Molecular marker for on-site rapid sex determination of stichopus japonicus whole life history, kit and application
By developing molecular markers and kits for rapid on-site sex identification of sea cucumbers throughout their entire life cycle, and utilizing LAMP isothermal amplification technology and fluorescent dye colorimetric indicators, the problem of time-consuming and labor-intensive traditional methods has been solved. This enables rapid, non-destructive, and accurate sex identification at all stages from larvae to adult sea cucumbers, meeting the rapid identification needs of aquaculture sites.
Patent Information
- Application Number
- CN202610106861.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-27
- Publication Date
- 2026-02-27
- Estimated Expiration
- 2046-01-27
AI Technical Summary
Existing technologies cannot achieve rapid and non-destructive sex identification at all stages of the sea cucumber's life cycle. Traditional methods are time-consuming, labor-intensive, and difficult to apply in aquaculture sites, failing to meet the industry's demand for rapid identification.
A molecular marker and kit for rapid on-site sex identification of sea cucumbers throughout their entire life cycle has been developed. The kit utilizes specific molecular markers and LAMP isothermal amplification technology for sex identification, and combines fluorescent dye colorimetric indicators to achieve visual interpretation of the results. It is applicable to sex identification at all stages from larva to adult sea cucumber.
It enables rapid, non-destructive, and accurate sex identification at all stages from larvae to adult ginseng, meeting the rapid identification needs of breeding sites and improving the efficiency of parent selection and germplasm resource management.
Smart Images

Figure CN121575150A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular genetics technology and relates to molecular markers, reagent kits and applications for rapid on-site sex identification of sea cucumbers throughout their entire life cycle. Background Technology
[0002] sea cucumber ( Apostichopus japonicus Sea cucumbers, also known as pseudo-sea cucumbers, are a marine aquaculture species with high economic value. However, sea cucumbers are dioecious, lacking significant sexual dimorphism in their external morphology, making it impossible to distinguish males and females by appearance alone. Currently, traditional sex determination methods in industry and research mainly rely on the dissection of sexually mature individuals, observing the morphological characteristics of the gonads or tissue sections under a microscope. However, this method requires the manual dissection of live sea cucumbers to remove the gonads, which is time-consuming and labor-intensive, and not conducive to parent selection and live breeding. Furthermore, it is difficult to effectively identify sex in juveniles, young sea cucumbers, and early-aged adult sea cucumbers with undifferentiated or immature gonads. It also cannot meet the demand for rapid and non-destructive sex determination in aquaculture settings. Therefore, existing technologies have become a key technological bottleneck restricting the progress of sea cucumber genetic breeding, large-scale cultivation of single-sex populations, and precision aquaculture management. In industry, there is an urgent need to develop a rapid and non-destructive sex determination technology solution applicable to the entire life cycle of sea cucumbers, which can be quickly implemented in aquaculture settings and includes a kit. This technology needs to be able to accurately identify sex at the molecular level, eliminate dependence on gonadal maturity, and be applicable to all developmental stages from tiny larvae to adult sea cucumbers, thus providing a core tool for the innovation of sea cucumber germplasm resources, the breeding of superior varieties, and the establishment of efficient farming models. Summary of the Invention
[0003] The purpose of this invention is to provide molecular markers, reagent kits, and applications for rapid on-site sex identification of sea cucumbers throughout their entire life cycle.
[0004] To achieve the above objectives, the present invention provides the following technical solution: Molecular markers for rapid on-site sex identification of sea cucumbers throughout their entire life cycle are shown in SEQ ID NO.1 of the sequence listing.
[0005] Furthermore, the sea cucumbers bearing the aforementioned molecular markers are male.
[0006] Furthermore, the present invention provides primers for sex identification of sea cucumber throughout its entire life cycle. These primers are PCR primers, and their nucleotide sequences are shown in SEQ ID NO.2 and SEQ ID NO.3 of the sequence listing; or the primers are a set of loop-mediated isothermal amplification detection primers, comprising outer primers CS-F3 and CS-B3, and inner primers CS-FIP and CS-BIP, and their nucleotide sequences are shown in SEQ ID NO.4-7 of the sequence listing, respectively.
[0007] Furthermore, the present invention provides the application of the aforementioned molecular markers, primers, and primer sets in any of the following: (1) Targeted breeding and production; (2) Breeding optimization; (3) Precision aquaculture management; (4) Prepare a reagent or kit for sex identification of sea cucumber with full life history.
[0008] Furthermore, the present invention also provides a kit for sex identification of sea cucumbers throughout their entire life cycle, wherein the kit contains the PCR primers or the loop-mediated isothermal amplification detection primer set described above.
[0009] Furthermore, the present invention also provides a method for sex determination of sea cucumber throughout its entire life cycle, the method comprising: (1) Extract genomic DNA from the sea cucumber to be tested; (2) Using the kit described above, the molecular marker is amplified using genomic DNA as a template; (3) Detect the amplification products to determine the sex of the sea cucumber to be tested.
[0010] Furthermore, the detection method for the amplified product in step (3) is selected from any one of turbidimetric method, fluorescence method, or agarose gel electrophoresis.
[0011] Furthermore, in step (3), when the amplification product is detected by fluorescence method, the amplification product that is violet or blue-purple is female, and the amplification product that is sky blue or dark sky blue is male.
[0012] This invention provides a specific molecular marker that can solve the problem of accurate sex identification in aquaculture. The invention utilizes LAMP isothermal amplification technology to amplify the identified male-specific DNA molecular markers of sea cucumbers with high sensitivity and specificity. The reaction system is premixed with fluorescent dyes or chromogenic indicators such as hydroxynaphthol blue (HNB). The binding of the amplification products with the dye causes significant changes in the turbidity or color of the solution, thereby enabling visually perceptible result interpretation and rapid on-site identification. Attached Figure Description
[0013] Figure 1 The results of amplification of the molecular markers provided in this embodiment of the invention using conventional PCR primers in male and female individuals of six different geographical populations of sea cucumber; wherein male and female samples 1-6 are sea cucumbers from populations A, B, C, D, E, and F, respectively; Figure 2The results of amplification of the molecular markers provided in this embodiment of the invention using conventional PCR primers in male and female individuals of six different geographical populations of sea cucumber; male and female samples 1-12 are sea cucumbers from populations A1, A2, B1, B2, C1, C2, D1, D2, E1, E2, F1, and F2, respectively; Figure 3 The image shows the effect of the rapid, non-destructive, and accurate sex identification kit for sea cucumbers developed using the LAMP method; (a) a reaction solution that is violet or blue-purple indicates a negative result (female sea cucumber); (b) a reaction solution that is sky blue or dark sky blue indicates a positive result (male sea cucumber); samples 1-12 are sea cucumbers from populations A1, A2, B1, B2, C1, C2, D1, D2, E1, E2, F1, and F2, respectively. Detailed Implementation
[0014] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments, but it is not limited thereto. Any modifications or equivalent substitutions to the technical solution of the present invention that do not depart from the spirit and scope of the technical solution of the present invention should be covered within the protection scope of the present invention.
[0015] I. Screening, Validation, and Acquisition of Specific Molecular Markers: To comprehensively cover the genetic diversity of sea cucumbers and ensure the universality of the screened molecular markers, this invention collected samples from six representative wild geographical populations (A, B, C, D, E, and F) in the Yellow and Bohai Seas. Approximately 30 healthy live sea cucumbers were randomly collected from each population.
[0016] The collected live specimens were immediately transported to the laboratory in icy seawater. Gonadal tissue was obtained from each individual through aseptic dissection. Preliminary sex determination was based on gonadal color: male gonads were milky white, while female gonads were orange-red or light orange-red. For further confirmation, paraffin sections of the gonadal tissue were prepared, stained with hematoxylin and eosin, and their histological structure was observed under an optical microscope to accurately identify the sex of each sea cucumber. Muscle tissue samples from all dissected individuals were preserved at -80°C for genomic DNA extraction.
[0017] Five males and five females, verified by dissection and microscopic observation, were selected from each geographic population, totaling 60 samples. High-quality genomic DNA was extracted from their muscle tissue using a marine animal tissue genomic DNA extraction kit. The absorbance of the DNA samples at 260 nm and 280 nm was measured using an ultra-micro spectrophotometer to ensure OD... 260 / OD 280A ratio between 1.8 and 2.0 indicates extremely low levels of contaminants such as proteins. Furthermore, DNA integrity was assessed using 1.0% agarose gel electrophoresis, confirming a clear main band without significant degradation.
[0018] Subsequently, equal amounts of DNA from 30 male individuals from all geographic populations were mixed thoroughly to construct a male DNA pool. Similarly, equal amounts of DNA from 30 female individuals were mixed to construct a female DNA pool. This step aims to efficiently screen for sex-differentiated sequences at the population level using a pooled sequencing strategy.
[0019] Library preparation was performed on DNA samples from both the male and female pools. The Illumina NovaSeq high-throughput sequencing platform was used, employing a paired-end 150 bp sequencing strategy. The sequencing data from each pool was required to ensure an average genome coverage depth of at least 50×. After filtering, the raw sequencing data were required to achieve a high-quality data ratio of Q20 ≥ 95% and Q30 ≥ 90%.
[0020] Using our team's published chromosome-level female sea cucumber reference genome (C-1) as a reference, we aligned all sequencing reads from the male pool using BWA software. We then extracted all male pool reads that failed to align to the female reference genome using SAMtools software, resulting in approximately 79,416,595 unaligned reads.
[0021] Using SOAPdenovo software, the K-mer value was set to 31. The unaligned reads were de novo assembled to generate a set of contigs representing male-specific or enriched sequences, named the male-enriched genome draft (X-1). All sequencing reads from the female pool were aligned with X-1, and female reads that failed to align in X-1 were extracted; their corresponding contig set was denoted as female-potentially-specific sequences (C-2). To exclude false positive sequences in C-2 caused by sequencing or alignment errors, they were BLASTN aligned with the original female reference genome C-1. A filtering criterion was set: if the alignment length of a contig with F-1 exceeded 60% of its own length, the sequence was considered to actually exist in the female genome and was removed. The remaining sequence set after filtering was denoted as high-strict female exclusion sequences (C-3). Subsequently, independent sequencing data from male individuals (X-2) were randomly selected and aligned with X-1. The sequencing coverage depth of each contig was calculated, and a set of contigs with a coverage depth greater than 20× was selected and denoted as male high-coverage sequences (X-3). The intersection of C-3 and X-3 sequences was calculated. This intersection sequence could not be located in females but was stably highly expressed in males, and therefore was identified as a high-confidence male-specific candidate genome sequence, resulting in 981 candidate contigs.
[0022] 981 candidate contig sequences were BLASTN aligned with both the male sea cucumber chromosome-level reference genome and the female reference genome owned by our team. Contigs that uniquely aligned to the male genome and showed no significant match with the female genome (no alignment results or extremely short alignment length) were selected. This rigorous screening yielded 18 strictly specific contigs. These 18 contigs were further screened, removing sequences that were too short or had abnormal adenine-thymine base content. Finally, three high-quality candidate molecular markers with appropriate sequence length and normal base composition were retained.
[0023] Using Primer Premier 5.0 software, specific PCR primers were designed for the three candidate sequences mentioned above. Design principles included: primer length 18-22 bp, annealing temperature (Tm value) 58-62°C, GC content 40-60%, amplification product length controlled at 200-500 bp, and ensuring no hairpin structures or dimers formed between or within the primers themselves. DNA from one male and one female of known sex from each of six geographical populations (a total of 12 samples) was used as templates for PCR amplification verification. The reaction system (20 μL) contained: 2 μL of 10× PCR Buffer, 1.6 μL of dNTPs (2.5 mM each), 0.8 μL each of upstream and downstream primers (10 μM), 0.2 μL of Taq DNA polymerase (5 U / μL), 1 μL of template DNA (50 ng / μL), and ddH2O added to the final volume. The reaction procedure was as follows: 94°C pre-denaturation for 5 min; 35 cycles (94°C denaturation for 30 s, 58-60°C annealing for 30 s, 72°C extension for 45 s); 72°C final extension for 5 min. PCR products were separated by 2.0% agarose gel electrophoresis and observed under a UV gel imaging system. The results showed that only one marker (SEQ ID NO.1) consistently amplified a clear, single, and specific band in all six male samples, while no amplification products were found in any of the female samples, as shown in Figure 1.
[0024] II. Amplification and Stability Assessment of Specific Molecular Markers: To systematically evaluate the stability, specificity, and universality of the aforementioned specific molecular marker (SEQ ID NO.1) and its primers (SEQ ID NO.2, SEQ ID NO.3) in different geographic populations, four live sea cucumbers (2 females and 2 males) were randomly selected from each of six wild geographic populations (A, B, C, D, E, and F), for a total of 24 individuals (12 females and 12 males). Genomic DNA was extracted from the muscle of each sample according to standard procedures, and its concentration, purity, and integrity were detected using Nanodrop and agarose gel electrophoresis to ensure that all templates met the requirements for subsequent PCR amplification. Subsequently, a 15 μL reaction mixture was prepared in a 0.2 mL sterile PCR tube: 1 μL DNA template, 0.5 μL each of forward and reverse primers, 5.5 μL sterile water, and 7.5 μL Taq enzyme. After preparation, place the reaction tube in the PCR instrument and execute the following program: 94℃ pre-denaturation for 5 min; 94℃ for 30 s, 68℃ for 30 s, 72℃ for 30 s, 35 cycles; 72℃ extension for 10 min.
[0025] PCR products were collected and separated by electrophoresis on a 2.0% agarose gel. UV gel imaging showed that all 12 male individuals exhibited a clear, single, specific band at the expected size position (approximately 233 bp). However, no amplified band was observed in the lanes of any of the 12 female individuals. Figure 2 As shown, this demonstrates that the sex-specific molecular marker SEQ ID NO.1 and its primers SEQ ID NO.2 and SEQ ID NO.3 of sea cucumber possess high reliability.
[0026] III. LAMP kit primer design, operation method and validation: Based on the aforementioned validated male-specific molecular marker (SEQ ID NO.1), this invention further developed a matching loop-mediated isothermal amplification detection system. Although existing conventional PCR technology can achieve molecular sex identification, it relies on a precision thermal cycler, has a lengthy process, is complex to operate, and is costly, making it difficult to apply in non-laboratory environments such as breeding workshops, hatcheries, or the wild.
[0027] In comparison, loop-mediated isothermal amplification (LAMP) technology has significant advantages: the reaction is carried out at an isothermal temperature, requiring only simple equipment such as a water bath; 4-6 primers can be designed for multiple regions of the target, and the specificity and sensitivity are generally higher than PCR; the amplification byproduct magnesium pyrophosphate precipitation or dye development can visualize the results, eliminating the need for open-top electrophoresis. These characteristics make it a perfect fit for the detection requirements of "on-site, rapid, and convenient". Currently, there are no publicly reported LAMP sex identification kits for the entire life cycle of sea cucumbers. Therefore, the development of this kit aims to fill this technological gap and establish a simple, easy-to-use, and visually interpretable on-site sex identification solution covering all stages from larva to adult sea cucumbers.
[0028] The conserved region of SEQ ID NO.1, a previously validated male-specific molecular marker for sea cucumber, was used as the target sequence. Primers were designed using the professional software PrimerExplorer V5. Four primers (outer primers CS-F3 and CS-B3, and inner primers CS-FIP and CS-BIP) were designed targeting the specific region of the molecular marker SEQ ID NO.1. The sequences of the primers are as follows: CS-F3: GCGAAGAATCTTGACAGAC, SEQ ID NO.4; CS-B3: TGTTAGCTTTGAATAAGGTTCA, SEQ ID NO.5; CS-FIP: GAGCAATCACTCGTAGTACCTTATTAGCTGTAATGAAGAAACATCC, SEQ ID NO.6; CS-BIP:ATTGACAGCAAAAGTTGATAGAGCTCACACCCTAAAAAAGCAACC, SEQ ID NO.7.
[0029] Twenty-four sex-determined sea cucumber individuals (12 females and 12 males) selected for the aforementioned specific molecular marker amplification validation were used. Approximately 5 mg of regenerable tissue (such as tube foot tips, parapodia, or micro-body sections) was obtained from live sea cucumbers using sterile instruments (scissors, scalpels, forceps, etc.) to ensure minimal damage to the individual. The tissue samples were placed in 1.5 mL or 2.0 mL sterile centrifuge tubes, and 30 μL of sterile nuclease-free water was added. The tissues were thoroughly homogenized using a disposable sterile pestle until a homogenate was formed. The mixture was allowed to stand at room temperature for 2–5 minutes, followed by centrifugation at 3,000–5,000 rpm for 1 minute. Two μL of the supernatant was used directly as the DNA template for the LAMP reaction.
[0030] Prepare a 20 μL reaction mixture in a 0.2 mL sterile PCR tube on ice or at room temperature (preferably below 25°C): 10 μL 2×LAMP Master Mix with UDG, 1 μL Bst DNA Polymerase, 2 μL primer mixture (containing 2 μM each of CS-F3 and CS-B3, and 16 μM each of CS-FIP and CS-BIP), 2 μL DNA template (supernatant), and 5 μL sterile nuclease-free water. Then, gently pipette to mix the reaction mixture and centrifuge to allow the liquid to settle at the bottom of the tube. A constant temperature water bath or portable metal bath can be used for the reaction. Before placing the tube in the water bath, add 20 μL of mineral oil to the reaction mixture to prevent evaporation. Place the 0.2 mL sterile PCR tube in a heated instrument and immediately raise the temperature to 61°C. Incubate at this temperature for 60-70 minutes. After the reaction, remove the PCR tube and allow it to stand at room temperature for approximately 1 minute. Against a white background, observe the color change of the reaction solution with the naked eye: a clear sky blue or dark sky blue indicates a male sea cucumber; a reaction solution that retains its original violet or bluish-purple color indicates a female sea cucumber.
[0031] The reaction solution for all 12 male samples turned sky blue; the reaction solution for all 12 female samples remained violet. The test results were completely consistent with the known sex, with an accuracy of 100%. Figure 3 As shown.
Claims
1. Molecular markers for rapid on-site sex identification of sea cucumber throughout its entire life cycle, characterized by: Its nucleotide sequence is shown in SEQ ID NO.1 of the sequence listing.
2. The molecular marker for rapid on-site sex identification of sea cucumber with its entire life cycle as described in claim 1, characterized in that: Sea cucumbers bearing the aforementioned molecular marker are male.
3. Primers for sex determination of sea cucumber throughout its entire life cycle, characterized by: The primers are PCR primers, and their nucleotide sequences are shown in SEQ ID NO.2 and SEQ ID NO.3 of the sequence listing; or the primers are a loop-mediated isothermal amplification detection primer set, which includes outer primers CS-F3 and CS-B3, and inner primers CS-FIP and CS-BIP, and their nucleotide sequences are shown in SEQ ID NO.4-7 of the sequence listing, respectively.
4. The use of the molecular marker according to claim 1 or 2 in any of the following: (1) Targeted breeding and production; (2) Breeding optimization; (3) Precision breeding management.
5. The use of the primer according to claim 3 in any of the following: (1) Targeted breeding and production; (2) Breeding optimization; (3) Precision aquaculture management; (4) Prepare a reagent or kit for sex identification of sea cucumber with full life history.
6. A reagent kit for determining the sex of sea cucumbers throughout their entire life cycle, characterized in that: The kit contains the PCR primers or loop-mediated isothermal amplification detection primer set as described in claim 3.
7. A method for sex determination of sea cucumber throughout its entire life cycle, characterized in that, The method includes: (1) Extract genomic DNA from the sea cucumber to be tested; (2) Using the kit of claim 6, amplification of the molecular marker of claim 1 is performed using genomic DNA as a template; (3) Detect the amplification products to determine the sex of the sea cucumber to be tested.
8. The method according to claim 7, characterized in that: The detection method for the amplified product in step (3) is selected from any one of turbidimetric method, fluorescence method, or agarose gel electrophoresis.
9. The method according to claim 8, characterized in that: In step (3), when the amplification product is detected by fluorescence method, the amplification product that is violet or blue-purple is female, and the amplification product that is sky blue or dark sky blue is male.
Citation Information
Patent Citations
Apostichopus japonicus whole genome 30K liquid phase breeding chip and application thereof
CN116497124A
Apostichopus japonicus gender specific molecular marker, primer pair, kit, application and identification method
CN118086537A
Molecular marker for sex identification of apostichopus japonicus and use thereof
US20250101515A1
Specific primers, identification method and kit for rapid stichopus monotuberculatus sex determination
WO2021147450A1