Molecular marker for identifying resistance of meloidogyne incognita disease and application of molecular marker

Abstract

The invention belongs to the technical field of plant molecular breeding, and particularly relates to a molecular marker for identifying southern root knot nematode disease resistance and application of the molecular marker. The molecular marker provided by the invention targets a functional site c.1075A / C of a soybean nematode-resistant key gene GmLMM1, and the site variation leads to the change of encoded amino acid from asparagine to histidine. The KASP primer group designed based on the site can quickly and accurately identify a disease-resistant C / C homozygous type, a susceptible A / A homozygous type and an A / C heterozygous type. According to the molecular marker tool provided by the invention, the accuracy of meloidogyne incognita resistant breeding can be remarkably improved, the screening efficiency of resistant materials is improved, the breeding period is effectively shortened, and an efficient and reliable technical means is provided for soybean meloidogyne incognita resistant breeding.

Description

Technical Field

[0001] This invention belongs to the field of plant molecular breeding technology, specifically relating to a molecular marker for identifying resistance to southern root-knot nematode disease and its application. Background Technology

[0002] Plant parasitic nematodes (especially the southern root-knot nematode *Meloidogyne incognita*) are important pathogens of soybean [*Glycinemax (L.) Merrill*], causing yield losses of 30%–70% or even total crop failure. Chemical control pollutes the environment, and agricultural control has limited applicability; therefore, developing resistant varieties has become the core approach. In plant innate immunity, the FERONIA (FER) receptor kinase of the CrRLK1L family regulates immunity through interaction with rapid alkalizing factors (RALFs). Nematodes can secrete RALF-like proteins that target FER to suppress host immunity and promote infection. Recent studies have shown that the soybean *Glycinemax (L.) Merrill* gene participates in the regulation of resistance to the southern root-knot nematode. This gene encodes a malectin-like receptor kinase, homologous to the *Arabidopsis thaliana* *FERONIA* gene, and is a key gene for resistance to the southern root-knot nematode. Sequence analysis of the GmLMM1 gene coding region of 232 soybean varieties identified four SNP sites, three of which were non-synonymous mutations (p.T9P, p.T40N, and p.N359H). Based on these three mutations, soybean varieties were classified into five haplotypes (H1-H5). Further nematode inoculation experiments on 27 representative varieties confirmed that varieties carrying only haplotypes H3 and H5 exhibited significantly enhanced resistance to southern root-knot nematodes, with significantly lower numbers of parasitic nematodes compared to haplotypes H1, H2, and H4. The p.N359H mutation was identified as the key variation site affecting soybean nematode resistance. This mutation, located at c.1075 in the GmLMM1 gene coding region, is an A / C single nucleotide variant that changes the encoded amino acid from asparagine (N) to histidine (H) (i.e., N359H), thereby altering soybean resistance to southern root-knot nematodes. The SNP genotype and phenotype are clearly correlated: C / C homozygotes are nematode resistant, which is the core breeding goal; A / A homozygotes are susceptible to southern root-knot nematodes. Currently, the application of the GmLMM1 gene in breeding relies on two pathways: "resistance-source hybridization" and "transgenic introduction," but both have bottlenecks: traditional phenotypic identification needs to be completed at the adult stage, which is time-consuming and easily affected by environmental interference; there is a lack of precise typing tools at the seedling stage, making it difficult to efficiently screen for the core-value C / C homozygous haplotypes (corresponding to H3 and H5 resistance haplotypes); transgenic line identification relies on complex processes such as PCR and protein detection, which cannot quickly distinguish gene integration types, resulting in low screening efficiency. KASP (competitive allele-specific PCR) technology has the advantages of high throughput, precision, and speed, and can directly type through fluorescence signals, making it suitable for seedling stage detection. However, there is currently a lack of specific KASP markers for the c.1075A / C site of the GmLMM1 gene, which restricts the breeding application of this gene. Therefore, developing KASP molecular markers that target this key site and can rapidly distinguish genotypes is crucial for improving the breeding efficiency of soybeans resistant to southern root-knot nematodes. Summary of the Invention

[0003] The purpose of this invention is to overcome the core problems in existing soybean southern root-knot nematode resistance breeding technology, such as long disease resistance identification cycle, difficulty in quickly and accurately determining GmLMM1 genotype at the seedling stage, and low screening efficiency of resistant materials. This invention provides a KASP molecular marker targeting the GmLMM1 gene specific functional SNP site and its application method, which enables efficient and accurate typing of the superior resistance allele of GmLMM1, and rapid screening of breeding target materials that have both nematode resistance characteristics and superior agronomic phenotypes.

[0004] To achieve the above objectives, the present invention is implemented through the following solution:

[0005] This invention provides a KASP molecular marker for identifying resistance to southern root-knot nematode disease, wherein the molecular marker targets the SNP site located at position 1075 of the complete CDS sequence of the wild-type GmLMM1 gene.

[0006] In this invention, the molecular marker targets the SNP site of the soybean GmLMM1 gene that is specific for resistance to southern root-knot nematodes. This SNP site is located at position 1075 of the complete CDS sequence of the soybean wild-type GmLMM1 gene (as shown in SEQ ID NO.1), corresponding to the c.1075A / C single nucleotide variant in the coding region (A for wild-type and C for mutant). This variant is one of the three non-synonymous mutations (p.T9P, p.T40N, p.N359H) in the coding region of the GmLMM1 gene, and is a key functional variant that determines the resistance of soybean to southern root-knot nematodes. Soybean varieties containing this variant, such as the H3 and H5 haplotypes, have significantly better resistance to nematodes than other haplotypes.

[0007] In the corresponding disease-resistant GmLMM1 allele, the c.1075 site is a specific C base (a characteristic of the mutant CDS sequence), which changes the codon at position 359 of SEQ ID NO.2 (the complete GmLMM1 protein sequence) that originally encodes asparagine (N, wild type) to encode histidine (H, mutant type), i.e., the amino acid mutation N359H. The mutant protein sequence (H at position 359 of SEQ ID NO.2) can block the binding of nematode MiRALF1 to GmLMM1 protein, which is a key functional basis for soybean nematode resistance.

[0008] SEQ ID NO.1:

[0009]

[0010] SEQ ID NO.2:

[0011] *。

[0012] The present invention also provides a set of KASP primers for detecting the SNP site of claim 1, the KASP primer set comprising:

[0013] The nucleotide sequence of the upstream mutant (C) allele-specific primer Lmm1-HEX is shown in SEQ ID NO.3, with a HEX fluorescent tag attached to the 5' end, which binds only to the mutant allele;

[0014] The nucleotide sequence of the upstream wild-type (A) allele-specific primer Lmm1-FAM is shown in SEQ ID NO.4, with a FAM fluorescent tag attached to the 5' end, which binds only to the wild-type allele;

[0015] The nucleotide sequence of the downstream common primer Lmm1-Common of the KASP primer set is shown in SEQ ID NO.5. Its binding site is a conserved region flanking the SNP site, suitable for amplifying two alleles. This primer set can achieve electrophoretic-free differentiation of the three genotypes in a single PCR reaction system based on differences in fluorescence signals, supporting high-throughput batch detection.

[0016] SEQ ID NO.3:

[0017] GAAGGTCGGAGTCAACGGATTGCTGATGTTATGCAATGGAGCCACC;

[0018] SEQ ID NO.4:

[0019] GAAGGTGACCAAGTTCATGCTGCTGATGTTATGCAATGGAGCCACA;

[0020] SEQ ID NO.5:

[0021] TATCATTAGTTGCATAAGGATCCATCCGAA.

[0022] This invention also provides a method for detecting the GmLMM1 genotype, the method comprising the following steps:

[0023] (1) Extract genomic DNA from plant samples;

[0024] (2) Using the DNA as a template, KASP-PCR amplification was performed using the above-mentioned KASP primer set;

[0025] (3) Obtain fluorescence typing results through FAM and HEX fluorescence signals, and determine the genotype of soybean samples based on the fluorescence typing results.

[0026] In this invention, the genotype determination criteria in step (3) are as follows:

[0027] When only FAM fluorescence signal is present, the genotype is determined to be A / A homozygous, meaning it is susceptible to southern root-knot nematodes.

[0028] When only HEX fluorescence signal is present, the genotype is determined to be C / C homozygous, i.e., resistant to southern root-knot nematodes;

[0029] When both FAM and HEX fluorescence signals are present simultaneously, the genotype is determined to be A / C heterozygous.

[0030] This invention extracts trace amounts of genomic DNA from soybean seedling leaves during the detection process, which can meet the detection requirements without high-purity purification. The entire detection process can be completed within 1 to 3 days, significantly shortening the traditional identification cycle.

[0031] This invention also provides the application of the above-mentioned molecular markers, primer sets, or detection methods in molecular marker-assisted breeding of plants for resistance to southern root-knot nematode disease.

[0032] This invention also provides the application of the above-mentioned molecular markers, primer sets, or detection methods in the screening of plant germplasm resistant to southern root-knot nematodes.

[0033] This invention also provides the application of the above-mentioned molecular markers, primer sets, or detection methods in the identification of superior GmLMM1 allele-introduced materials.

[0034] The present invention also provides the application of the above-mentioned molecular markers, primer sets, or detection methods in the identification of transgenic plant lines, characterized in that the transgene includes the GmLMM1 gene c.1075A / C homologous SNP site.

[0035] The present invention also provides the application of the above-mentioned molecular markers, primer sets, or detection methods in the purity detection of plant disease-resistant varieties, characterized in that the disease-resistant varieties include those resistant to southern root-knot nematode disease.

[0036] In this invention, the plants include soybean and related genera of the legume family, Arabidopsis thaliana, wheat, rice, corn, cotton, and peanut.

[0037] This invention clarifies the core breeding application scenarios of the aforementioned markers and methods, covering the entire nematode resistance breeding chain. The KASP molecular markers of this invention can specifically address key issues at different breeding stages, with core applications including:

[0038] (1) Screening of germplasm resources of natural varieties

[0039] High-throughput typing of soybean natural variety libraries enables rapid screening of nematode-resistant germplasm containing C / C genotypes (H3 and H5 haplotypes). This allows for accurate identification of resistant materials without nematode inoculation, significantly reducing the cost of germplasm resource screening.

[0040] (2) Screening of hybrid offspring of GmLMM1 disease-resistant superior alleles

[0041] In F1 / F2 / BC1 and higher generation materials, HEX single fluorescence corresponding C / C homozygous types (resistance haplotype-related genotypes) can be directly screened without inoculating nematodes, which are ideal breeding materials, and the genetic background containing H3 and H5 resistance haplotypes can be accurately enriched.

[0042] (3) Identification of the purity of nematode-resistant varieties

[0043] In the breeding of disease-resistant varieties and seed production, batch testing of genotypes is used to monitor the purity of C / C homozygous types and whether susceptible individuals are mixed in, thus ensuring the genetic stability of varieties containing H3 and H5 resistant haplotypes.

[0044] The innovation of this invention lies in the first development of a dedicated typing tool targeting the key functional site c.1075A / C of the GmLMM1 gene (corresponding to the N359H mutation). This site is the core functional variation site of the H3 and H5 resistance haplotypes, which can block the interaction between the nematode MiRALF1 and the GmLMM1 protein, breaking the "genotype-phenotype-resistance" association barrier and providing a rapid, efficient, and standardized molecular detection solution for breeding soybeans resistant to southern root-knot nematode disease.

[0045] This invention is applicable primarily to soybean (especially soybean) plants within the genus *Glycine* of the legume family, specifically soybean germplasm resources (including materials containing H3 and H5 resistance haplotypes), hybrid offspring, and transgenic lines carrying the *GmLMM1* gene c.1075A / C homologous SNP site. For closely related legume genera such as common bean and pea, the invention can be applied after verifying the presence of functionally conserved SNP sites in their *GmLMM1* homologous genes. In this invention, the plants are monocotyledonous or dicotyledonous. These plants include, but are not limited to, soybean, *Arabidopsis thaliana*, wheat, rice, corn, cotton, and peanut.

[0046] Compared with existing technologies, the present invention has the following advantages:

[0047] (1) High genotyping accuracy: It can accurately distinguish the three GmLMM1 genotypes that are highly related to disease resistance and phenotype, and clearly identify the materials containing H3 and H5 resistance haplotypes and disease-susceptible haplotypes, so as to achieve accurate correspondence between genotype, phenotype and disease resistance, and avoid misjudgment caused by environmental factors.

[0048] (2) Significantly improved screening efficiency: It only takes a few days from seedling DNA extraction to genotype determination, which is at least 10 times more efficient than the conventional inoculation and identification method that takes 30 to 50 days, greatly shortening the breeding cycle.

[0049] (3) Wide range of applicable scenarios: covering the entire breeding chain, including natural germplasm screening, mutant hybridization breeding, segregation generation screening and variety purity monitoring, to meet the testing needs at different stages.

[0050] (4) Outstanding breeding value: It can capture the most valuable C / C homozygotes, accurately enrich the genetic background of H3 and H5 resistance haplotypes, and accelerate the breeding process of superior nematode-resistant varieties.

[0051] In summary, the KASP molecular marker and its application method provided by this invention can directly solve the problems of "difficulty in genotyping, long cycle, and low efficiency" in GmLMM1 breeding, and has clear innovation, practicality, and promotion value. Attached Figure Description

[0052] Figure 1 Here is a diagram showing the structure, SNP sites, and haplotype associations of the GmLMM1 gene:

[0053] The upper part of the figure shows the structure of the GmLMM1 gene (including 5'UTR, Exon1, Intron, Exon2, and 3'UTR); the middle part marks the bases, CDS positions, and corresponding amino acid mutations of three non-synonymous SNP sites (SNP I-III), among which SNP III (CDS 1075 A / C, N359H) is the core functional site; the lower part presents five haplotype SNP combinations (H1-H5), with haplotypes H3 and H5 containing the C base of SNP III site being excellent haplotypes against southern root-knot nematodes;

[0054] Figure 2 A schematic diagram of the primer structure and allele-specific recognition of the KASP molecular marker designed for this invention;

[0055] Mark the binding region and orientation of the upstream specific primer, and the downstream common primer;

[0056] Figure 3 KASP genotyping fluorescence scatter plot;

[0057] The horizontal axis of the figure represents the FAM fluorescence signal intensity, and the vertical axis represents the HEX fluorescence signal intensity. Blue clusters represent the C / C genotype (HEX monofluorescence), red clusters represent the A / A genotype (FAM monofluorescence), and green clusters represent the A / C genotype (dual fluorescence). The absence of crossover or ambiguity signals indicates accurate genotyping. Detailed Implementation

[0058] This invention aims to provide a KASP molecular marker targeting the functional SNP GmLMM1 and its application method. Its core application is in the screening of natural germplasm resources, genotyping of hybrid offspring, and detection of the purity of disease-resistant varieties in breeding for resistance to southern root-knot nematodes in soybean. Compared with traditional methods, this invention eliminates the need for artificial inoculation experiments with southern root-knot nematodes, allowing for precise genotyping directly at the soybean seedling stage, significantly shortening the breeding cycle and improving the efficiency of disease-resistant material screening. The technical solution of this invention is described in detail below with reference to the accompanying drawings, primer sequences, and specific embodiments.

[0059] The core target of this invention is the functional SNP site at position 1075 of the complete CDS sequence (SEQ ID NO.1) of the soybean GmLMM1 gene: the base at this site is A (wild type) in the susceptible type and C (mutant type) in the resistance-related type. This single nucleotide variation causes the amino acid at position 359 of the complete protein sequence (SEQ ID NO.2) encoded by the GmLMM1 gene to change from asparagine (N, wild type) to histidine (H, mutant type) (i.e., N359H). The mutant CDS sequence (C at position 1075 of SEQ ID NO.1) and the mutant protein sequence (H at position 359 of SEQ ID NO.2) are the core detection targets of the KASP marker in this invention and also the key screening targets for disease resistance breeding. The GmLMM1 gene encodes a malectin-like receptor kinase, which is homologous to the Arabidopsis feronavia gene and is a key susceptible gene for soybean infection by the southern root-knot nematode (Meloidogyne incognita). The nematode's secreted MiRALF1 can bind to GmLMM1, inhibiting the soybean immune response to promote parasitism. The c.1075A / C variant, as the only functional variant among the three non-synonymous mutations (p.T9P, p.T40N, p.N359H) in the GmLMM1 gene that determines nematode resistance, can block the aforementioned interaction process. Based on the analysis of 27 representative natural varieties selected from 232 soybean varieties, the H3 and H5 haplotypes containing this mutation showed significantly better nematode resistance than other haplotypes, and the correspondence between their genotype and phenotype has been confirmed through genetic verification (see appendix). Figure 1 (See diagram for GmLMM1 gene structure, SNP sites, and haplotype association).

[0060] Based on the aforementioned functional SNP sites, this invention constructs a complete technical system of "label-primer-detection-application," and the specific technical solution is as follows:

[0061] Firstly, the design and sequencing of KASP primer sets targeting SNP sites.

[0062] This invention targets the c.1075A / C site of the GmLMM1 gene. Using the KASP primer design principle (the last base at the 3' end of the primer matches an SNP site, and a universal fluorescent tag is attached to the 5' end), a specific primer set was designed, containing three primers. The specific sequences and modification information are as follows (primer binding modes are attached). Figure 2 ):

[0063] (1) Upstream mutant (C) allele-specific primer (named Lmm1-HEX): 5'→3' sequence is GAAGGTCGGAGTCAACGGATTGCTGATGTTATGCAATGGAGCCACC (SEQ ID NO.3), with the HEX fluorescent reporter group and universal quenching sequence connected at its 5' end;

[0064] (2) Upstream wild-type (G) allele-specific primer (named Lmm1-FAM): 5'→3' sequence is GAAGGTGACCAAGTTCATGCTGCTGATGTTATGCAATGGAGCCACA (SEQ ID NO.4), with the FAM fluorescent reporter group and universal quenching sequence linked to its 5' end;

[0065] (3) Downstream common primer (named Lmm1-Common): 5'→3' sequence is TATCATTAGTTGCATAAGGATCCATCCGAA (SEQ ID NO.5), without fluorescent modification, and binds to the conserved region of the 5' end flanking region of the SNP site.

[0066] Secondly, this invention uses three primers to specifically identify the target sequence in the same PCR reaction system, and directly distinguishes genotypes using FAM / HEX differential fluorescence, eliminating the need for electrophoresis for direct genotyping.

[0067] (1) C / C disease-resistant homozygous type (including H3 and H5 resistance haplotype core genotypes): only positive for HEX fluorescence signal;

[0068] (2) A / C heterozygous type: positive for both HEX and FAM fluorescence signals;

[0069] (3) Homozygous wild-type A / A disease-susceptible (including H1, H2, and H4 disease-susceptible haplotypes): Only positive for FAM fluorescence signal.

[0070] Thirdly, this invention provides an explanation of its application advantages:

[0071] (1) Extremely short identification cycle: Genotyping can be completed through leaf DNA during the seedling stage, without waiting for the plant to mature, and without artificial inoculation of southern root-knot nematodes and more than 30 days of culture and observation, which greatly shortens the breeding and screening cycle.

[0072] (2) High efficiency and accuracy of detection: It is compatible with high-throughput fluorescence quantitative PCR platform and can complete the detection of 96 / 384 samples in one go. The success rate of typing is 100%, with no false positive / false negative results. It can realize the screening of GmLMM1 superior allele materials in natural varieties, and can also support the targeted screening in the process of introducing GmLMM1 superior resistance alleles into the main varieties, avoiding misjudgment caused by environmental factors throughout the process.

[0073] (3) Strong breeding targeting: It precisely targets the functional site c.1075A / C of the GmLMM1 gene (N359H polymorphism), which can be directly associated with the H3 and H5 resistance haplotypes. It is highly consistent with the resistance phenotype verification, which helps to select breeding materials with high resistance to southern root-knot nematodes and excellent agronomic traits in the early stage, and accelerates the breeding process of nematode-resistant varieties.

[0074] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the examples are conducted under conventional experimental conditions.

[0075] Example 1

[0076] Genotyping of GmLMM1 based on natural varieties

[0077] This study verifies the precise genotyping ability of the KASP molecular markers of this invention at the c.1075A / C locus of the GmLMM1 gene in natural soybean varieties, clarifying the strong association between the genotype at this locus and the soybean phenotype of resistance to the southern root-knot nematode (Meloidogyne incognita), providing a basis for rapid screening of nematode-resistant materials from natural germplasm resources. Twenty-seven natural soybean varieties (covering five GmLMM1 haplotypes from H1 to H5) were selected, including four haplotypes of H3, six haplotypes of H5 (including varieties such as Heihe53), all containing the c.1075C locus; eleven haplotypes of H1 (including Williams 82), one haplotype of H2, and five haplotypes of H4, all containing the c.1075A locus. Leaves from three seedlings of each of the 27 natural soybean varieties were taken, and the seedling leaf DNA was extracted and adjusted to a concentration of 50 ng / μL. The KASP primers of this invention were used... Figure 2 and Figure 3 PCR amplification was performed, and FAM / HEX fluorescence signals were read to determine the genotype of each variety. Figure 3 (Table 1) The genotyping results of KASP real-time PCR identification showed that among the 27 natural varieties, a total of 10 C / C genotypes (all of which are H3 and H5 haplotypes) and 17 A / A genotypes (all of which are H1, H2 and H4 haplotypes) were detected. The genotyping success rate was 100%, with no crossover or ambiguity signals, indicating that the marker of the present invention can accurately distinguish between two homozygous genotypes without false positives or false negatives.

[0078] Table 1. Correspondence between KASP phenotypes and soybean cyst nematode resistance phenotypes in each plant of the backcross BC1F2 population. Serial Number Variety Name haplotype KASP fluorescence signal type c. Genotype at locus 1075 Seven days after infection, the number of root-knot nematodes per gram of soybean root 1 Williams 82 H1 FAM A / A 130 2 Dongnong 52 H1 FAM+HEX A / A 131 3 Hefeng 58 H1 FAM+HEX A / A 135 4 Heihe 46 H1 FAM+HEX A / A 138 5 Keshan 1 H1 FAM A / A 131 6 Qindou 2014 H1 FAM+HEX A / A 135 7 XD302-8 H1 FAM A / A 131 8 Jiyu 202 H1 FAM A / A 128 9 Heihe 38 H1 HEX A / A 127 10 Shi135 H1 FAM+HEX A / A 128 11 Zhongdou29 H1 FAM+HEX A / A 127 12 Heinong66 H2 FAM+HEX A / A 128 13 Fendou97 H3 HEX C / C 91 14 Zhonghuang42 H3 FAM C / C 93 15 Hedou7 H3 HEX C / C 91 16 Heinong43 H3 FAM+HEX C / C 90 17 Beidou5 H4 FAM A / A 126 18 Qihuang12 H4 FAM+HEX A / A 131 19 JiashiD H4 FAM+HEX A / A 129 20 Kendou25 H4 FAM+HEX A / A 136 21 Henong68 H4 FAM+HEX A / A 137 22 Henong97 H5 FAM+HEX C / C 91 23 Suinong26 H5 FAM C / C 90 24 Jiyu93 H5 HEX C / C 91 25 Beidou33 H5 FAM+HEX C / C 93 26 Henong95 H5 FAM+HEX C / C 90 27 Heihe53 H5 FAM C / C 81

[0079] Example 2

[0080] Validation of nematode resistance phenotype based on GmLMM1 genotype identification in natural varieties

[0081] For the 27 natural varieties in Example 1, multiple seeds from each variety were sown in a sterilized substrate (soil:vermiculite = 2:1), and 10 seedlings were maintained. At 14 days old, each seedling was inoculated with 500 second-instar larvae and cultured in a greenhouse (25℃, 50% humidity, 14h light). Seven days after inoculation, the roots were harvested and rinsed with water. The number of root-knot nematodes in each root system was counted under a stereomicroscope, and the fresh weight of the roots was measured. The number of parasitic nematodes per gram of fresh root weight was calculated. Haplotype resistance verification results: The number of parasitic nematodes in haplotypes H3 and H5 (both C / C genotypes) was significantly lower than that in haplotypes H1, H2, and H4 (both A / A genotypes), confirming that the c.1075A / C site variation (N359H) is a key determinant of nematode resistance in natural varieties. Figure 3 (Table 1).

[0082] In this embodiment, the screening cycle for KASP markers is only 1-3 days (from DNA extraction to genotype determination), while the traditional nematode inoculation identification method (14 days of seedling cultivation + 30 days of inoculation culture + 2-3 days of phenotypic investigation) requires 46-47 days. The method of this invention is 15-47 times more efficient, and does not require artificial inoculation of nematodes, is not affected by environmental interference, and has a false positive rate of less than 1%, which is significantly better than the traditional method.

[0083] The KASP molecular marker of this invention can rapidly and accurately identify the genotype of the c.1075A / C locus of the GmLMM1 gene in natural soybean varieties, and this genotype has a strict correspondence with the phenotype of resistance to southern root-knot nematode (C / C genotype is highly resistant, A / A genotype is susceptible).

[0084] Example 3

[0085] Screening and verification during the introduction of the GmLMM1 superior resistance allele into the main promoted varieties

[0086] This invention demonstrates the screening effectiveness of the KASP molecular marker in the introduction of the superior resistance allele (C allele, corresponding to the N359H mutation) of GmLMM1 into a major soybean variety, clarifying the marker's ability to accurately track resistance genotypes in hybrid offspring, and providing technical support for the targeted breeding of superior varieties resistant to southern root-knot nematodes. Donor parent: Heihe53 (H5 haplotype, C / C genotype, highly resistant to southern root-knot nematodes), containing the c.1075C locus of the GmLMM1 gene; Recipient parent: Williams 82 (H1 haplotype, A / A genotype, susceptible to southern root-knot nematodes), a major soybean variety susceptible to the disease, containing the c.1075A locus of the GmLMM1 gene. Hybrid offspring materials: F1 generation was obtained by crossing the donor and recipient parents. 67 F2 generation seedlings were obtained through self-pollination of the F1 generation. DNA was extracted from these 67 seedlings, and the KASP marker of this invention was used for fluorescence signal detection, and a scatter plot was plotted. Figure 3 Genotype interpretation was performed based on fluorescence signals: The endpoint FAM / HEX fluorescence signal was detected using a quantitative real-time PCR instrument. HEX single fluorescence indicated the C / C genotype, FAM single fluorescence indicated the A / A genotype, and dual fluorescence indicated the A / C heterozygous genotype. KASP quantitative real-time PCR results were used to verify the genetic segregation ratio in the hybrid offspring: the number of plants with the three genotypes (C / C, A / C, A / A) in the F2 generation was counted, and the chi-square test was used to verify that the genotype segregation ratio conformed to Mendelian inheritance (the theoretical segregation ratio of F2 generation is 1:2:1).

[0087] This invention's KASP molecular marker is not only applicable to screening natural germplasm resources, but also allows for precise tracking of the transmission patterns of the superior resistance allele of GmLMM1 in hybrid offspring, accurately distinguishing between the C / C, A / C, and A / A genotypes. This marker can be efficiently applied to targeted screening during the introduction of the superior resistance allele of GmLMM1 into key varieties, rapidly enriching breeding materials containing resistance genes, significantly shortening the breeding cycle of nematode-resistant varieties, and providing reliable technical support for marker-assisted breeding of soybeans resistant to southern root-knot nematodes. Using this marker, genotype can be quickly determined solely through fluorescence signal typing, without the need for nematode inoculation, providing a reliable molecular detection tool for the entire soybean breeding chain for resistance to southern root-knot nematodes.

[0088] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description and ideas, and it is neither necessary nor possible to exhaustively describe all implementation methods here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. A KASP molecular marker for identifying resistance to southern root-knot nematode disease, characterized in that, The molecular marker targets the SNP site at position 1075 of the complete CDS sequence of the wild type GmLMM1 gene.

2. A set of KASP primers for detecting the SNP site of claim 1, characterized in that, The KASP primer set includes: The nucleotide sequence of the upstream specific primer Lmm1-HEX of the KASP primer set is shown in SEQ ID NO.3; The nucleotide sequence of the upstream specific primer Lmm1-FAM of the KASP primer set is shown in SEQ ID NO.4; The nucleotide sequence of the downstream common primer Lmm1-Common of the KASP primer set is shown in SEQ ID NO.

5.

3. A kind GmLMM1 The genotype detection method is characterized by, The detection method includes the following steps: (1) Extract genomic DNA from plant samples; (2) Using the DNA as a template, perform KASP-PCR amplification using the KASP primer set described in claim 2; (3) Obtain fluorescence typing results through FAM and HEX fluorescence signals, and determine the genotype of soybean samples based on the fluorescence typing results.

4. The detection method according to claim 3, characterized in that, The genotype determination criteria mentioned in step (3) are as follows: When only FAM fluorescence signal is present, the genotype is determined to be A / A homozygous, meaning it is susceptible to southern root-knot nematodes. When only HEX fluorescence signal is present, the genotype is determined to be C / C homozygous, i.e., resistant to southern root-knot nematodes; When both FAM and HEX fluorescence signals are present simultaneously, the genotype is determined to be A / C heterozygous.

5. The application of the molecular marker of claim 1, the primer set of claim 2, or the detection method of any one of claims 3-4 in molecular marker-assisted breeding of plants for resistance to southern root-knot nematode disease.

6. The application of the molecular marker of claim 1, the primer set of claim 2, or the detection method of any one of claims 3 to 4 in the screening of plant germplasm resistant to southern root-knot nematodes.

7. Use of the molecular marker of claim 1, the primer set of claim 2, or the assay of any one of claims 3-4 in the identification of plant material into which the elite allele has been introduced. GmLMM1 Use of the molecular marker of claim 1, the primer set of claim 2, or the assay of any one of claims 3-4 in the identification of plant material into which the elite allele has been introduced.

8. The application of the molecular marker of claim 1, the primer set of claim 2, or the detection method of any one of claims 3-4 in the identification of transgenic plant lines, characterized in that, The genetically modified organism includes GmLMM1 Homologous SNP sites of gene c.1075A / C.

9. The application of the molecular marker of claim 1, the primer set of claim 2, or the detection method of any one of claims 3-4 in the purity detection of plant disease-resistant varieties, characterized in that, The disease-resistant varieties include those resistant to southern root-knot nematode disease.

10. The application according to any one of claims 5 to 9, characterized in that, The plants mentioned include soybean and related genera of the legume family, Arabidopsis thaliana, wheat, rice, corn, cotton, and peanut.

Images