Application of odd-carbon fatty acid as Nrf2 activator
By activating the Nrf2 pathway using natural pentadecanoic acid (C15:0), the toxicity problem of chemically synthesized agonists has been solved, enabling effective treatment of various chronic diseases and intrauterine growth retardation, as well as improvement of mammalian health.
Patent Information
- Application Number
- CN202411141835.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-19
- Publication Date
- 2026-03-03
AI Technical Summary
Existing chemically synthesized Nrf2 agonists have significant off-target effects, high toxicity, and low patient tolerance in clinical applications, and there is a lack of effective treatments for intrauterine growth restriction or intrauterine growth retardation (IUGR).
Using naturally occurring pentadecanoic acid (C15:0) as an Nrf2 activator, it is produced in large quantities through fermentation in algae using biotechnology, and then prepared into an oil composition to activate the expression of Nrf2 and downstream target factors for the prevention or treatment of Nrf2-related diseases.
Increasing Nrf2 levels and activating the Nrf2 pathway can effectively prevent or treat a variety of chronic diseases, improve the physical condition of mammals, enhance the survival rate and growth performance of newborn mammals, and reduce the biotoxicity of treatments.
Smart Images

Figure BDA0005001391710000161 
Figure BDA0005001391710000171 
Figure BDA0005001391710000181
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and more particularly to the use of odd-carbon fatty acids as Nrf2 activators. Background Technology
[0002] Pentadecanoic acid (C15:0) is a naturally occurring long-chain fatty acid. Because its content in the human body is trace, its functional research has not received sufficient attention.
[0003] Nrf2 (Nuclear Factor E2-associated factor 2) is a transcription factor whose levels are tightly controlled under basal conditions by the cytoplasmic actin-binding repressor KEAP1 (Kelch-like ECH-associated protein 1). KEAP1 binds to Nrf2 and targets it for ubiquitination and proteasome degradation via a Cul3-based E3-ubiquitin ligase complex. Therefore, cytoplasmic Nrf2 levels are low under normal conditions. However, this system is designed to respond immediately to environmental stress by increasing Nrf2 activity. Inappropriately low Nrf2 levels are a cause of various diseases, and activating Nrf2 expression holds significant promise for the treatment of various chronic diseases, including those affecting the respiratory, cardiovascular, musculoskeletal, and nervous systems. Currently, most Nrf2 agonists are chemically synthesized, which has many drawbacks in clinical application, including significant off-target effects, high toxicity, low patient tolerance, and a very high incidence of adverse reactions.
[0004] Intrauterine growth restriction (IUGR) is one of the most common perinatal complications in mammals. It is characterized by a birth weight that is two standard deviations below the average weight for gestational age or below the 10th percentile of normal weight for gestational age. It is a major cause of perinatal mortality. Summary of the Invention
[0005] To address the aforementioned issues, the inventors have proposed a novel application for pentadecanoic acid (C15:0) as an Nrf2 activator. C15:0 can increase Nrf2 levels and activate the expression of Nrf2 and its downstream target factors. C15:0 is naturally present in the human diet and exhibits higher biocompatibility than other Nrf2 agonists. Furthermore, biotechnology allows for the large-scale production of C15:0 through food-grade algal fermentation, a mild and environmentally friendly process. Therefore, C15:0 is a promising Nrf2 agonist with significant advantages in the prevention, alleviation, or treatment of various Nrf2-related diseases, demonstrating excellent application prospects.
[0006] The present invention first provides the use of odd-numbered carbon fatty acids or compositions containing odd-numbered carbon fatty acids in the preparation of medicaments for treating and / or preventing Nrf2 pathway-mediated diseases or symptoms.
[0007] In one or more embodiments, the composition containing odd-numbered carbon fatty acids comprises any one or a mixture of two or more of the following fatty acid compositions: odd-numbered carbon fatty acids, preferably at least pentadecanoic acid monoglycerides, diglycerides, and triglycerides.
[0008] In one or more embodiments, the composition is an oil-based composition.
[0009] In one or more embodiments, the fatty acid composition of the oil composition contains 1-100% odd-numbered carbon fatty acids, such as 5-100%, 10-100%, 20-100%, 30-100%, 20-80%, 20-60%, or 30-50%.
[0010] In one or more embodiments, the fatty acid composition of the oil composition includes pentadecanoic acid and heptadecanoic acid in odd-numbered carbon fatty acids, and optionally also contains undecanoic acid and tridecanoic acid.
[0011] In one or more embodiments, the fatty acid composition of the oil composition contains pentadecanoic acid at a content of 10-100%, for example, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or a range between any two of the above values.
[0012] In one or more embodiments, the fatty acid composition of the oil composition contains pentadecanoic acid at a content of 20-100%, 30-100%, 20-80%, 20-60%, or 30-50%.
[0013] In one or more embodiments, the fatty acid composition of the oil composition contains 30-40% pentadecanoic acid, preferably 33-37%.
[0014] In one or more embodiments, the fatty acid composition of the oil composition contains 2-15% heptadecanoic acid, such as 5-15% or 8-12%.
[0015] In one or more embodiments, the fatty acid composition of the oil composition contains heptadecanoic acid at a content of 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, or a range between any two of the above values.
[0016] In one or more embodiments, the fatty acid composition of the oil composition contains 10-40% pentadecanoic acid and 2-15% heptadecanoic acid.
[0017] In one or more embodiments, the fatty acid composition of the oil composition further contains 0.01-0.5% undecanoic acid and 0.5-1.5% tridecanoic acid; preferably, the fatty acid composition of the oil composition contains 30-40% pentadecanoic acid, more preferably 33-37%, and 5-15% heptadecanoic acid, more preferably 8-12%.
[0018] In one or more embodiments, the odd-carbon fatty acid glyceride is pentadecanoic acid glyceride, more preferably pentadecanoic acid triglyceride.
[0019] In one or more embodiments, the Nrf2 pathway-mediated diseases or symptoms include those benefiting from the activation of at least one of Nrf2, NQO1, HO-1, and GCLM, and increased mRNA expression levels and / or protein levels and / or activity of at least one of Nrf2, NQO1, HO-1, and GCLM.
[0020] In one or more embodiments, the diseases or symptoms that benefit from Nrf2 activation and increased Nrf2 mRNA expression levels and / or protein levels and / or activity include intestinal diseases or chronic diseases such as systemic diseases of the digestive, respiratory, cardiovascular, musculoskeletal, and nervous systems, specifically including chronic obstructive pulmonary disease, asthma, diabetes, tumors and multiple sclerosis, as well as high glucose and high lipid-induced glucolipotoxicity.
[0021] In one or more embodiments, the diseases or symptoms that benefit from NQO1 activation and increased mRNA expression levels and / or protein levels and / or activity of NQO1 are selected from skin cancer, Alzheimer's disease, Crohn's disease of the stomach and duodenum, tardive dyskinesia, childhood leukemia, papillary thyroid microcarcinoma, senile cataract, hepatocellular adenoma, cell lymphoma, chronic atrophic gastritis, neonatal bronchopulmonary dysplasia, liver oxidative stress, clear cell renal cell carcinoma, breast cancer, pancreatic ductal carcinoma, colon cancer, cervical cancer, lung cancer, colorectal cancer, pancreatic cancer, prostate cancer, and T-cell lymphoma.
[0022] In one or more embodiments, the diseases or symptoms that benefit from HO-1 activation and increased mRNA expression levels and / or protein levels and / or activity of HO-1 are selected from chronic obstructive pulmonary disease, pulmonary fibrosis, lung cancer, asthma, acute lung injury, wound healing, kidney disease, diabetes, cardiovascular disease, neuroinflammatory diseases, eye diseases (such as corneal disease, glaucoma, cataract, uveitis, Graves' ophthalmopathy, diabetic retinopathy, retinitis pigmentosa), acute liver injury, and gastrointestinal diseases (such as gastrointestinal injury, inflammatory bowel disease, intestinal ischemia-reperfusion injury, gastrointestinal tumors, gastroparesis).
[0023] In one or more embodiments, the diseases or symptoms that benefit from GCLM activation and increased mRNA expression levels and / or protein levels and / or activity of GCLM are selected from gastric cancer, schizophrenia, esophageal cancer, cognitive impairment, renal cancer, human granulosa cell carcinoma, liver cancer, lung cancer, breast cancer, ovarian cancer, neurofibromatosis, stroke, cerebral infarction, cerebrovascular disease, coronary heart disease, asthma, chronic myeloid leukemia, acute kidney injury, degenerative diseases (such as Alzheimer's disease, Huntington's disease, and Parkinson's disease), cerebral hemorrhage, traumatic brain injury, and ischemia-reperfusion injury.
[0024] A second aspect of the invention provides the use of odd-carbon fatty acids or compositions containing odd-carbon fatty acids in the preparation of compositions that improve the physical condition of mammals during pregnancy and / or postpartum.
[0025] In some implementations, the improvement of the physical condition of the mammal after pregnancy and / or childbirth includes:
[0026] (a) Promotes postpartum recovery in mammals;
[0027] (b) To increase the lactose content in the milk of lactating mammals, thereby improving milk quality;
[0028] (c) Increase prolactin levels in pregnant or postpartum mammals, and improve mammary gland development and lactation capacity;
[0029] (d) Improves the digestibility of fiber (especially neutral and acid detergent fibers) in pregnant or postpartum mammals and enhances intestinal utilization of fiber; and
[0030] (e) Improve estrus after weaning in farmed mammals, such as by increasing estrus rate and / or shortening estrus interval.
[0031] In some implementations, the application includes:
[0032] (1) Improve the physical condition of pregnant and lactating women;
[0033] (2) Increase the lactose content in breast milk and improve the quality of breast milk;
[0034] (3) Increase prolactin levels in pregnant and postpartum women and improve mammary gland development and lactation capacity;
[0035] (4) Improve the digestibility of neutral and acidic detergent fibers for pregnant and postpartum women and enhance the utilization of fiber in the intestines.
[0036] (5) Improves the recovery of body condition and shortens the estrus period in farmed mammals;
[0037] (6) Increase the lactose content in the milk of farmed mammals and improve the quality of the milk;
[0038] (7) Increases prolactin levels in farmed mammals during pregnancy and lactation, and improves mammary gland development and lactation capacity; and
[0039] (8) Improve the digestibility of neutral and acid detergent fibers in farmed mammals during pregnancy and lactation, and enhance the utilization of fiber in the intestines.
[0040] In some embodiments, the composition for improving the physical condition of mammals during pregnancy and / or postpartum is a food fortifier, health supplement, or food.
[0041] A third aspect of the present invention provides the use of Nrf2 pathway agonists in the preparation of compositions that improve the physical condition of newborn mammals.
[0042] In some embodiments, the Nrf2 pathway agonist is an odd-numbered carbon fatty acid, especially C15:0, or an oil composition containing an odd-numbered carbon fatty acid (especially C15:0), preferably an oil composition as described in any of the embodiments herein.
[0043] In some implementations, the improvement in the physical condition of newborn mammals includes improving the survival rate and weight catch-up of newborn mammals with low birth weight.
[0044] In some implementations, the applications include: improving weight catch-up in neonatal infants with low birth weight; or improving growth performance and survival rate in farmed mammal offspring with intrauterine growth retardation.
[0045] In some embodiments, the composition for improving the physical condition of newborn mammals is a food fortifier, health supplement, or food.
[0046] A fourth aspect of the present invention provides a food fortifier, health product or food for improving the physical condition of pregnant and / or postpartum mammals or newborn mammals, comprising odd-carbon fatty acids (preferably pentadecanoic acid) or a composition containing odd-carbon fatty acids (preferably pentadecanoic acid); preferably, the composition containing odd-carbon fatty acids is an oil composition containing odd-carbon fatty acids (preferably pentadecanoic acid), preferably an oil composition described in any embodiment herein.
[0047] The fifth aspect of the present invention is a method for improving the physical condition of a mammal during pregnancy and / or after childbirth, the method comprising administering to the mammal an effective amount of odd-carbon fatty acids or a composition containing odd-carbon fatty acids.
[0048] A sixth aspect of the present invention provides a method for improving the physical condition of a newborn mammal, the method comprising administering an Nrf2 pathway agonist to the mammal; preferably, the Nrf2 pathway agonist is as described in any embodiment herein. Attached Figure Description
[0049] Figure 1 The effect of different treatment times and concentrations of H2O2 on cell viability. Different letters are used to represent statistically significant results. If two groups do not share the same letter, the data from the two groups are statistically significant; if they share the same letter, the data from the two groups are not statistically significant. For example, pairwise differences between the different letters a, b, and c indicate statistical significance.
[0050] Figure 2 Effects of different treatment times and concentrations of C15:0 on cell viability.
[0051] Figure 3 C15:0 pretreatment improved the viability of a cell model damaged by hydrogen peroxide.
[0052] Figure 4 : Expression levels of genes in the Nrf2 signaling pathway.
[0053] Figure 5 Effect of C15:0 on body loss induced by diquat in mice. Among them, the CON group and the DIQ group were p < 0.001.
[0054] Figure 6 Effects of C15:0 on the Nrf2 signaling pathway in the mouse intestine under diquat stimulation.
[0055] Figure 7 Supplementation with two different algal oils during late pregnancy and lactation improved the growth performance and survival rate of IUGR piglets.
[0056] Figure 8 The effects of supplementing with two different algal oils during late pregnancy and lactation on the growth performance of piglets with normal birth weight.
[0057] Figure 9 Effects of early oral administration of pentadecanoic acid triglycerides on the average body weight of IUGR piglets on days 14 and 21 of neonatal period.
[0058] Figure 10 Effects of early oral administration of pentadecanoic acid triglycerides on average daily weight gain in newborn IUGR piglets. Detailed Implementation
[0059] The inventors have discovered that feeding sows with oils containing odd-numbered carbon fatty acids (OCFA) is beneficial to their health and promotes the growth of IUGR piglets nursed in litters. The inventors further determined that OCFA (especially C15:O, which is most abundant in oils containing OCFA) can increase the expression of Nrf2 protein mRNA and enhance the mRNA expression of its downstream target factors NQO1 (quinone oxidoreductase), HO-1 (heme oxidase), and GCLM (glutathione synthase), thus activating the Nrf2 pathway. Therefore, OCFA can be used as Nrf2 agonists to prevent, alleviate, or treat diseases and symptoms that benefit from increased Nrf2 expression or activity and Nrf2 pathway activation, and to improve or promote events that benefit from increased Nrf2 expression or activity and Nrf2 pathway activation. This completes the present invention.
[0060] Odd-carbon fatty acids and their compositions
[0061] In this article, odd-chain fatty acids (OCFA), also known as odd-chain fatty acids, refer to fatty acids with an odd number of carbon atoms, such as undecanoic acid (C11:0), tridecanoic acid (C13:0), pentadecanoic acid (C15:0), heptadecanoic acid (C17:0), nonadecanoic acid (C19:0), and dodecanoic acid (C21:0).
[0062] In some embodiments, the odd-carbon fatty acids described herein primarily refer to pentadecanoic acid (C15:0) and heptadecanoic acid (C17:0). In further embodiments, the odd-carbon fatty acids described herein primarily refer to pentadecanoic acid, with the molecular formula CH3(CH2). 13 COOH.
[0063] In some embodiments, the composition is any one or a mixture of two or more of monoglycerides, diglycerides, and triglycerides whose fatty acid composition includes odd-numbered carbon fatty acids. Preferably, the fatty acid composition of the monoglycerides, diglycerides, and triglycerides includes at least pentadecanoic acid.
[0064] In some embodiments, the composition is an oil and fat composition. As is well known in the art, oils and fats are essentially composed of triglycerides. In some embodiments, the fatty acid composition of the oil and fat composition contains 1-100% odd-numbered carbon fatty acids, such as 5-100%, 10-100%, 20-100%, 30-100%, 20-80%, 20-60%, or 30-50%; preferably, the fatty acid composition of the oil and fat composition contains pentadecanoic acid and heptadecanoic acid, optionally also containing undecanoic acid and tridecanoic acid; preferably, the fatty acid composition of the oil and fat composition contains 10-100% pentadecanoic acid, such as 20-100%, 30-100%, 20-60%, or 30-50%. -80%, 20-60%, 30-50%, 30-40%, or 33-37%; preferably, the content of heptadecanoic acid is 2-15%, such as 5-15% or 8-12%; preferably, the fatty acid composition of the oil composition further contains 0.01-0.5% undecanoic acid and 0.2-1.5% or 0.5-1.5% tridecanoic acid; preferably, the fatty acid composition of the oil composition contains 10-40% pentadecanoic acid, preferably 30-40% or 33-37%, and 2-15% heptadecanoic acid, preferably 5-15% or 8-12%.
[0065] In some embodiments, the fatty acid composition of the oil composition contains 30-40% pentadecanoic acid, preferably 33-37%, 5-15% heptadecanoic acid, preferably 8-12%, 0.01-0.5% undecanoic acid, and 0.5-1.5% tridecanoic acid.
[0066] In some embodiments, the fatty acids in the oil composition further include C16:0, C18:1, C22:5, and C22:6. Preferably, the content of C16:0 in the fatty acid composition is 8-15%, more preferably 10-14%; the content of C18:1 is preferably 4-9%, more preferably 6-8%; the content of C22:5 is preferably 3-8%, more preferably 5-6.5%; and the content of C22:6 is preferably 18-30%, more preferably 22-26%. In addition to the above-mentioned fatty acids, the oil composition may also contain one or more of C12:0, C14:0, C16:1, C18:0, C18:2, C18:3, C20:1, C20:3, and C22:2, the content of each of these fatty acids is generally ≤2%, and the total content is generally ≤6%.
[0067] Similarly, for diglycerides, their fatty acid composition contains at least odd-numbered carbon fatty acids, preferably at least pentadecanoic acid. Preferably, the content of odd-numbered carbon fatty acids in the fatty acid composition of the mixture formed from diglycerides can be 1-100%, such as 5-100%, 10-100%, 20-100%, 30-100%, 20-80%, 20-60%, or 30-50%. The fatty acids of diglycerides may also contain other odd-numbered carbon fatty acids, such as heptadecanoic acid, undecanoic acid, and / or tridecanoic acid, and optionally other known fatty acids, such as one or more of C12:0, C14:0, C16:1, C18:0, C18:2, C18:3, C20:1, C20:3, C22:2, etc.
[0068] In mixtures formed from monoglycerides, the content of monoglycerides whose fatty acid chains consist of odd-numbered carbon fatty acids is at least 1 wt%, such as 1-100 wt%, 5-100 wt%, 10-100 wt%, 20-100 wt%, 30-100 wt%, 40-100 wt%, 50-100%, 10-50 wt%, etc. Preferably, in the fatty acid composition of the mixture, the content of odd-numbered carbon fatty acids can be 1-100%, such as 5-100%, 10-100%, 20-100%, 30-100%, 20-80%, 20-60%, or 30-50%. The fatty acids in the mixture may also contain other odd-carbon fatty acids, such as heptadecanoic acid, undecanoic acid and / or tridecanoic acid, and optionally one or more of other known fatty acids, such as C12:0, C14:0, C16:1, C18:0, C18:2, C18:3, C20:1, C20:3, C22:2, etc.
[0069] The oil compositions described herein may be existing known oils containing odd-numbered carbon fatty acids, such as DHA algal oil rich in odd-numbered carbon fatty acids, or oil compositions obtained by directly mixing oils containing odd-numbered carbon fatty acids with other conventional vegetable oils, or oil compositions prepared by transesterification of oils containing odd-numbered carbon fatty acids with other conventional vegetable oils, or oil compositions prepared by transesterification of odd-numbered carbon fatty acids with conventional vegetable oils, or oil compositions prepared by esterification of odd-numbered carbon fatty acids with glycerol (this oil composition may contain monoglycerides, diglycerides, and / or triglycerides).
[0070] The conventional vegetable oils include, but are not limited to, common edible oils such as soybean oil, cottonseed oil, rice bran oil, tea seed oil, safflower seed oil, palm oil, corn oil, peanut oil, sesame oil, olive oil, almond oil, walnut oil, flaxseed oil, shea butter, senna resin, safflower oil, and mango kernel oil, as well as their extracts and transesterification products, such as palm stearin and shea butter stearin. The oils containing odd-numbered carbon fatty acids are typically algal oils containing odd-numbered carbon fatty acids. Algal oils containing odd-numbered carbon fatty acids can be obtained commercially, or can be prepared by fermenting algae capable of producing oils containing odd-numbered carbon fatty acids.
[0071] The transesterification reaction in this invention can be carried out using methods conventional in the art, including but not limited to chemical transesterification or enzymatic transesterification. For example, for enzymatic transesterification, immobilized lipases (e.g., DF enzymes) are typically used as catalysts, with the amount of catalyst usually being 5-20% of the substrate weight. The reactants are reacted at room temperature or under heating conditions (e.g., 50-100°C) to obtain the transesterification product. For chemical transesterification, a catalyst (e.g., sodium methoxide) can be added to the dehydrated reactants, and the reaction is carried out at 100-110°C for 30-60 minutes under normal pressure or vacuum conditions (e.g., 0.1 bar), and then the reaction is terminated to complete the transesterification reaction. The amount of catalyst is usually 0.1-0.5% of the weight of the raw oil. Citric acid solution can be added to terminate the reaction, and the amount added can be determined according to the actual reaction conditions. Preferably, this invention uses chemical transesterification to prepare the oil composition containing odd-numbered carbon fatty acids.
[0072] The amount of feedstock oil used for transesterification can be determined based on the content of odd-numbered carbon fatty acids in the feedstock oil, so that the content of odd-numbered carbon fatty acids in the prepared oil composition is within the range described herein.
[0073] In some embodiments, algal oil containing OCFA and DHA and high-oleic sunflower seed oil are chemically transesterified at a mass ratio of 90-99:1-10 to prepare the oil composition of the present invention. The algal oil containing OCFA and DHA and high-oleic sunflower seed oil can be dehydrated under vacuum at 100-110°C for 30-60 minutes, then a catalyst such as sodium methoxide is added, and the reaction is carried out under vacuum at 100-110°C for 30-60 minutes; the amount of catalyst used is 0.1-0.3% of the algal oil and high-oleic sunflower seed oil; the reaction is terminated by adding 1.5-2.0 times the weight of the catalyst in citric acid solution, and the mixture is washed with water until neutral to obtain the oil composition containing odd-numbered carbon fatty acids described in the present invention.
[0074] In some embodiments, the oil composition containing odd-numbered carbon fatty acids described in this invention can be an oil prepared by esterification of odd-numbered carbon fatty acids such as pentadecanoic acid and glycerol. The molar ratio of odd-numbered carbon fatty acids such as pentadecanoic acid to glycerol can be 1:(1-10), for example 1:(2-7) or 1:(3-5). An enzyme, such as NOVO435, can be added at 5-15% of the total weight of the odd-numbered carbon fatty acids and glycerol to perform enzymatic transesterification at the enzyme's operating temperature. For example, the suitable operating temperature of NOVO435 is in the range of 60-80°C. After the reaction, the enzyme is removed, and then purification is performed (e.g., by molecular distillation). In molecular distillation, the distillation temperature can be 200-250°C (e.g., 230°C), the rotation speed can be 250-500 r / min (e.g., 300 r / min), and the vacuum degree can be 0.1-10 mbar (e.g., 10 mbar). After purification, the oil containing odd-numbered carbon fatty acids described in this invention can be obtained. Depending on the reaction conditions (e.g., the molar ratio of reactants), the resulting oil composition can be any one of monoglycerides, diglycerides, and triglycerides, or any mixture of two or more of them. In some embodiments, the oil composition is pentadecanoic acid triglyceride.
[0075] Optionally, the oil can be refined using methods well known in the art, such as one or more of water washing, alkali refining, decolorization, and deodorization. An exemplary water washing step includes adding a washing agent such as a citric acid solution, stirring to allow precipitation, repeating this process multiple times, and then removing the lower aqueous phase. The amount of washing agent added is 10-20% of the oil's weight, the citric acid concentration can be 0.3-0.7‰, the stirring speed can be 100-300 rpm, the stirring time can be 3-7 min, and the settling time can be 3-5 hours. An exemplary alkali refining step includes heating the oil, adding alkali solution for water washing and brine for water washing respectively, stirring to allow precipitation, and then removing the aqueous phase. The amount of alkali solution and brine added can be 10-20% of the oil's weight, the alkali concentration and salt concentration can be 0.3-0.7‰ respectively, the stirring speed can be 50-200 rpm, the stirring time can be 1-15 min, and the settling time can be 1-5 hours. An exemplary decolorization temperature is 100-120℃, the decolorization time is 0.1-1 hour, the pressure is 5-30 mbar, and the decolorizing agent can be a conventional decolorizing agent in the art, such as bleaching clay, the amount of which can be 0.5-5% of the oil weight. An exemplary deodorization temperature is 200-250℃, the vacuum degree is 3-10 mbar, and the deodorization time is 1-3 hours.
[0076] In some embodiments, the composition described herein may be a composition containing either odd-carbon fatty acids or an oil composition as described in any of the preceding embodiments. In addition to odd-carbon fatty acids or oil compositions, the composition may also contain other ingredients depending on its intended use. For example, as feed, the composition may contain, in addition to odd-carbon fatty acids and / or oil compositions, other ingredients commonly found in feeds, such as corn, soybean meal, wheat bran, other oils, dicalcium phosphate, limestone, salt, amino acids (such as lysine, threonine, etc.), vitamins (such as vitamin A, vitamin E, vitamin K3, vitamin B1, vitamin B2, vitamin B6, vitamin B12, niacin, pantothenic acid, folic acid, biotin, choline chloride, etc.), and trace elements (such as iron, copper, zinc, manganese, iodine, selenium, etc.). Other ingredients in the feed and their contents may be conventional and vary depending on the target animal. The content of odd-numbered carbon fatty acids in feed can be 0.01–10 wt%, such as 0.1–5 wt%, 0.2–4 wt%, 0.3–3 wt%, and 0.5–3 wt%.
[0077] In some embodiments, the composition is a pharmaceutical composition that, in addition to odd-carbon fatty acids and / or oil compositions, typically contains a pharmaceutically acceptable carrier or excipient. In this document, a pharmaceutically acceptable carrier or excipient can be any of the pharmaceutically acceptable carriers or excipients well known in the art, including but not limited to: sugars such as lactose or sucrose, mannitol or sorbitol; cellulose preparations and / or calcium phosphates, such as tricalcium phosphate or calcium hydrogen phosphate; binders, such as starch pastes including corn starch, wheat starch, rice starch, potato starch, gelatin, astragalus gum, methylcellulose, hydroxypropyl methylcellulose, sodium carboxymethylcellulose, and / or polyvinylpyrrolidone; flow regulators and lubricants, such as silica, talc, stearic acid or its salts, such as magnesium stearate or calcium stearate, and / or polyethylene glycol. In some embodiments, the carrier or excipient can provide a suitable coating that is resistant to gastric juices. This coating can be prepared using a concentrated sugar solution that may contain gum arabic, talc, polyvinylpyrrolidone, polyethylene glycol and / or titanium dioxide, varnish solution, and a suitable organic solvent or solvent mixture.
[0078] The carrier or excipient can vary depending on the dosage form. For example, for compressible capsules made from gelatin, the active compound may be in particulate form, mixed with fillers such as lactose; binders such as starch; and / or lubricants such as talc or magnesium stearate, and stabilizers. Formulations suitable for parenteral administration include aqueous solutions of the active compound, such as solutions of water-soluble salts and alkaline solutions. Additionally, oily injectable suspensions of the appropriate active compound may be administered. Suitable lipophilic solvents or carriers include oils such as sesame oils, synthetic fatty acid esters such as ethyl oleate or triglycerides or polyethylene glycol 400, or hydrogenated castor oil, or cyclodextrin. Aqueous injectable suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, and / or dextran. Suspension stabilizers may also be included.
[0079] In the pharmaceutical composition of the present invention, the content of odd-numbered carbon fatty acids may be 0.1 to 1000 mg / dose, such as 0.5-50 mg / dose or 0.5-10 mg / dose.
[0080] The pharmaceutical compositions of the present invention can be any suitable dosage form, including injections and oral preparations (tablets, capsules, oral liquids), etc.
[0081] The pharmaceutical compositions of the present invention can be manufactured by known methods. For example, they can be manufactured by conventional mixing, granulation, tableting, dissolving, or freeze-drying processes. When manufacturing oral formulations, solid excipients and active compounds can be combined and the mixture can be selectively ground. If necessary or required, an appropriate amount of excipients can be added, and the granular mixture can be processed to obtain tablets or tablet cores.
[0082] Disease treatment and prevention methods and applications
[0083] This invention has discovered that odd-carbon fatty acids can increase the expression level and / or activity of Nrf2 pathway proteins. Therefore, this invention provides a method for increasing the mRNA expression and / or protein expression and / or activity of Nrf2 pathway proteins, comprising administering an effective amount of odd-carbon fatty acids or a composition containing odd-carbon fatty acids to a desired subject. In this document, subject, patient, and individual are used interchangeably, including but not limited to humans and non-human animals, such as various mammals, including poultry and livestock, such as pigs. It should be understood that when administered to humans, the composition should be a composition that is usable (e.g., ingested) by humans.
[0084] Nrf2 (nuclear factor E2-related factor 2) is a transcription factor composed of seven Neh domains. The level of Nrf2 in the cytoplasm is normally low. However, inappropriately low Nrf2 levels are a cause of various diseases, and activating Nrf2 expression holds significant promise for the treatment of various intestinal or chronic diseases. These intestinal or chronic diseases encompass multiple systemic disorders, including those of the digestive, respiratory, cardiovascular, musculoskeletal, and nervous systems. Furthermore, it is known in the art that Nrf2 is closely associated with various diseases such as chronic obstructive pulmonary disease, asthma, diabetes, tumors, and multiple sclerosis. Additionally, Nrf2 activation improves glucose and lipid toxicity induced by high glucose and high lipid levels (CN 202211293117.4).
[0085] The Nrf2 pathway described in this article includes at least Nrf2, NQO1 (quinone oxidoreductase), HO-1 (heme oxidase), and GCLM (glutathione synthase).
[0086] In this paper, Nrf2, NQO1, HO-1 and GCLM have meanings known in the art, and their coding sequences, amino acid sequences and known variants can be found in existing databases and literature.
[0087] Therefore, in some embodiments, the present invention provides a method for treating or preventing Nrf2 pathway-mediated diseases or symptoms, the method comprising administering to a subject a therapeutically or preventively effective amount of an odd-carbon fatty acid or a composition containing an odd-carbon fatty acid. In some embodiments, the present invention also provides the use of an odd-carbon fatty acid or a composition containing an odd-carbon fatty acid in the preparation of a medicament for treating or preventing Nrf2 pathway-mediated diseases or symptoms. In some embodiments, the present invention also provides an odd-carbon fatty acid or a composition containing an odd-carbon fatty acid for use in methods for treating or preventing Nrf2 pathway-mediated diseases or symptoms.
[0088] In this article, “treatment” for any disease means reversing, alleviating, preventing, or improving the disease or at least one of its clinical symptoms, reducing the risk of acquiring the disease or at least one of its clinical symptoms, inhibiting the progression of the disease or at least one of its clinical symptoms, or reducing the risk of developing the disease or at least one of its clinical symptoms. “Prevention” means preventing or delaying the onset of a patient’s disease or at least one or more of its symptoms, where the patient is exposed to or susceptible to the disease, even if the patient does not experience or exhibit symptoms of the disease.
[0089] In this document, "effective amount" refers to the amount required to achieve the desired purpose. For example, "therapeutic effective amount" refers to the amount of a compound that, when administered to an individual to treat a disease or clinical symptoms of at least one disease, is sufficient to affect the disease or its symptoms. "Prophylactic effective amount" refers to the amount required to achieve a preventative purpose. "Therapeutic effective amount" can vary depending on, for example, the compound, the disease and / or the symptoms of the disease, the severity of the disease and / or the symptoms of the disease or disorder, the age, weight, and / or health status of the patient being treated, and the judgment of the prescribing clinician. The appropriate amount in any given situation can be determined by those skilled in the art or can be determined through routine testing.
[0090] In some implementations, the Nrf2 pathway-mediated diseases or symptoms described herein refer to those that benefit from Nrf2 pathway activation and / or increased mRNA expression levels and / or protein levels and / or activity of the Nrf2 pathway. Increased protein levels generally refer to increased protein expression levels, leading to increased protein content in the body. Increased protein activity refers to increased biological activity of the protein itself.
[0091] The Nrf2 pathway-mediated diseases or symptoms described herein include those benefiting from the activation of at least one of Nrf2, NQO1, HO-1, and GCLM, and increased mRNA expression levels and / or protein levels and / or activity of at least one of Nrf2, NQO1, HO-1, and GCLM. In other words, the Nrf2 pathway-mediated diseases or symptoms described herein include those mediated by at least one of Nrf2, NQO1, HO-1, and GCLM.
[0092] The Nrf2-mediated diseases or symptoms described in this article include intestinal diseases or chronic diseases, such as systemic diseases of the digestive, respiratory, cardiovascular, musculoskeletal, and nervous systems, specifically including chronic obstructive pulmonary disease, asthma, diabetes, tumors and multiple sclerosis, as well as glucose and lipid toxicity induced by high glucose and high lipid.
[0093] The diseases or symptoms that benefit from NQO1 activation and increased mRNA expression and / or protein levels and / or activity of NOQ1 (i.e., NQO1-mediated diseases or symptoms) described in this article include, but are not limited to, skin cancer, Alzheimer's disease, Crohn's disease of the stomach and duodenum, tardive dyskinesia, childhood leukemia, papillary thyroid microcarcinoma, senile cataract hepatocellular adenoma (https: / / www.cyagen.com / cn / zh-cn / community / newsletters / issue-875.html), and cellular lymphoma (Chinese Journal of Clinical Oncology, 2018, 45(20):1033-1037.DOI:10.3969 / j.issn.1000-8179.2018.20.920). Chronic atrophic gastritis (Chinese Journal of Microecology, 2023, 35(9):993-1000. doi:10.13381 / j.cnki.cjm.202309001), neonatal bronchopulmonary dysplasia (Journal of Xuzhou Medical University, 2022, 42(11):854-858. DOI:10.3969 / j.issn.2096-3882.2022.11.014), liver antioxidant stress (World Chinese Journal of Gastroenterology, 2010; 18(18):1907-1911. DOI:10.11569 / wcjd.v18.i18.1907), renal clear cell carcinoma (Journal of Hebei Medical University, 2014, Vol.35, Issue(4):421-421), breast cancer (Acta... Chimica Sinica 79(3):331), pancreatic ductal carcinoma (Feng Qian, Albumin binding revitalizes NQO1 bioactivatable drugs as novel therapeutics for pancreatic cancer, Journal of Controlled Release), colon cancer, cervical cancer, lung cancer, colorectal cancer, pancreatic cancer (BMB Rep. 2015 Nov; 48(11):609-17), prostate cancer (Commun Biol 3,12(2020). https: / / doi.org / 10.1038 / s42003-019-0720-z), and T-cell lymphoma (Chin J Clin Oncol 2018.Vol.45.No.20), etc.
[0094] The diseases or symptoms that benefit from HO-1 activation and increased mRNA expression and / or protein levels and / or activity of HO-1 (i.e., HO-1-mediated diseases or symptoms) described in this article include, but are not limited to: chronic obstructive pulmonary disease, pulmonary fibrosis, lung cancer, asthma, acute lung injury, wound healing, nephropathy, diabetes, cardiovascular disease, neuroinflammatory diseases (DOI: 10.3760 / cma.j.issn.1008-1372.2015.12.054), eye diseases (such as corneal diseases, glaucoma, cataracts, uveitis, Graves' ophthalmopathy, diabetic retinopathy, retinitis pigmentosa) (Chinese Journal of Experimental Ophthalmology, 2020, 38(1):73-76), acute liver injury (World Chinese Journal of Gastroenterology, 2007-01-28; 15(3):228-233), and gastrointestinal diseases (such as gastrointestinal injury, inflammatory bowel disease, intestinal ischemia-reperfusion injury, gastrointestinal tumors, gastroparesis) (Journal of DalianMedical University,2022,44(1):69-74) etc.
[0095] The diseases or symptoms that benefit from GCLM activation and increased mRNA expression and / or protein levels and / or activity of GCLM described in this article include, but are not limited to: gastric cancer, schizophrenia, esophageal cancer, cognitive impairment, renal cancer, human granulosa cell carcinoma, liver cancer, lung cancer, breast cancer, ovarian cancer, neurofibromatosis (Senior Sister Tumor Research, Vol.12 No.1 (January 2022)), stroke, cerebral infarction, cerebrovascular disease, coronary heart disease, asthma, chronic myeloid leukemia (https: / / www.silexon.tech / bio / c_GCLM), acute kidney injury, degenerative diseases (Alzheimer's disease, Huntington's disease and Parkinson's disease), cerebral hemorrhage, traumatic brain injury and ischemia-reperfusion injury (Journal of Army Medical University, 2023, 45(7):639-644), etc.
[0096] Nrf2 pathway agonists and their applications
[0097] In some embodiments, this application provides the use of odd-carbon fatty acids or combinations thereof in the preparation of Nrf2 pathway agonists. More specifically, in some embodiments, this application provides the use of odd-carbon fatty acids or combinations thereof in the preparation of Nrf2 agonists. The Nrf2 pathway agonists described herein, especially Nrf2 agonists, may contain odd-carbon fatty acids or oily compositions thereof, for example, the content of odd-carbon fatty acids in the agonist may be 0.1 wt% or more, such as 1 wt% or more, 5 wt% or more, 10 wt% or more, 20 wt% or more, 30 wt% or more, or 50 wt% or more. In some embodiments, the Nrf2 pathway agonist is an odd-carbon fatty acid, especially C15:0, or an oily composition containing odd-carbon fatty acids (especially C15:0), preferably the oily composition described in any of the foregoing embodiments.
[0098] Activation of the Nrf2 pathway can improve the physical condition of newborn mammals, and odd-carbon fatty acids can improve the physical condition of mammals during pregnancy and / or postpartum. Therefore, in some embodiments, this application provides a method for improving the physical condition of mammals during pregnancy and / or postpartum, the method comprising administering a desired effective amount of odd-carbon fatty acids or a composition containing odd-carbon fatty acids to the mammal. This application also provides a method for improving the physical condition of newborn mammals, the method comprising administering a desired effective amount of an Nrf2 pathway agonist or a composition containing the agonist to the mammal. This invention also provides the use of an Nrf2 pathway agonist in the preparation of compositions for improving the physical condition of newborn mammals, and the use of odd-carbon fatty acids or compositions containing odd-carbon fatty acids in the preparation of compositions for improving the physical condition of mammals during pregnancy and / or postpartum. In some embodiments, this invention also provides odd-carbon fatty acids or compositions containing odd-carbon fatty acids used in methods for improving the physical condition of mammals during pregnancy and / or postpartum, and Nrf2 pathway agonists or compositions containing the agonist used in methods for improving the physical condition of newborn mammals.
[0099] In this document, the Nrf2 pathway agonist may contain at least one of an Nrf2 agonist, an NQO1 agonist, an HO-1 agonist, and a GCLM agonist. This invention may be practiced using Nrf2 agonists, NQO1 agonists, HO-1 agonists, and GCLM agonists known in the art.
[0100] In some embodiments, the composition containing the Nrf2 pathway agonist can be a food fortifier or a food product. Food fortifiers are natural or synthetic food additives added to food to artificially increase its nutritional content. Food fortifiers typically include: minerals such as calcium, iron, zinc, selenium, magnesium, potassium, sodium, copper, manganese, chromium, strontium, and vanadium; vitamins such as VA, VD, VE, VC, B vitamins (VB1, VB2, VB3, VB5, VB6, VB12), folic acid, and biotin; amino acids such as taurine and the eighteen essential amino acids; and other nutrients such as DHA, ARA, oligosaccharides, dietary fiber, prebiotics, lecithin, nucleotides, CPP, choline, and L-carnitine. Odd-carbon fatty acids or compositions containing odd-carbon fatty acids, such as oil compositions, can be added to conventional food fortifiers.
[0101] In some implementations, the food fortifier is also referred to as a health product or fortifier. Article 3.1 of GB16740-97 "General Standard for Health (Functional) Foods" defines health food (health product) as: "Health (functional) food is a type of food that has the common characteristics of general food, can regulate the functions of the human body, is suitable for consumption by specific groups of people, but is not intended to treat diseases."
[0102] The food fortifier of the present invention can be added to food, for example, as an ingredient in flour, cereals, confectionery, pastries, baby food, beverages, etc.
[0103] The emulsion may be infant formula or preserved breast milk, with appropriate amounts of the odd-carbon fatty acids described herein or an oil composition containing odd-carbon fatty acids added. Similarly, the milk powder may be infant formula, with appropriate amounts of the odd-carbon fatty acids described herein or an oil composition containing odd-carbon fatty acids added. Other components in the emulsion and milk powder may be various components known in the art as found in emulsions and milk powders, including but not limited to carbohydrates, proteins, emulsifiers, etc. Carbohydrates may include digestible carbohydrates and indigestible carbohydrates. Digestible carbohydrates are typically sugars commonly added to formula milk powder, including but not limited to at least one of lactose, glucose, galactose, maltose, sucrose, fructose, starch, maltodextrin, glucose syrup, and corn syrup. Emulsifiers include phospholipids, monoglycerides, etc. Proteins may be provided by whey protein powder, etc. The amounts of these components are conventional amounts known in the art. An oil composition containing odd-carbon fatty acids described herein may be added to conventional cod liver oil to obtain an oil with Nrf2 pathway activation. Similarly, odd-numbered fatty acids or oils containing odd-numbered fatty acids (such as algal oil) can be added to common nutritional supplements to replace some or all of the oils contained in the original nutritional supplements.
[0104] Food can be a daily diet (including beverages) for pregnant and / or postpartum mammals and newborn mammals, fortified with odd-carbon fatty acids or oil compositions containing odd-carbon fatty acids as described herein. For example, for humans, oils containing odd-carbon fatty acids as described herein can be used to prepare the daily meals of pregnant and postpartum women, partially or completely replacing the original oils, and / or odd-carbon fatty acids can be added directly to their daily diet. For animals, odd-carbon fatty acids or oils containing odd-carbon fatty acids can be added to their feed, partially or completely replacing the original oils.
[0105] In this article, the mammals referred to can be humans, such as pregnant women; or domesticated mammals, such as sows, cows, or ewes.
[0106] In this document, the improvement of mammalian physical condition includes, but is not limited to, promoting postpartum recovery in female mammals, increasing lactose content in the milk of lactating mammals (thereby improving milk quality), increasing prolactin levels in pregnant or postpartum mammals, improving mammary gland development and lactation capacity, improving the digestibility of fiber (especially neutral and acid detergent fibers) in pregnant or postpartum mammals, enhancing intestinal utilization of fiber, and improving neonatal survival and weight catch-up in low birth weight mammals. In some embodiments, the improvement of mammalian physical condition includes improving post-weaning estrus in farmed mammals, such as increasing estrus rate and / or shortening estrus interval.
[0107] Therefore, in some embodiments, the present invention provides the use of odd-numbered carbon fatty acids or compositions containing odd-numbered carbon fatty acids in the preparation of compositions for one or more of the following uses:
[0108] (1) Improve the physical condition of pregnant and lactating women; (2) Increase the lactose content in breast milk and improve the quality of breast milk; (3) Increase the prolactin level of pregnant and lactating women, improve mammary gland development and lactation capacity; and (4) Improve the digestibility of neutral detergent fiber and acid detergent fiber by pregnant and lactating women, and improve the utilization of fiber by the intestines.
[0109] In some embodiments, the present invention provides the use of Nrf2 pathway agonists in the preparation of compositions for improving weight catch-up in neonatal low birth weight infants.
[0110] In some embodiments, the present invention also provides the use of odd-carbon fatty acids or compositions containing odd-carbon fatty acids in the preparation of compositions for one or more of the following uses: (1) improving the recovery of body condition in farmed mammals and shortening the estrus period; (2) increasing the lactose content in the milk of farmed mammals and improving milk quality; (3) increasing the prolactin levels in farmed mammals during pregnancy and lactation, improving mammary gland development and lactation capacity; and (4) improving the digestibility of neutral detergent fiber and acid detergent fiber in farmed mammals during pregnancy and lactation, and improving the utilization of fiber by the intestines.
[0111] In some embodiments, the present invention provides the use of Nrf2 pathway agonists in the preparation of compositions for improving the growth performance and survival rate of farmed mammal offspring with intrauterine growth retardation.
[0112] The present invention will be further described below by way of specific embodiments. It should be understood that these embodiments are merely illustrative and are not intended to limit the scope of the invention. Unless otherwise stated, the methods and reagents used in the embodiments are conventional methods and reagents in the art.
[0113] Example 1: Cell Experiment
[0114] 1. MODE-K cell culture
[0115] MODE-K cells (provided by the College of Animal Science and Technology, China Agricultural University) were seeded in DMEM basal medium (Gibco) containing 10% fetal bovine serum and 1% penicillin (100 U / mL penicillin, 0.1 mg / mL streptomycin). The cells were placed in a humidified cell culture incubator at 37°C with 5% CO2. When the cell density reached 80%-90%, the cells were passaged using 0.25% EDTA-trypsin (Gibco) and then subjected to subsequent experimental analysis.
[0116] 2. CCK-8 assay for the cytotoxicity of C15:0 cells
[0117] The toxicity of C15:0 (Sigma, 99.9% purity) to MODE-K cells was determined using the CCK-8 Cell Proliferation-Cytotoxicity Assay Kit (Beiren Chemical Technology Co., Ltd.). MODE-K cells were seeded into 96-well cell culture plates at a seeding density of 5 × 10⁶ cells / well. 4Cells were cultured at 100 μL / mL in a constant temperature incubator for 24 h, and the supernatant was aspirated. DMEM medium containing different concentrations of C15:0 (0, 5, 10, 20, 50, 100 μM) was added to each well, and the cells were cultured at 37°C for 6, 12, and 24 h, respectively. The medium was then aspirated, and 100 μL of DMEM medium containing 10% CCK-8 reagent was added to each well. The cells were then cultured at 37°C for 1 h. The absorbance was measured at 450 nm using a microplate reader to calculate cell viability.
[0118] 3. Using H2O2 to construct a cell damage model
[0119] After culturing the cells according to the above method, the supernatant was aspirated, and culture medium containing different concentrations of H2O2 (0.2mM, 0.4mM, and 0.6mM) was added, and the cells were cultured in an incubator at 37°C. The cell viability was then detected using the CCK-8 assay.
[0120] 4. Effect of C15:0 on the survival rate of H2O2-induced MODE-K cell model
[0121] Cells were divided into a blank control group (DMEM medium), a model group (DMEM medium + H2O2), and an experimental group (different concentrations of C15:0 + H2O2). After culturing the cells according to section 2.2, the experimental group was treated with the corresponding concentrations of C15:0 (0, 5, 10, 20, 50, 100 μM) for 24 h. Then, the cells were treated with three different concentrations of H2O2 (0.2 mM, 0.4 mM, 0.6 mM) for 1 h. Cell viability was detected using the CCK-8 assay.
[0122] 5. Effects of C15:0 on the expression levels of genes related to the Nrf2 signaling pathway in H2O2-induced MODE-K cells
[0123] After culturing and treating cells according to step 4, cells were collected using cell lysis buffer, and total RNA was extracted from cells in different treatment groups. The RNA was reverse-engineered into cDNA, and the expression levels of Nrf2 signaling pathway-related proteins (Nrf2, Keap1, HO-1, NQO1, GCLM) were detected using RT-qPCR.
[0124] The primer sequences are shown in the table below:
[0125] Primer name Primer sequences (5' to 3') Serial Number M-Nrf2 forward primer TCTTGGAGTAAGTCGAGAAGTGT 1 M-Nrf2 reverse primer GTTGAAACTGAGCGAAAAAGGC 2 M-HO-1 forward primer AAGCCGAGAATGCTGAGTTCA 3 M-HO-1 reverse primer GCCGTGTAGATATGGTACAAGGA 4 M-Keap1 forward primer TGCCCCTGTGGTCAAAGTG 5 M-Keap1 reverse primer GGTTCGGTTACCGTCCTGC 6 M-NQO1 forward primer AGGATGGGAGGTACTCGAATC 7 M-NQO1 reverse primer AGGCGTCCTTCCTTATATGCTA 8 M-GCLM forward primers AGGAGCTTCGGGACTGTATCC 9 M-GCLM reverse primer GGGACATGGTGCATTCCAAAA 10
[0126] 6. Results
[0127] (1) C15:0 can improve cell survival.
[0128] Figure 1 The results showed that treatment with 0.2 mM hydrogen peroxide for 12 h could lead to a decrease in cell viability. Figure 2Under normal conditions, C15:0 can improve cell survival rate. Figure 3 The results showed that C15:0 can enhance cell survival under conditions of hydrogen peroxide damage.
[0129] (2) C15:0 activates the Nrf2 pathway
[0130] Figure 4 The results showed that hydrogen peroxide induction led to a decrease in the mRNA levels of Nrf2 and its downstream target factors, indicating that hydrogen peroxide disrupts the Nrf2 pathway. However, the addition of C15:0 increased the expression of Nrf2 protein mRNA and enhanced the mRNA expression of its downstream target factors NQO1 (quinone oxidoreductase), HO-1 (heme oxidase), and GCLM (glutathione synthase), indicating that C15:0 can activate the Nrf2 pathway.
[0131] Example 2: Animal Experiment
[0132] 1. Experimental Design
[0133] Thirty-two 7-week-old male C57BL / 6J mice were randomly divided into four groups of eight each: 1) CON group, administered 100 μL PBS by gavage daily, followed by an intraperitoneal injection of 200 μL PBS on day 14; 2) PA group, administered C15:0 at 45 mg / kg body weight by gavage daily, followed by an intraperitoneal injection of 200 μL PBS on day 14; 3) Diquat group, administered 100 μL PBS by gavage daily, followed by an intraperitoneal injection of 25 mg / kg body weight of Diquat on day 14; 4) C15:0+Diquat group, administered C15:0 at 45 mg / kg body weight by gavage daily, followed by an intraperitoneal injection of 25 mg / kg body weight of Diquat on day 14. Mice were sacrificed and samples were collected on day 15 of the experiment.
[0134] 2. Sample Collection and Analysis
[0135] (1) Effect of C15:0 on growth performance of mice
[0136] Mice were weighed and their food intake was recorded on days 1, 7, and 14 of the experiment and before slaughter.
[0137] (2) Effects of C15:0 on the mouse Nrf2 signaling pathway
[0138] Mouse jejunal fixed and molecular samples were collected, and the expression levels of genes related to the Nrf2 signaling pathway in the jejunum were detected by RT-qPCR.
[0139] 3. Results
[0140] Depend on Figure 5The study showed that the pesticide Diquat (DIQ) caused damage to mice, leading to weight loss. The addition of C15:0 could alleviate the weight loss induced by Diquat in mice.
[0141] Figure 6 The results showed that stimulation with diquat led to a decrease in the expression levels of Nrf2 and its downstream target factor mRNA in the mouse jejunum, indicating that diquat caused damage to the Nrf2 signaling pathway in the mouse jejunum. However, the addition of C15:0 significantly increased the expression levels of Nrf2 and its downstream target factor mRNA, indicating that C15:0 can activate the Nrf2 signaling pathway.
[0142] In summary, both cell and animal experiments have demonstrated that C15:0 can increase the expression of Nrf2 and its downstream target factor mRNA, indicating that C15:0 can activate the Nrf2 signaling pathway and can act as an Nrf2 activator.
[0143] Example 3: Odd-numbered carbon fatty acids and the health of pregnant and lactating mammals
[0144] 1. Experimental Procedure
[0145] 1.1—Preparation of Oils and Fats
[0146] Oil 1: DHA algal oil (Qingdao Keyuan) and palm oil-derived stearin (Hard ST) (Yihai Kerry) were melted and mixed evenly at a mass ratio of 49:51, followed by chemical transesterification to ensure uniform distribution of fatty acids on the glycerol backbone. The chemical transesterification process was as follows: first, vacuum dehydration was carried out at 110℃ for 1 hour, then 0.2% sodium methoxide was added, and the reaction was carried out under vacuum at 110℃ for 1 hour. After cooling to below 80℃, 1.8 times the mass of sodium methoxide and citric acid (prepared as a 10% citric acid solution) were added. After stirring, the mixture was poured into a separatory funnel, washed with hot water until neutral, and then vacuum dehydrated at 110℃. The resulting oil was refined using conventional oil refining methods to obtain Oil 1.
[0147] Oil refining methods:
[0148] 1. Weigh 500g of oil into a 2L glass jacket reactor and heat it naturally until it melts and keep it at 60℃. Stir at 200rpm and keep the reactor under nitrogen protection throughout the process. Detect AV (acid value) and PV.
[0149] 2. Water washing: Gradually add citric acid solution (15% water, 0.5‰ citric acid), stirring at 200 rpm for 5 minutes, then stop stirring and let it settle for 4 hours. After settling, lower the aqueous phase. Then gradually add water (15% water), stirring at 200 rpm for 5 minutes, then stop stirring and let it settle for 4 hours. After settling, lower the aqueous phase.
[0150] 3. Alkali refining: Sample and test AV and PV, calculate the amount of alkali to be added, alkali amount = theoretical alkali (0.713 × oil weight (tons) × acid value / 0.93 alkali concentration) + excess alkali (crude oil weight * 0.0005), water amount (kg) = alkali amount (kg) × 40; prepare alkali solution with water and alkali; heat the oil to 60℃; start stirring at 100 rpm, then add alkali solution within 5 minutes, stir rapidly for 5 minutes after addition, let stand and settle for 4-6 hours; after settling, discard the lower aqueous phase; brine washing: add 15% water and 0.5‰ salt dropwise to the oil, stirring at 100 rpm, stir for 3 minutes and then turn off stirring, let settle for 3 hours, after settling, discard the lower aqueous phase. Alkaline washing: Add 15% water and 0.2‰ alkali dropwise to the oil while stirring at 100 rpm for 3 minutes. Turn off the stirring and allow the mixture to settle for 3 hours. After settling, discharge the lower aqueous phase. Repeat the alkaline washing twice. Water washing: Add 15% water and stir for 3 minutes after addition. Then turn off the stirring and allow the mixture to settle for 3 hours. After settling, discharge the lower aqueous phase. Perform a total of two water washes.
[0151] 4. Decolorization: Decolorization and deodorization are carried out using conventional methods. The decolorization temperature is 105℃, and approximately 2% (by weight of oil) of bleaching clay is added as a decolorizing adsorbent. The vacuum degree is 10 min, and the decolorization is carried out for 0.5 h before filtration.
[0152] 5. Deodorization: The temperature is 200℃, the vacuum degree is 5mbar, nitrogen is introduced, and the deodorization time is 2 hours. After refining, refined oil is obtained.
[0153] Oil 2: Algal oil (Yihai Kerry) containing OCFA and DHA and high-oleic sunflower seed oil (Yihai Kerry) were melted and mixed evenly at a mass ratio of 93:7, and then subjected to chemical transesterification (the chemical transesterification method is the same as that of Oil 1) to make the fatty acids evenly distributed on the glycerol backbone. The subsequent oil refining method is the same as that of Oil 1 to obtain Oil 2.
[0154] 1.2—Composition of Fatty Acids in Oils and Fats
[0155] The fatty acid composition of oils and fats was determined according to the normalization method, Method III, in "GB5009.168-2016 National Food Safety Standard - Determination of Fatty Acids in Food". The fatty acid composition (%) of oils and fats is shown in Table 1.
[0156] Table 1: Fatty acid composition of oils and fats
[0157]
[0158]
[0159] 1.3 Animal Experiments
[0160] Experimental Design and Animals: Thirty-six pregnant sows with similar body conditions (similar parity, weight, backfat, and gestational age of 85) were randomly divided into three groups of 12 sows each. The sows were grouped according to the amount of fat in their daily diet: (a) Control group: sows were fed a basal diet; (b) DHA algal oil group: sows were fed a basal diet supplemented with 20g / sow / day of fat1; (c) DHA+OCFA algal oil group: sows were fed a basal diet supplemented with 20g / sow / day of fat2. The supplemented fat was mixed into the first meal of the day to ensure the sows consumed all of it; the rest of the day, the sows were fed normally. The experiment began on day 85 of gestation and ended on day 21 of lactation. Growth and reproductive performance of the sows were recorded, and plasma, milk, and fecal samples were collected.
[0161] Sow feeding and management: All animal operations in this experiment were performed in accordance with the relevant procedures and requirements of animal welfare at China Agricultural University. The feeding experiment was conducted at the Animal Experiment Base of the Feed Industry Center of China Agricultural University (Fengning, Hebei). From day 85 to day 107 of gestation, sows were kept individually in gestation stalls in the gestation house, and each sow was fed 3 kg of feed per day (1 kg each at 4:00, 10:00, and 15:00). On day 107 of gestation, the sows were transferred to the farrowing house, and from day 107 of gestation until farrowing, each sow was allowed to consume 2.76 kg of feed per day (at 9:00 and 15:00). After farrowing, the sows began to consume lactation feed. On the day of farrowing, each sow was fed approximately 0.5 kg of feed, and over the following week, the feed was increased by approximately 1 kg per day until free access to feed was achieved. Sows had free access to water throughout the experimental period. The ambient temperature in the farrowing house was controlled at 20–23℃.
[0162] Table 2: Dietary composition and nutrient levels (%, feeding basal level) for sows during late gestation and lactation
[0163]
[0164] Note: The premix provides the following per kg of diet: Vitamin A 12,000 IU, Vitamin E 24 IU, Vitamin K3 2.0 mg, Vitamin B1 2.0 mg, Vitamin B2 6.0 mg, Vitamin B6 4 mg, Vitamin B12 24 μg, Niacin 30 mg, Pantothenic Acid 20 mg, Folic Acid 3.6 mg, Biotin 0.4 mg, Choline Chloride 0.4 mg, Iron 96 mg, Copper 8.0 mg, Zinc 120 mg, Manganese 40 mg, Iodine 0.56 mg, Selenium 0.4 mg.
[0165] 2. Nutritional effects
[0166] 2.1 Postpartum body condition of sows
[0167] As shown in Table 3, supplementation with two different algal oils during late pregnancy and lactation had no significant effect on sow body weight and backfat (P>0.05). Compared with the control group and the DHA algal oil group, the DHA+OCFA algal oil group increased the estrus rate within 7 days after weaning (control group = 66.67%, DHA algal oil group = 75.00%, DHA+OCFA algal oil group = 100.00%) and reduced the estrus interval after weaning (control group = 5.2 days, DHA algal oil group = 4.7 days, DHA+OCFA algal oil group = 3.8 days). These results indicate that supplementation with DHA+OCFA algal oil during late pregnancy and lactation improved sow body condition recovery and thus improved post-weaning estrus.
[0168] Table 3: Effects of supplementation with two different algal oils during late gestation and lactation on the body condition of sows
[0169]
[0170] 2.2 Composition of pig milk
[0171] The composition of colostrum and normal milk was determined according to the methods described in Chapter 2, "Routine and Immunoglobulin Content of Colostrum and Normal Milk," in Li Longxian's "The Effects and Mechanisms of α-Lauryl Monoglyceride on the Production Performance of Lactating Sows and Weaned Piglets." The results are shown in Table 4 below.
[0172] Table 4: Effects of supplementation with two different algal oils during late pregnancy and lactation on the composition of colostrum and normal milk in sows.
[0173]
[0174] As shown in Table 4, compared with the control group and the DHA algal oil group, the DHA+OCFA algal oil group increased the lactose content in colostrum and 21-day-old breast milk, indicating that DHA+OCFA algal oil supplementation can improve milk quality by improving the lactose content of breast milk.
[0175] 2.3 Plasma components of gestational sows
[0176] Plasma biochemical indicators were detected according to the "Blood Biochemical Indicators" method in Chapter 2 of Li Longxian's "The Effects and Mechanisms of α-Lauryl Monoglyceride on the Production Performance of Lactating Sows and Weaned Piglets". The results are shown in Table 5 below.
[0177] Table 5: Effects of supplementation with two different algal oils during late pregnancy and lactation on plasma biochemical parameters in sows
[0178]
[0179] As shown in Table 5, compared with the control group, the DHA algal oil group and the DHA+OCFA algal oil group showed increased plasma prolactin levels on day 7 of lactation (P<0.01), while the DHA+OCFA algal oil group showed increased plasma prolactin levels in sows on day 110 of gestation (P<0.01), at farrowing (P=0.07), and day 21 of lactation (P<0.01). Furthermore, on day 21 of lactation, the plasma prolactin level in sows in the DHA+OCFA algal oil group was significantly higher than that in the DHA algal oil group (P<0.01). These results indicate that DHA+OCFA algal oil increased plasma prolactin levels in sows during gestation and lactation, suggesting that supplementation with DHA+OCFA algal oil during gestation and lactation can improve mammary gland development and lactation capacity in sows.
[0180] 2.4 Supplementing with DHA / OCFA algal oil improves fiber utilization.
[0181] Neutral detergent fiber (NDF) is a measurement index of plant cell wall or fiber components. The measured NDF mainly includes cellulose, hemicellulose, and lignin, which are composed of insoluble non-starch polysaccharides and lignin, and can accurately reflect the actual fiber content. Acid detergent fiber (ADF) is the main component of fibrous carbohydrates or structural carbohydrates, mainly composed of cellulose, lignin, and insoluble protein complexes, and is a good indicator of digestibility. The apparent intestinal digestibility of sows after 21 days of lactation was measured, and the results are shown in the table below.
[0182] The total intestinal digestibility was tested according to the method described in Chapter 2, "The Effects and Mechanisms of α-Lauryl Monoglyceride on the Production Performance of Lactating Sows and Weaned Piglets," by Li Longxian. The results are shown in Table 6 below.
[0183] Table 6: Apparent intestinal digestibility of sows after 21 days of lactation (%)
[0184]
[0185] As shown in Table 6, compared with the control group, the apparent digestibility of neutral detergent fiber and acid detergent fiber in sows in the DHA / OCFA algal oil group was significantly improved, indicating that OCFA is beneficial to improving intestinal fiber utilization. Furthermore, the digestibility of neutral detergent fiber in the DHA group did not show a significant improvement compared to the control group, while the DHA / OCFA algal oil group showed a significant improvement compared to the control group, indicating that the combined effect of OCFA and DHA is more effective than DHA in improving the utilization rate of neutral detergent fiber in the intestine.
[0186] 2.5 Supplementation with DHA / OCFA algal oil improved the growth performance and survival rate of IUGR piglets in litters.
[0187] like Figure 7As shown, compared with the control group and the DHA algal oil group, the DHA / OCFA algal oil group significantly increased the average IUGR weight of piglets in litters on days 7, 14, and 21 of lactation. Figure 7 (A, P<0.01) and the average daily weight gain of IUGR piglets in the litter during the lactation period ( Figure 7 B, P<0.01). Furthermore, DHA / OCFA algal oil supplementation significantly increased the survival rate of IUGR piglets during lactation (CON=78.6%, DHA=76.9%, DHA / OCFA=90.0%). However, the DHA / OCFA algal oil group did not significantly increase the growth performance of normal birth weight piglets compared to the DHA algal oil group. Figure 8 The above results indicate that OCFA is beneficial for weight catch-up in neonatal mammals with low birth weight.
[0188] Example 4: Pentadecanoic acid glyceride supplementation promotes the health of IUGR piglets
[0189] 1. Oil and fat preparation
[0190] Glycerol (Yihai Kerry) and pentadecanoic acid (purchased from Titan Platform, Adamas, purity ≥95%) were mixed in a 1:4 molar ratio and heated to 70°C until homogeneous. This mixture served as the reaction substrate. 10% (by weight) of immobilized enzyme NOVO435 (Novozymes) was added, and the reaction was carried out at 70°C, 300 rpm, and a vacuum of ≤10 mbar for 15 hours to obtain the crude oil product. The crude oil product was then subjected to molecular distillation; the heavy phase was pentadecanoic acid glyceride (C15-TAG), with a purity >98%.
[0191] 2. Preparation of oil powder
[0192] 15 g of monoglyceride (Yihai Kerry, model DMG-CF01), 15 g of phospholipid (Yihai Kerry, non-GMO soybean phospholipid), and 300 g of the above C15-TAG were mixed and stirred at 60°C until dissolved and homogeneous. An aqueous solution obtained by dissolving 1.08 kg of lactose and 97.5 g of sodium caseinate in 3.5 kg of pure water was added. The mixture was subjected to high-speed shearing at 12000 rpm for 8 minutes and homogenized twice under high pressure at 300 bar to complete the emulsion preparation. The emulsion was then spray-dried at an inlet temperature of 180°C and an outlet temperature of 90°C to obtain oil powder 1.
[0193] Replace the C15-TAG with Hard ST and prepare the oil powder according to the above method to obtain oil powder 2.
[0194] 3. Animal experiments
[0195] 3.1 During the experiment, 225 mg of oil powder was accurately weighed using a 1 / 250000 balance. 1 mL of warm water (approximately 65℃) was added to the oil powder to ensure complete dissolution and mixing, resulting in an oil powder emulsion with a triglyceride concentration of 45 mg / mL. The oil powder emulsion was prepared fresh for each use. During the administration of the oil powder emulsion to piglets, the solution should be kept homogeneous to prevent precipitation. Furthermore, during administration, the emulsion should be kept as high as possible above the piglet's mouth and added slowly to lower the emulsion temperature and prevent scalding.
[0196] The experiment included 24 IUGR piglets (birth weight 0.94±0.03 kg, half male and half female) and 12 lactating sows with similar body condition (parity = 2.25±0.43, body weight = 213.21±15.11 kg, backfat = 17.17±1.14 mm). The 24 IUGR piglets were randomly assigned to 12 litters, with 2 piglets per litter, of the same sex. The 2 IUGR piglets from each litter were then randomly assigned to either the HardST group (C16:0 group) or the pentadecanoic acid triglyceride group (C15:0 group), with 12 piglets per group, half male and half female. The experiment lasted from day 1 to day 21 of lactation. During days 1-7 of lactation, piglets in group C16:0 were administered pentadecanoic acid triglyceride oil powder emulsion at a rate of 1 mL / kg BW / d, while piglets in group C15:0 were administered pentadecanoic acid triglyceride oil powder emulsion at a rate of 1 mL / kg BW / d. Piglet body weight was recorded on days 1-7 and on days 14 and 21 of lactation, and average daily weight gain was calculated. Plasma and fecal samples were collected from piglets on days 8 and 21 of lactation. On day 21 of lactation, molecular and fixed samples of liver, adipose tissue, jejunum, ileum, and colon, as well as molecular and fixed samples of mucosa and cecal chyme were collected and analyzed.
[0197] 4. Nutritional effects
[0198] The results are as follows Figure 9 As shown. The results showed that early oral administration of pentadecanoic acid triglycerides significantly increased the average body weight of IUGR piglets on days 14 and 21 of neonatal period (as shown). Figure 9 (P<0.05), and significantly increased the average daily weight gain of IUGR piglets during the neonatal period ( Figure 10 (P<0.05). The above results indicate that early oral administration of pentadecanoic acid triglycerides significantly improved the growth performance of neonatal IUGR piglets.
Claims
1. The use of odd-carbon fatty acids or compositions containing odd-carbon fatty acids in the preparation of medicaments for the treatment and / or prevention of Nrf2 pathway-mediated diseases or symptoms.
2. The application as described in claim 1, characterized in that, The composition containing odd-numbered carbon fatty acids is a mixture of any one or more of the following: odd-numbered carbon fatty acids, preferably including at least pentadecanoic acid monoglycerides, diglycerides, and triglycerides. Preferably, the composition is an oil composition; preferably, the content of odd-numbered carbon fatty acids in the fatty acid composition is 1-100%, such as 5-100%, 10-100%, 20-100%, 30-100%, 20-80%, 20-60%, or 30-50%; preferably, the odd-numbered carbon fatty acids in the fatty acid composition include pentadecanoic acid and heptadecanoic acid, and optionally also contain undecanoic acid and tridecanoic acid; preferably, the content of pentadecanoic acid in the fatty acid composition is 10-100%, such as 20-100%, 30-100%, or 30-100%. The fatty acid composition of the oil composition contains 0%, 20-80%, 20-60%, 30-50%, 30-40%, or 33-37%; preferably, the content of heptadecanoic acid is 2-15%, such as 5-15% or 8-12%; preferably, the fatty acid composition of the oil composition further contains 0.01-0.5% undecanoic acid and 0.2-1.5% or 0.5-1.5% tridecanoic acid; preferably, the content of pentadecanoic acid in the fatty acid composition of the oil composition is 10-40%, preferably 30-40% or 33-37%, and the content of heptadecanoic acid is 2-15%, preferably 5-15% or 8-12%.
3. The application as described in claim 1, characterized in that, The Nrf2 pathway-mediated diseases or symptoms include those that benefit from the activation of at least one of Nrf2, NQO1, HO-1, and GCLM, and increased mRNA expression levels and / or protein levels and / or activity of at least one of Nrf2, NQO1, HO-1, and GCLM. Preferably, the diseases or symptoms that benefit from Nrf2 activation and increased Nrf2 mRNA expression levels and / or protein levels and / or activity include intestinal diseases or chronic diseases, such as systemic diseases of the digestive, respiratory, cardiovascular, musculoskeletal, and nervous systems, specifically including chronic obstructive pulmonary disease, asthma, diabetes, tumors and multiple sclerosis, as well as high glucose and high lipid-induced glucolipotoxicity. Preferably, the diseases or symptoms that benefit from NQO1 activation and increased NQO1 mRNA expression levels and / or protein levels and / or activity are selected from skin cancer, Alzheimer's disease, Crohn's disease of the stomach and duodenum, tardive dyskinesia, childhood leukemia, papillary thyroid microcarcinoma, senile cataract, hepatocellular adenoma, cell lymphoma, chronic atrophic gastritis, neonatal bronchopulmonary dysplasia, liver oxidative stress, clear cell renal cell carcinoma, breast cancer, pancreatic ductal carcinoma, colon cancer, cervical cancer, lung cancer, colorectal cancer, pancreatic cancer, prostate cancer, and T-cell lymphoma; or Preferably, the diseases or symptoms that benefit from HO-1 activation and increased mRNA expression and / or protein levels and / or activity of HO-1 are selected from chronic obstructive pulmonary disease, pulmonary fibrosis, lung cancer, asthma, acute lung injury, wound healing, kidney disease, diabetes, cardiovascular disease, neuroinflammatory diseases, eye diseases (such as corneal disease, glaucoma, cataract, uveitis, Graves' ophthalmopathy, diabetic retinopathy, retinitis pigmentosa), acute liver injury, and gastrointestinal diseases (such as gastrointestinal injury, inflammatory bowel disease, intestinal ischemia-reperfusion injury, gastrointestinal tumors, gastroparesis). or Preferably, the diseases or symptoms that benefit from GCLM activation and increased mRNA expression and / or protein levels and / or activity of GCLM are selected from gastric cancer, schizophrenia, esophageal cancer, cognitive impairment, renal cancer, human granulosa cell carcinoma, liver cancer, lung cancer, breast cancer, ovarian cancer, neurofibromatosis, stroke, cerebral infarction, cerebrovascular disease, coronary heart disease, asthma, chronic myeloid leukemia, acute kidney injury, degenerative diseases (such as Alzheimer's disease, Huntington's disease, and Parkinson's disease), cerebral hemorrhage, traumatic brain injury, and ischemia-reperfusion injury.
4. The use of odd-carbon fatty acids or combinations thereof in the preparation of Nrf2 agonists; preferably, the composition is an oil composition.
5. Selected from the following applications: (1) The application of Nrf2 pathway agonists in the preparation of compositions that improve the physical condition of newborn mammals; and (2) Use of odd-numbered carbon fatty acids or compositions containing odd-numbered carbon fatty acids in the preparation of compositions that improve the physical condition of mammals during pregnancy and / or after childbirth.
6. The application as described in claim 5, characterized in that: (1) The Nrf2 pathway agonist is an odd-numbered carbon fatty acid, especially C15:0, or an oil composition containing an odd-numbered carbon fatty acid (especially C15:0), preferably the oil composition of claim 2. (2) The composition containing odd-numbered carbon fatty acids is an oil composition containing odd-numbered carbon fatty acids (especially C15:0), preferably the oil composition according to claim 2.
7. The application as described in claim 5, characterized in that: The improvement of the physical condition of mammals after pregnancy and / or childbirth includes: (a) Promotes postpartum recovery in mammals; (b) To increase the lactose content in the milk of lactating mammals, thereby improving milk quality; (c) Increase prolactin levels in pregnant or postpartum mammals, and improve mammary gland development and lactation capacity; (d) Improves the digestibility of fiber (especially neutral and acid detergent fibers) in pregnant or postpartum mammals and enhances intestinal utilization of fiber; and (e) Improve estrus after weaning in farmed mammals, such as increasing estrus rate and / or shortening estrus interval; The improvement in the physical condition of newborn mammals includes improving the survival rate and weight catch-up of newborn mammals with low birth weight.
8. The application as described in claim 7, characterized in that, The applications include: (1) Improve the physical condition of pregnant and lactating women; (2) Increase the lactose content in breast milk and improve the quality of breast milk; (3) Increase prolactin levels in pregnant and postpartum women and improve mammary gland development and lactation capacity; (4) Improve the digestibility of neutral and acidic detergent fibers for pregnant and postpartum women and enhance the utilization of fiber in the intestines. (5) Improve weight catch-up in newborns with low birth weight; (6) Improves the recovery of body condition and shortens the estrus period in farmed mammals; (7) Increase the lactose content in the milk of farmed mammals and improve the quality of the milk; (8) Increase prolactin levels in farmed mammals during pregnancy and lactation, and improve mammary gland development and lactation capacity; (9) Improves the digestibility of neutral and acid detergent fibers in farmed mammals during pregnancy and lactation, and enhances intestinal utilization of fiber; and (10) Improve the growth performance and survival rate of farmed mammal cubs with intrauterine growth retardation.
9. The application as described in claim 5, characterized in that, The composition for improving the physical condition of newborn mammals or improving the physical condition of mammals during pregnancy and / or after childbirth is a health product or food.
10. A food fortifier or food for improving the physical condition of pregnant and / or postpartum mammals or newborn mammals, comprising odd-carbon fatty acids (preferably pentadecanoic acid) or a composition containing odd-carbon fatty acids (preferably pentadecanoic acid); preferably, the composition containing odd-carbon fatty acids is an oil composition containing odd-carbon fatty acids (preferably pentadecanoic acid), preferably the oil composition of claim 2.
Citation Information
Patent Citations
Bdh1 gene medicine for treating diabetic kidney diseases
CN116059406A