 none c-88 AB Nucleus 0 197 c-89 BC Nucleus-free 1 none c-90 AB Nucleus 0 197 d-91 B Nucleus 0 197 d-92 B Nucleus 0 197 d-93 B Nucleus 0 none d-94 B Nucleus 0 none d-95 BC Nucleus-free 1 197 d-96 B Nucleus 1 197 d-97 B Nucleus 1 none d-98 BC Nucleus-free 0 none d-99 BC Nucleus-free 1 197 d-100 BC Nucleus-free 1 none d-101 B Nucleus 1 none d-102 BC Nucleus-free 0 197 d-103 AB Nucleus 1 none d-104 BC Nucleus-free 1 197 d-105 B Nucleus 0 none d-106 BC Nucleus-free 1 197 d-107 B Nucleus 0 none d-108 B Nucleus 0 none d-109 B Nucleus 0 none d-110 BC Nucleus-free 1 197 d-111 B Nucleus 0 none d-112 BC Nucleus-free 0 197 210 d-113 B Nucleus 0 none d-114 BC Nucleus-free 0 none d-115 BC Nucleus-free 1 none d-116 B Nucleus 0 none d-117 BC Nucleus-free 1 none d-118 BC Nucleus-free 1 197 210 d-119 B Nucleus 0 none d-120 AB Nucleus 0 none d-121 BC Nucleus-free 1 none e-122 B Nucleus 0 197 e-123 BC Nucleus-free 1 none e-124 B Nucleus 0 none e-125 AB Nucleus 1 197 e-126 BC Nucleus-free 0 197 e-127 BC Nucleus-free 0 none e-128 BC Nucleus-free 1 none e-129 AC Nucleus 0 none e-130 AB Nucleus 1 none e-131 BC Nucleus-free 1 197 e-132 BC Nucleus-free 1 none e-133 BC Nucleus-free 1 197 210 e-134 AB Nucleus 0 197 e-135 AB Nucleus 0 none e-136 BC Nucleus-free 0 197 e-137 AB Nucleus 0 none e-138 AB Nucleus 0 197 e-139 AB Nucleus 0 none e-140 AB Nucleus 0 none e-141 BC Nucleus-free 1 197 210 e-142 AC Nucleus 0 197 e-143 BC Nucleus-free 1 197 e-144 AC Nucleus 0 none e-145 AB Nucleus 0 none e-146 BC Nucleus-free 1 197 e-147 AC Nucleus 0 none e-148 AC Nucleus 0 none e-149 AC Nucleus 0 197 f-150 AB Nucleus 0 197 f-151 BC Nucleus-free 0 none f-152 B Nucleus 0 197 f-153 AC Nucleus 0 none f-154 AB Nucleus 0 none f-155 BC Nucleus-free 1 197 f-156 A Nucleus 0 none f-157 C Nucleus-free 0 none f-158 BC Nucleus-free 1 197 f-159 AC Nucleus 0 none f-160 B Nucleus 0 none f-161 C Nucleus-free 1 none f-162 C Nucleus-free 1 197 f-163 BC Nucleus-free 1 197 f-164 A Nucleus 0 197 f-165 C Nucleus-free 0 none f-166 BC Nucleus-free 1 197 f-167 B Nucleus 0 none f-168 B Nucleus 0 197 f-169 B Nucleus 0 none f-170 BC Nucleus-free 1 197 f-171 BC Nucleus-free 1 197 210 f-172 C Nucleus-free 1 none f-173 AB Nucleus 0 none f-174 C Nucleus-free 1 197 f-175 AB Nucleus 0 197 210 f-176 BC Nucleus-free 1 197 f-177 BC Nucleus-free 1 197 f-178 AB Nucleus 0 none f-179 C Nucleus-free 1 197 f-180 B Nucleus 1 none f-181 B Nucleus 0 none f-182 BC Nucleus-free 1 197 210 f-183 C Nucleus-free 1 197 f-184 BC Nucleus-free 1 197 210 f-185 AB Nucleus 0 197 f-186 AC Nucleus 0 197 f-187 AC Nucleus 1 none f-188 BC Nucleus-free 1 197 f-189 BC Nucleus-free 1 197 f-190 AB Nucleus 0 none f-191 BC Nucleus-free 0 none f-192 B Nucleus 0 none f-193 BC Nucleus-free 1 197 f-194 B Nucleus 1 197 f-195 BC Nucleus-free 1 197 210 f-196 C Nucleus-free 1 197 f-197 B Nucleus 0 none f-198 B Nucleus 0 none g-199 C Nucleus-free 0 197 g-200 B Nucleus 0 197 g-201 BC Nucleus-free 1 none g-202 BC Nucleus-free 1 none g-203 BC Nucleus-free 0 none g-204 AC Nucleus 0 none g-205 BC Nucleus-free 1 197 g-206 B Nucleus 0 none g-207 B Nucleus 1 197 g-208 AC Nucleus 0 197 210 g-209 A Nucleus 1 197 g-210 AC Nucleus 0 none h-211 B Nucleus 0 none h-212 B Nucleus 0 none h-213 C Nucleus-free 0 197 h-214 BC Nucleus-free 1 none h-215 BC Nucleus-free 0 none h-216 B Nucleus 0 none h-217 B Nucleus 0 197 h-218 C Nucleus-free 1 none h-219 B Nucleus 0 none h-220 B Nucleus 0 none h-221 B Nucleus 0 none h-222 C Nucleus-free 1 197 h-223 B Nucleus 0 none h-224 C Nucleus-free 0 197 h-225 BC Nucleus-free 1 197 h-226 B Nucleus 0 none h-227 B Nucleus 0 none h-228 B Nucleus 1 none h-229 C Nucleus-free 0 none h-230 C Nucleus-free 1 197 210 h-231 BC Nucleus-free 1 197 210 h-232 C Nucleus-free 1 197 h-233 C Nucleus-free 1 197 h-234 C Nucleus-free 1 197 210 h-235 AB Nucleus 0 none h-236 B Nucleus 0 none h-237 B Nucleus 0 none h-238 B Nucleus 0 none h-239 B Nucleus 0 none h-240 BC Nucleus-free 1 197 210 h-241 C Nucleus-free 1 197 210 i-242 B Nucleus none 197 i-243 BC Nucleus-free 1 197 210 i-244 C Nucleus-free 1 197 i-245 BC Nucleus-free 1 197 210 i-246 BC Nucleus-free 0 none i-247 B Nucleus 0 none i-248 B Nucleus 0 none i-249 B Nucleus 0 none i-250 BC Nucleus-free 1 197 210 i-251 BC Nucleus-free 1 197 210 i-252 B Nucleus 0 none i-253 B Nucleus 1 none i-254 B Nucleus 0 none i-255 B Nucleus 0 none i-256 BC Nucleus-free 0 197 i-257 BC Nucleus-free 1 197 210 i-258 BC Nucleus-free 1 none i-259 B Nucleus 0 none i-260 B Nucleus 0 none i-261 BC Nucleus-free 1 197 i-262 BC Nucleus-free 0 197 210 i-263 B Nucleus 0 none i-264 BC Nucleus-free 0 none i-265 B Nucleus 0 197 i-266 BC Nucleus-free 1 197 i-267 BC Nucleus-free 1 197 i-268 B Nucleus 0 none i-269 BC Nucleus-free 0 197 i-270 B Nucleus 0 none i-271 B Nucleus 0 none i-272 B Nucleus 0 none i-273 B Nucleus 0 none i-274 B Nucleus 0 none i-275 BC Nucleus-free 0 none i-276 BC Nucleus-free 1 197 i-277 BC Nucleus-free 1 197 210 i-278 AC Nucleus-free 1 none i-279 BC Nucleus-free 1 197 i-280 BC Nucleus-free 1 197 i-281 B Nucleus 1 197 i-282 B Nucleus 0 197 210 i-283 B Nucleus 0 none i-284 BC Nucleus-free 1 197 210 i-285 B Nucleus 0 none Figure 1The results in Table 2 show that, in Comparative Example 1, the amplification of the PRO marker resulted in the amplification of specific locus bands in all 285 offspring plants from the 9 hybrid combinations. Of these, 125 samples exhibited the nucleus-less phenotype, and 160 exhibited the nucleus-containing phenotype. Field phenotypic surveys revealed that 109 offspring plants had the nucleus-less phenotype, and 193 had the nucleus-containing phenotype. When the PRO marker was validated alone, the nucleus-less genotyping detection rate for each of the 7 combinations ranged from 88.89% to 95.24%, the abnormal nucleus-less detection rate ranged from 2.04% to 12.90%, and the marker phenotypic detection accuracy rate ranged from 83.87% to 89.80%. In Comparative Example 2, when the INS marker was validated alone, the nucleus-less genotyping detection accuracy rate for each of the 7 combinations ranged from 66.67% to 90.48%, the marker phenotypic detection accuracy rate ranged from 73.47% to 87.10%, and the abnormal nucleus-less detection rate ranged from 4.08% to 11.36%. When the CDS markers in Comparative Example 3 were validated individually, the accuracy rates for nucleus genotyping detection in each of the seven pairs of combinations were 66.67–80.95%, for marker trait detection were 67.35–81.81%, and for nucleus genotyping anomalies were 7.14–14.29%. Compared to Comparative Example 1, which only analyzed the PRO markers, Example 1 achieved nucleus genotyping detection accuracy rates of 90.48–100%, for marker trait detection accuracy rates of 90.32–96.42%, and for nucleus genotyping anomalies of 0–4.54%. The nucleus genotyping detection rate of the population increased by up to 5 percentage points, with groups b, d, and e reaching a maximum of 100%. The accuracy rates for marker trait detection in each group of the population all improved, with a maximum increase of 7 percentage points, and all seven groups reaching over 90%. The nucleus genotyping anomaly rate of the population decreased, dropping to a minimum of 0%, and groups b, d, and e were able to detect all plants with nucleus genotyping traits. Based on the PRO marker, the combination of amino acid mutation sites in the promoter regions INS and CDS of VvAGL11 was used to identify the seedless trait in hybrid populations and seedling progeny. The results showed that the combined marker of the present invention can effectively optimize and improve the efficiency of single marker identification of seedless trait in grapes, effectively improve the identification accuracy, and expand the prediction range of seedless trait in grapes.

[0031] Example 2: (1) To verify the identification effect of the combined marker in grape seedlings, the 'Kyoho' grape variety was used as the test material, and the seeds were germinated to cultivate seedlings.

[0032] (2) When the grape vine has developed to 5-7 leaves, collect young leaf samples to extract DNA and RNA (reverse transcribe into cDNA).

[0033] (3) Predict offspring traits by combining markers.

[0034] in accordance with Figure 2 The preparation process of A in the figure utilizes INS+CDS combined labeling. Figure 2Forty-eight seedlings of Kyoho grapes, verified by PRO as fully nucleated, were tested, and the results are shown in Table 3. The combined markers of this invention successfully detected two individuals with the nucleus-free trait (numbered 7 and 11), demonstrating that it can expand the detection range of the nucleus-free trait, enabling in-depth detection and avoiding missed detection of individuals with the target trait. This allows for better application in molecular marker-assisted breeding, providing strong technical support for the cultivation of nucleus-free varieties.

[0035] Table 3: Identification results of the PRO-verified nucleated population serial number PRO predicts seed type INS CDS 1 Nucleus 1 none 2 Nucleus 0 197 3 Nucleus 0 none 4 Nucleus 1 none 5 Nucleus 0 none 6 Nucleus 0 197 210 7 Nucleus 1 197 8 Nucleus 0 none 9 Nucleus 0 none 10 Nucleus 1 none 11 Nucleus 1 197 12 Nucleus 0 197 13 Nucleus 0 197 210 14 Nucleus 0 none 15 Nucleus 1 none 16 Nucleus 0 197 17 Nucleus 0 none 18 Nucleus 0 197 19 Nucleus 0 none 20 Nucleus 0 none 21 Nucleus 0 197 22 Nucleus 0 none 23 Nucleus 0 none 24 Nucleus 1 none 25 Nucleus 0 none 26 Nucleus 0 none 27 Nucleus 0 none 28 Nucleus 0 none 29 Nucleus 0 none 30 Nucleus 0 none 31 Nucleus 0 none 32 Nucleus 0 none 33 Nucleus 1 none 34 Nucleus 0 197 35 Nucleus 0 197 36 Nucleus 0 197 37 Nucleus 0 none 38 Nucleus 0 none 39 Nucleus 0 none 40 Nucleus 1 none 41 Nucleus 0 197 210 42 Nucleus 0 197 43 Nucleus 0 197 44 Nucleus 0 none 45 Nucleus 0 none 46 Nucleus 0 none 47 Nucleus 0 none 48 Nucleus 0 none Example 3: Thirty-seven grape germplasm samples were taken and identified using PRO+INS, PRO+CDS, and INS+CDS markers, respectively. The results are shown in Table 4.

[0036] Table 4: Information and identification results of 37 grape samples Serial Number name Seed type CDS area Genotyping INS population 1 Hanazawa No. 1 Nucleus-free 197、210 C 1 Europe and America 2 Autumn Honey Nucleus-free 197、210 C 1 Europe and America 3 Rose of Royal Nucleus 197 BC 0 Europe and America 4 Jade Seedless Nucleus-free 197 AB 0 Europe and America 5 Zheng Guo No. 8 Nucleus-free 197 C 1 Eurasia 6 Miss Huang Nucleus-free 197 C 1 Eurasia 7 Chachivach Nucleus-free 197、210 C 1 Eurasia 8 Black Karas Nucleus 197、210 C 1 Eurasia 9 Karmanshi Nucleus-free 210 C 1 Eurasia 10 Bai Shani Nucleus-free 197、210 BC 0 Eurasia 11 Miss Hei Nucleus 197、210 C 1 Eurasia 12 Italian Rose Nucleus none B 0 Eurasia 13 Black Sababas Nucleus-free none BC 0 Eurasia 14 donkey milk Nucleus-free none C 1 Eurasia 15 Long spike, seedless white Nucleus-free none C 1 Eurasia 16 Large, seedless purple (red) Nucleus-free 197 BC 0 Eurasia 17 Red Seedless Dew Nucleus-free 197 C 1 Eurasia 18 Pfal Nucleus-free 197、210 C 1 Eurasia 19 White kernel Nucleus-free none C 1 Europe and America 20 Yang Geer Nucleus-free 197、210 C 1 Eurasia 21 Barbarossa Nucleus-free 197、210 C 1 Eurasia 22 Seedless white chicken heart Nucleus-free none C 1 Eurasia 23 Soso grapes Nucleus-free none BC 1 Eurasia 24 Mona Lisa without a core Nucleus-free none C 1 Europe and America 25 Ruby without a core Nucleus-free none C 1 Eurasia 26 Brown without a core Nucleus-free none C 1 Europe and America 27 Wei Ke Nucleus none AC 0 Eurasia 28 Gao Mo Nucleus none B 0 Europe and America 29 Jufeng Nucleus none AB 0 Europe and America 30 Jingfeng nuclear-free Nucleus-free none C 1 Eurasia 31 Red face, kernelless Nucleus-free 197 C 1 Eurasia 32 White Rosa Nucleus none AC 0 Eurasia 33 Seedless white Nucleus-free 197、210 C 1 Eurasia 34 Zijin Early Birth Nucleus-free 197 C 1 Europe and America 35 Golden Field Royal Seedless Nucleus-free 197 C 1 Eurasia 36 Queen of the Vineyards Nucleus 197 C 1 Eurasia 37 Kyoho Akira Nucleus-free 197、210 C 1 Eurasia Table 4 shows that: ① When the PRO marker and INS identification results are the same, the combined PRO+CDS nucleus-free typing detection rate is 96.15% (25 / 26), and the phenotypic detection accuracy is 96.67% (29 / 30). ② When the PRO and CDS identification results are the same, the combined PRO+CDS nucleus-free typing detection rate is 100% (18 / 18), and the phenotypic detection accuracy is 95.65% (22 / 23). ③ When the INS and CDS are the same, the combined INS+CDS nucleus-free typing detection rate is 94.11% (16 / 17), and the phenotypic detection accuracy is 95.24% (20 / 21). Combined with Examples 1 and 2, it can be seen that the detection rate and accuracy of the combined molecular markers of the present invention are significantly higher than those of single molecular markers.

[0037] For those skilled in the art, various other corresponding changes and modifications can be made based on the technical solutions and concepts described above, and all such changes and modifications should fall within the protection scope of the claims of this invention.

Claims

1. A molecular marker composition for identifying seedless characteristics in grapes, characterized in that, This includes sequence tag site molecular markers for the VvAGL11 gene with the sequence shown in SEQ ID NO.1, insertion fragment markers for the promoter region with the sequence shown in SEQ ID NO.2, and amino acid mutation site markers for the coding region with the sequence shown in SEQ ID NO.

3.

2. The molecular marker composition according to claim 1, characterized in that, The coding region is mutated at position 197 or at positions 197 and 210 simultaneously.

3. A primer for the molecular marker composition of claim 1, characterized in that, The primers used to amplify the promoter region include primer pairs with sequences as shown in SEQ ID NO.4 and SEQ ID NO.

5.

4. The primers of the molecular marker composition according to claim 3, characterized in that, The primers used to amplify the coding region include primer pairs with sequences as shown in SEQ ID NO.6 and SEQ ID NO.

7.

5. A product comprising the primer of claim 3 or 4, characterized in that, This includes reagents, reagent kits, or chips.

6. The use of the molecular marker composition of claim 1 in seedless grape breeding.

7. A method for identifying the seedless trait of grapes, characterized in that, Includes the following steps: DNA, RNA, and cDNA samples of grapes to be tested are prepared and amplified using the primers described in claim 3 or 4; after amplification, the promoter region labeling, insertion fragment labeling, and coding region labeling are compared and analyzed, and the nucleus-free trait is identified based on the consistency of the results.

8. The identification method according to claim 7, characterized in that, If any two or three of the three markings show that the grapes being tested have seeds, then the grapes being tested are seeded varieties; if any two or three of the markings show that the grapes are seedless, then the grapes being tested are seedless varieties.

9. The identification method according to claim 7, characterized in that, The grape samples include one or both of the hybrid or self-crossed samples.

Images