Transcriptional regulatory factor LysG gene variant and method for producing L-citrulline or L-arginine using same
By performing specific base substitutions on the LysG gene, a gene variant was prepared and introduced into a recombinant vector, solving the problem of low production efficiency of L-citrulline or L-arginine in existing technologies and achieving a significant increase in production capacity.
Patent Information
- Application Number
- CN202510382548.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2024-08-20
- Filing Date
- 2025-03-28
- Publication Date
- 2026-03-03
AI Technical Summary
In existing technologies, the production efficiency of L-citrulline or L-arginine is low, and the variety of proteins directly or indirectly involved, such as enzymes, transcription factors, and transport proteins, makes it difficult to significantly improve their production capacity.
By performing specific base substitutions on the LysG gene, a gene variant is prepared, and its encoded recombinant vector is introduced into host cells to form a transformant, thereby increasing the expression level and activity of the LysG gene and enhancing the production capacity of L-citrulline or L-arginine.
It significantly improved the production capacity of L-citrulline or L-arginine, increasing production by 5% to 50%, with a specific example showing an increase of 13.4% to 24.6%, and optimized cell volume and fermentation yield.
Smart Images

Figure BDA0005335000380000141 
Figure BDA0005335000380000151
Abstract
Description
Technical Field
[0001] This invention relates to variants of the transcriptional regulatory factor LysG gene and methods for producing L-citrulline or L-arginine using it. Background Technology
[0002] Citrulline is a non-essential amino acid with beneficial effects, including promoting ammonia metabolism, improving blood flow through vasodilation, lowering blood pressure, neurotransmission, enhancing immunity, and scavenging reactive oxygen species. In the kidneys, citrulline is metabolized into arginine, producing NO (nitric oxide). While citrulline is not a constituent amino acid of proteins, it is an intermediate in the urea cycle, produced from arginine along with NO, a known vasodilator, which further condenses with aspartic acid to regenerate arginine.
[0003] Although arginine is a non-essential amino acid, it is an essential semi-essential amino acid that is necessary for children during their growth period and in special conditions such as stress, injury, and cancer. It is widely used as an amino acid enhancer, in pharmaceuticals, and in food. As a medicine, it is used as a liver function promoter, brain function promoter, treatment for male infertility, and in comprehensive amino acid preparations. As a food, it is used as an additive in fish cakes, a health drink additive, and a salt substitute for patients with hypertension.
[0004] In the production of citrulline or arginine using microorganisms, naturally occurring wild-type strains or mutant strains modified from wild-type strains to enhance their citrulline or arginine production capabilities can be used to produce L-citrulline or L-arginine. In recent years, to improve the production efficiency of L-citrulline or L-arginine, gene recombination technology has been applied to microorganisms such as *Escherichia coli* and *Corynebacterium*, which are widely used in the production of L-amino acids and other useful substances. This has led to the development of various recombinant strains or mutant strains with excellent L-citrulline or L-arginine production capabilities, as well as methods for producing L-citrulline or L-arginine using these strains. In microorganisms, L-glutamate is synthesized from 2-oxoglutarate, an intermediate in the citric acid cycle. Using 2-oxoglutarate as a starting material, L-citrulline and L-arginine are synthesized through N-acetylglutamate, N-acetylglutamyl-P, N-acetylglutamate 5-semialdehyde, N-acetylornithine, and L-ornithine.
[0005] The biosynthesis of L-citrulline or L-arginine in microorganisms involves various proteins, including enzymes, transcription factors, and transporters, at different stages. Therefore, attempts are made to increase the production of L-citrulline or L-arginine by inducing mutations in the genes encoding these proteins or in the promoters regulating their expression. However, the types of enzymes, transcription factors, and transporters directly or indirectly involved in the production of L-citrulline or L-arginine are diverse. Therefore, whether changes in the activity of these proteins actually increase the production capacity of L-citrulline or L-arginine still requires extensive research.
[0006] Existing technical documents
[0007] Patent documents
[0008] Korean Patent No. 10-1053429
[0009] Korean Patent No. 10-1999454 Summary of the Invention
[0010] The purpose of this invention is to provide a gene variant of the transcriptional regulatory factor LysG.
[0011] In addition, the present invention aims to provide a recombinant vector comprising the above-mentioned gene variants.
[0012] Furthermore, the present invention aims to provide a transformant that utilizes the aforementioned recombinant vector for transformation.
[0013] In addition, the present invention aims to provide a method for producing L-citrulline or L-arginine using the above-described transformants.
[0014] One embodiment of the present invention provides a variant of the gene encoding the transcriptional regulator LysG, specifically, a variant of the transcriptional regulator LysG gene comprising the base sequence of SEQ ID NO:3 in which the 78th base of the SEQ ID NO:1 is replaced by A instead of C; or a variant of the transcriptional regulator LysG gene comprising the base sequence of SEQ ID NO:5 in which the 78th base of the SEQ ID NO:1 is replaced by A instead of C and the 138th base is replaced by A instead of G.
[0015] The "transcriptional regulator" LysG used in this invention is a protein that not only positively regulates lysine but also positively regulates the expression of LysE, a transporter involved in the excretion of citrulline and arginine. The aforementioned transcriptional regulator LysG can be encoded by the LysE gene, but is not limited to this.
[0016] The nucleic acid and protein sequence information of the transcriptional regulator LysG can be obtained from known sequence databases (e.g., GenBank, UniProt).
[0017] According to a specific embodiment of the present invention, the above-mentioned transcriptional regulatory factor LysG gene can be derived from Corynebacterium glutamicum.
[0018] According to a specific embodiment of the present invention, the above-mentioned transcriptional regulatory factor LysG gene includes the base sequence of SEQ ID NO:1, which can encode the amino acid sequence of SEQ ID NO:2.
[0019] In this invention, "variation" refers to changes in the bases, nucleotides, polynucleotides, or nucleic acids of a gene, which may include substitutions, insertions, and deletions. Substitution refers to replacing a base, nucleotide, polynucleotide, or nucleic acid with another base, nucleotide, polynucleotide, or nucleic acid. Insertion refers to adding another base, nucleotide, polynucleotide, or nucleic acid. Deletion refers to removing a base, nucleotide, polynucleotide, or nucleic acid. Genes exhibiting such variations are called variant genes or gene variants.
[0020] The base variations in the aforementioned gene sequence refer to changes or variations in the sequence that show differences in one or more bases or nucleotides (A, T, C, or G; nucleotide A refers to adenine, nucleotide T to thymine, nucleotide C to cytosine, and nucleotide G to guanine). A variation in one base or nucleotide is called a single nucleotide variant. When such base variations exist in regions that encode proteins (coding sequences), they can affect the protein's structure, altering its structure or function. When they exist in non-coding regions that do not encode proteins, such as promoters, they can cause differences in protein expression levels, thus potentially increasing or decreasing the overall activity of the protein.
[0021] Such base variations can result in translated polypeptides or proteins that are the same as or different from the original amino acid sequence.
[0022] The transcription factor LysG gene variant according to the present invention is a substitution of base 78 and / or base 138 in the base sequence of SEQ ID NO:1, which is equivalent to a silent mutation with no change in the amino acid sequence. In the above-mentioned transcription factor LysG gene variant, due to the substitution of base 78, the codon sequence changes from tcc to tca, and due to the substitution of base 138, the codon sequence changes from gtg to gta, and the expression rate or expression level of the gene is expected to change (Wang, Y., et al. An Engineered Rare Codon Device for Optimization of Metabolic Pathways. Sci Rep 6, 20608 (2016)).
[0023] The aforementioned transcriptional regulator LysG gene variants include the base sequences of SEQ ID NO:3 or SEQ ID NO:5, and may consist of or must include sequences having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% homology or identity with each base sequence, except for the variant positions (bases 78 and / or 138). There is no restriction on including any sequence that maintains the function or characteristics of the aforementioned variants. Here, "homology" or "identity" refers to the percentage (%) of similarity between two sequences when the benchmark sequence and any other sequences are aligned in a manner that maximizes correspondence.
[0024] In addition, another embodiment of the present invention provides a recombinant vector comprising the above-described gene variant.
[0025] In addition, another embodiment of the present invention provides a transformant that is transformed using the above-described recombinant vector.
[0026] In this invention, "vector" refers to all types of nucleic acid sequence transport structures used as a means of delivering and expressing a target gene to a variant object (host cell). Unless otherwise specified, the above-mentioned vector can refer to a vector that allows the carried nucleic acid sequence to be inserted into a host cell gene for expression and / or expressed independently. Such a vector includes operably linked necessary regulatory elements for expressing the gene insert. "Operably linked" means that the target gene and its regulatory sequence are functionally linked to each other in a manner that enables gene expression. "Regulatory elements" include promoters for carrying out transcription, arbitrary operon sequences for regulating transcription, sequences encoding suitable mRNA ribosome binding sites, and sequences regulating the termination of transcription and translation.
[0027] The vectors used in this invention are not particularly limited as long as they can replicate in host cells, and any vector known in the art can be used. Examples of the aforementioned vectors include plasmids, granules, viruses, and bacteriophages in their natural or recombinant states. For example, as bacteriophage vectors or granule vectors, there are pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and as plasmid vectors, there are pBR, pUC, pBluescriptII, pGEM, pTZ, pCL, and pET lines, etc., but the invention is not limited to these.
[0028] The vectors described above can be constructed representatively as vectors for cloning or vectors for expression. Vectors for expression can be conventional vectors used in the art for expressing exogenous genes or proteins in plants, animals, or microorganisms, and can be constructed using various methods known in the art.
[0029] The "recombinant vector" used in this invention can be constructed using prokaryotic or eukaryotic cells as hosts, and can replicate independently of the host cell's genome, or can be stitched into the genome itself. The host cell is capable of replicating the vector and may include a replication origin consisting of a specific base sequence that initiates replication. For example, when the vector used is an expression vector and a prokaryotic cell is used as the host, it typically includes a strong promoter that enables transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter), a ribosome binding site for translation initiation, and a transcription / translation termination sequence. When a eukaryotic cell is used as the host, the replication origin initiated in the eukaryotic cell containing the vector includes, but is not limited to, f1 replication origin, SV40 replication origin, pMB1 replication origin, adenovirus replication origin, AAV replication origin, and BBV replication origin. In addition, promoters derived from mammalian cell genomes (e.g., metallothionein promoters) or from mammalian viruses (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, HSV tk promoter) can be used, and they typically have polyadenylated sequences as transcription termination sequences.
[0030] The recombinant vectors mentioned above may include selection markers, which are used to screen for transformants (host cells) transformed using the vector. In the culture medium treated with the selection markers, only cells expressing the selection markers can survive, thus enabling the screening of transformed cells. Representative examples of selection markers include ampicillin, kanamycin, streptomycin, chloramphenicol, etc., but are not limited to these.
[0031] The recombinant vector according to the present invention, as a variant of the transcriptional regulatory factor LysG gene, may include the base sequence of SEQ ID NO:3 or SEQ ID NO:5.
[0032] Transformants can be created by inserting a recombinant vector into a host cell. These transformants can be obtained by introducing the recombinant vector into a suitable host cell. The host cell can be a cell capable of stably and continuously cloning or expressing the expression vector described above, or any host cell known in the art can be used.
[0033] When transforming prokaryotic cells to create recombinant microorganisms, various intestinal bacteria and strains can be used as host cells, such as *Escherichia coli* (e.g., *E. coli* JM109, *E. coli* BL21, *E. coli* RR1, *E. coli* LE392, *E. coli* B, *E. coli* X 1776, *E. coli* W3110, *E. coli* XL1-Blue, *Corynebacterium*, *Bacillus subtilis*, *Bacillus thuringiensis*, etc.; but are not limited to these.
[0034] When transforming eukaryotic cells to create recombinant microorganisms, yeast (e.g., Saccharomyces cerevisiae), insect cells, plant cells, and animal cells can be used as host cells, such as Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, MDCK cell lines, etc., but are not limited to these.
[0035] In this invention, "transformation" refers to the phenomenon of artificially inducing genetic changes by introducing exogenous DNA into host cells, and "transformant" refers to a host cell in which exogenous DNA has been introduced and the expression of the target gene is stably maintained.
[0036] In the above transformation, a suitable vector delivery technique is selected based on the host cell, thereby enabling the expression of the target gene or a recombinant vector containing it within the host cell. For example, vector delivery can be performed via electroporation, heat-shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or combinations thereof, but is not limited to these methods. The transformed gene can be included as long as it can be expressed within the host cell, without limitation on whether it is inserted into or located extrachromosomally within the host cell.
[0037] The aforementioned transformants include cells transfected, transformed, or infected in vivo or in vitro using the recombinant vector according to the invention, and may be used interchangeably with recombinant host cells, recombinant cells, or recombinant microorganisms.
[0038] According to a specific embodiment of the present invention, the above-mentioned transformant can be a strain of the genus Corynebacterium.
[0039] The aforementioned Corynebacterium strains can be *Corynebacterium glutamicum*, *Corynebacterium crudilactis*, *Corynebacterium deserti*, *Corynebacterium callunae*, *Corynebacterium suranareeae*, *Corynebacterium lubricantis*, *Corynebacterium doosanense*, *Corynebacterium efficiens*, *Corynebacterium uterequi*, *Corynebacterium stationis*, *Corynebacterium pacaense*, *Corynebacterium singulare*, *Corynebacterium humireducens*, and *Corynebacterium* var. *marine*. The list includes, but is not limited to, *Corynebacterium marinum*, *Corynebacterium halotolerans*, *Corynebacterium spheniscorum*, *Corynebacterium freiburgense*, *Corynebacterium striatum*, *Corynebacterium canis*, *Corynebacterium ammoniagenes*, *Corynebacterium renale*, *Corynebacterium pollutisoli*, *Corynebacterium imitans*, *Corynebacterium caspium*, *Corynebacterium testudinoris*, *Corynebacterium pseudopelargi*, and *Corynebacterium flavescens*.
[0040] The transformants according to the present invention may be strains including the above-described transcription factor LysG gene variant or vectors containing the above-described transcription factor LysG gene variant, strains expressing the above-described transcription factor LysG gene variant, or strains having activity against proteins encoded by the above-described transcription factor LysG gene variant, but are not limited thereto.
[0041] The transformants in this invention may include other gene variants besides the LysG gene variants mentioned above.
[0042] According to a specific embodiment of the present invention, the above-described transformant may have the ability to produce L-citrulline or L-arginine.
[0043] The aforementioned transformants may naturally possess the ability to produce L-citrulline or L-arginine, or they may be artificially endowed with the ability to produce L-citrulline or L-arginine.
[0044] According to a specific embodiment of the present invention, the above-described transformant can enhance the production capacity of L-citrulline or L-arginine by altering the expression level or activity of the protein encoded by a variant of the transcriptional regulator LysG gene.
[0045] In this invention, "improving L-citrulline or L-arginine production capacity" refers to an increase in L-citrulline / L-arginine production capacity compared to the parental strain. The aforementioned parental strain refers to a wild-type or mutant strain that becomes the target of mutation, including strains directly targeted for mutation or obtained through transformation using recombinant vectors. In this invention, the parental strain may lack or possess L-citrulline / L-arginine production capacity, and can be a wild-type Corynebacterium strain or a Corynebacterium strain mutated from it.
[0046] The transformants according to the present invention, by introducing a variant of the transcriptional regulator LysG gene, alter the expression level or activity of the transcriptional regulator LysG gene or the protein encoded by it, and show increased L-citrulline or L-arginine production capacity compared with strains (parental strains) that include the pre-mutant transcriptional regulator LysG gene. Specifically, the L-citrulline or L-arginine production of the above-mentioned transformants can be increased by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared with the parent strain, or by 1.1 times, 1.5 times, 2 times, 2.5 times, 3 times, 3.5 times, 4 times, 4.5 times, 5 times, 5.5 times, 6 times, 6.5 times, 7 times, 7.5 times, 8 times, 8.5 times, 9 times, 9.5 times, 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or 100 times, but is not limited to these. As an example, the transformation strain introduced with the above-mentioned transcriptional regulatory factor LysG gene variant can increase the production of L-citrulline / L-arginine by more than 5% compared with the parent strain, specifically, by 5 to 50% (preferably 7 to 30%).
[0047] Compositions including the transformants according to the invention can be used as compositions for the production of L-citrulline or L-arginine.
[0048] In addition, according to another embodiment of the present invention, a method for producing L-citrulline or L-arginine is provided, comprising the steps of: culturing the above-mentioned transformant in a culture medium; and recovering L-citrulline or L-arginine from the above-mentioned transformant or the culture medium for culturing the transformant.
[0049] The above-described culture can be carried out using suitable culture media and conditions known in the art, and those skilled in the art can easily adjust the culture media and conditions for use. Specifically, the culture media can be liquid culture media, but is not limited thereto. Culture methods can include, for example, batch culture, continuous culture, fed-batch culture, or combinations thereof, but are not limited thereto.
[0050] According to a specific embodiment of the invention, the culture medium described above must be adapted to meet the requirements of a particular strain in a suitable manner, and may be appropriately modified by those skilled in the art. For information on culture media for Corynebacterium strains, reference may be made to well-known literature (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but it is not limited thereto.
[0051] According to a specific embodiment of the invention, the culture medium may contain various carbon sources, nitrogen sources, and trace element components. Usable carbon sources include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These substances may be used alone or in mixtures, but are not limited thereto. Usable nitrogen sources may include peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal, and urea, or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used alone or in mixtures, but are not limited thereto. Usable phosphorus sources may include potassium dihydrogen phosphate or dipotassium hydrogen phosphate or corresponding sodium-containing salts, but are not limited thereto. Furthermore, the culture medium may contain metal salts such as magnesium sulfate or ferrous sulfate required for growth, but is not limited thereto. In addition, it may contain essential growth substances such as amino acids and vitamins. Furthermore, precursors suitable for the culture medium may be used. The aforementioned culture medium or individual components may be added to the culture medium in batches or continuously during the culture process in an appropriate manner, but are not limited thereto.
[0052] According to one specific embodiment of the invention, during the cultivation process, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid can be added to the microbial culture medium in an appropriate manner to adjust the pH of the culture medium. Furthermore, during the cultivation process, antifoaming agents such as polyethylene glycol esters of fatty acids can be used to suppress bubble formation. Further, to maintain an aerobic state in the culture medium, oxygen or an oxygen-containing gas (e.g., air) can be injected into the culture medium. The temperature of the culture medium is typically between 20°C and 45°C, for example, between 25°C and 40°C. The cultivation time can continue until the desired production of the useful substance is achieved, for example, between 10 and 160 hours.
[0053] According to a specific embodiment of the present invention, in the above-described step of recovering L-citrulline or L-arginine from the cultured transformant or the culture medium for the transformant, the produced L-citrulline or L-arginine can be collected or recovered from the culture medium according to the culture method and using suitable methods known in the art. For example, centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractional dissolution (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobicity and size exclusion), etc., can be used, but are not limited thereto.
[0054] According to a specific embodiment of the present invention, in the above-described step of recovering L-citrulline or L-arginine, the culture medium can be centrifuged at low speed to remove biomass, and the resulting supernatant can be separated by ion exchange chromatography.
[0055] According to a specific embodiment of the present invention, the step of recovering L-citrulline or L-arginine described above may include a step of purifying L-citrulline or L-arginine.
[0056] According to the present invention, the transcription factor LysG gene variant alters the protein activity of the transcription factor LysG by mutating one or more bases in the base sequence of the gene encoding the transcription factor LysG, thereby enabling recombinant microorganisms including the above-mentioned transcription factor LysG gene variant to efficiently produce L-citrulline or L-arginine. Detailed Implementation
[0057] The present invention will now be described in more detail. However, such description is merely illustrative and is intended to aid in understanding the invention, and the scope of the invention is not limited to such illustrative description.
[0058] Example 1. Production of strains expressing variants of the transcriptional regulatory factor LysG gene
[0059] To produce strains expressing the transcriptional regulator LysG gene variant, Corynebacterium glutamicum CT19b3 (accession number KCCM13451P), a strain that produces L-citrulline, and Corynebacterium glutamicum 14GR (accession number KCCM13219P), a strain that produces L-arginine, were used.
[0060] 1-1. C78A variant
[0061] A variant strain (SEQ ID NO:3) was created, comprising a variation in the base sequence of the gene encoding the transcriptional regulatory factor LysG (SEQ ID NO:1) in which base 78 is replaced by adenine (a) instead of cytosine (c).
[0062] Genomic DNA from *Corynebacterium glutamicum* ATCC13032 was used as a template for PCR amplification using primers 1 and 3, primers 2 and 4, primers 5 and 7, and primers 6 and 8, respectively. Then, plasmids from the pCGI vector [Kim et al., *Journal of Microbiological Methods* 84 (2011) 128-130] were used as templates for PCR amplification using primers 9 and 15, and primers 14 and 16. The PCR products were then purified, mixed, and cloned using self-assembly cloning (BioTechniques 51:55-56 (July 2011)). The cloned product was then transformed into *E. coli* DH5α (HIT Competent cells). TM The sample was prepared in a medium containing 50 μg / ml kanamycin (Cat No. RH618). It was then spread onto LB agar plates containing 50 μg / ml kanamycin and incubated at 37°C for 24 hours to obtain the recombinant vector containing the C78A mutation. The resulting colonies were isolated to confirm the correct presence of the insert within the vector.
[0063] PCR was performed using a thermal cycler (TP600, TAKARABIO Inc.) in a reaction solution supplemented with 100 μM of each deoxyribonucleoside triphosphate (dATP, dCTP, dGTP, dTTP). 1 pM of oligonucleotides and 10 ng of Corynebacterium glutamicum ATCC13032 chromosomal DNA or pCGI vector were used as templates. The PCR was performed for 25–30 cycles in the presence of 1 unit of Takara PrimeSTAR Max DNA polymerase. The PCR conditions were: (i) denaturation at 94 °C for 10 seconds, (ii) annealing at 60 °C for 10 seconds, and (iii) extension at 72 °C for 30 seconds.
[0064] Base sequence analysis was performed on the transformed colonies to screen for colonies containing inserted DNA. Corynebacterium glutamicum CT19b3 and Corynebacterium glutamicum 14GR, prepared as competent cells, were subjected to electroporation to induce homologous recombination and introduce mutations. The resulting mutant strains were named DC-1 and DA-1, respectively.
[0065] 1-2. G138A variant
[0066] A variant strain (SEQ ID NO:4) was created, comprising a variation in the base sequence of the gene encoding the transcriptional regulatory factor LysG (SEQ ID NO:1) in which base 138 is replaced by adenine (a) instead of guanine (g).
[0067] Genomic DNA from *Corynebacterium glutamicum* ATCC13032 was used as a template for PCR amplification using primers 1 and 10, primers 2 and 11, primers 12 and 7, and primers 13 and 8, respectively. Then, plasmids from the pCGI vector [Kim et al., Journal of Microbiological Methods 84 (2011) 128-130] were used as templates for PCR amplification using primers 9 and 15, and primers 14 and 16. The PCR products were then purified, mixed, and cloned using self-assembly cloning (BioTechniques 51:55-56 (July 2011)), and transformed into *E. coli* DH5a (HIT Competent cells). TM The sample was prepared in a medium containing 50 μg / ml kanamycin (Cat No. RH618). It was then spread onto LB agar plates containing 50 μg / ml kanamycin and incubated at 37°C for 24 hours to obtain the recombinant vector containing the G138A mutation. The resulting colonies were isolated to confirm the correct presence of the insert within the vector.
[0068] PCR was performed using a thermal cycler (TP600, TAKARA BIO Inc.) in a reaction solution supplemented with 100 μM of each deoxyribonucleoside triphosphate (dATP, dCTP, dGTP, dTTP). 1 pM of oligonucleotides and 10 ng of Corynebacterium glutamicum ATCC13032 chromosomal DNA or pCGI vector were used as templates. The PCR was performed for 25–30 cycles in the presence of 1 unit of Takara PrimeSTAR Max DNA polymerase. The PCR conditions were as follows: (i) denaturation at 94 °C for 10 seconds, (ii) annealing at 60 °C for 10 seconds, and (iii) extension at 72 °C for 30 seconds.
[0069] Then, following the same method as in Example 1-1, the mutant strains produced here were named DC-3 and DA-3, respectively.
[0070] 1-3. C78A and G138A variants
[0071] A variant strain was created, comprising a variation in the base sequence of the gene encoding the transcriptional regulator LysG (SEQ ID NO:1) in which base 78 is replaced by adenine (a) and base 138 is replaced by adenine (a) (SEQ ID NO:5).
[0072] Genomic DNA from *Corynebacterium glutamicum* ATCC13032 was used as a template for PCR amplification using primers 1 and 3, primers 2 and 4, primers 5 and 10, primers 6 and 11, primers 12 and 7, and primers 13 and 8, respectively. Then, plasmids from the pCGI vector [Kim et al., *Journal of Microbiological Methods* 84 (2011) 128-130] were used as templates for PCR amplification using primers 9 and 15, and primers 14 and 16. The PCR products were then purified, mixed, and cloned using self-assembly cloning (BioTechniques 51:55-56 (July 2011)). The cloned product was then transformed into *E. coli* DH5a (HIT Competentcells). TMThe culture was prepared in the culture medium (Cat No. RH618). Then, it was spread onto LB agar plates containing 50 μg / ml kanamycin and incubated at 37°C for 24 hours to obtain the recombinant vector containing C78A and G138A variants. The resulting colonies were isolated to confirm the correct presence of the insert within the vector.
[0073] PCR was performed using a thermal cycler (TP600, TAKARA BIO Inc.) in a reaction solution supplemented with 100 μM of each deoxyribonucleoside triphosphate (dATP, dCTP, dGTP, dTTP). 1 pM of oligonucleotides and 10 ng of Corynebacterium glutamicum ATCC13032 chromosomal DNA or pCGI vector were used as templates. The PCR was performed for 25–30 cycles in the presence of 1 unit of Takara PrimeSTAR Max DNA polymerase. The PCR conditions were as follows: (i) denaturation at 94 °C for 10 seconds, (ii) annealing at 60 °C for 10 seconds, and (iii) extension at 72 °C for 30 seconds.
[0074] Then, following the same method as in Example 1-1, the mutant strains produced here were named DC-2 and DA-2, respectively.
[0075] The primers used in Example 1 are shown in Table 1 below.
[0076] Table 1
[0077] Primer name Primer sequence (5'-3') SEQ ID NO Primer 1 tgattacgcc TCGGGTTCAACCAGGTCA 6 Primer 2 TCGGGTTCAACCAGGTCA 7 Primer 3 AAATTGAAAGGGCTAAGGAGGC 8 Primer 4 GCCGAGGGGGAAATTGAAA 9 Primer 5 CCCCCTCGGCGGTGAGTCAGCGCGTTAA 10 Primer 6 GGTGAGTCAGCGCGTTAA 11 Primer 7 ATCGAGGAGGATCACTTCTCC 12 Primer 8 TGGGTATCTCATCGAGGAGG 13 Primer 9 GAGATACCCA actggccgtcgttttacaac 14 Primer 10 CTCGAGAGCTTTAACGCGC 15 Primer 11 CCACGTGATGCTCGAGA 16 Primer 12 CATCACGTGGGTCGAGTATTGGTATCGCGC 17 Primer 13 GTCGAGTATTGGTATCGCGC 18 Primer 14 actggccgtcgttttacaac 19 Primer 15 tggtcatagctgtttcctgtgt 20 Primer 16 ggcgtaatcatggtcatagctg 21
[0078] Example 1. Evaluation of L-citrulline production capacity
[0079] The L-citrulline production capacity of the variant strain expressing the LysG gene variant prepared in Example 1 was evaluated by comparing it with Corynebacterium glutamicum CT19b3, which served as the parent strain.
[0080] In 100 mL flasks containing 10 mL of the L-citrulline production medium (Table 2 below), 1% of each strain (parental strain or mutant) was inoculated by volume and cultured at 32°C and 200 rpm for 30 hours. After culture, the concentration of L-citrulline in the medium was determined by HPLC (Agilent), and the results are shown in Table 3 below. The yield (Yp / s) (%) in Table 3 shows the amount of L-citrulline produced relative to the consumed sugar, and C-recovery (C-recovery) (%) represents the carbon recovery rate per unit time.
[0081] Table 2
[0082]
[0083] Table 3
[0084] strains OD610 L-citrulline (%) Total carbohydrates (%) Yield (Yp / S) (%) C-Recovery (%) Parental strain 18.6 1.34 3.75 35.9 52.0 DC-1 22.9 1.52 3.77 40.3 60.0 DC-2 23.4 1.67 3.85 43.2 63.0 DC-3 23.8 1.15 3.81 30.3 50.5
[0085] As shown in Table 3 above, when the gene encoding the transcriptional regulator LysG included a substitution at base 78 (DC-1), or a substitution involving both bases 78 and 138 (DC-2), it was confirmed that L-citrulline production was increased by 13.4% and 24.6%, respectively, compared to the parental strain without base variations. Cell mass, fermentation yield, and C-recovery were also improved. On the other hand, when base 138 of the gene encoding the transcriptional regulator LysG was substituted alone (DC-3), no increase in L-citrulline production was observed.
[0086] Therefore, it can be concluded that the C78A variant, or the C78A and G138A variants, in the LysG gene, are effective variants that help improve L-citrulline production capacity.
[0087] Example 2. Evaluation of L-arginine production capacity
[0088] The L-arginine production capacity of a variant strain expressing the LysG gene variant prepared in Example 1 was evaluated by comparison with Corynebacterium glutamicum 14GR, which served as the parent strain.
[0089] In 100 mL flasks containing 10 mL of the L-arginine production medium (Table 4 below), 1% of each strain (parental strain or mutant) was inoculated by volume and cultured at 32°C and 200 rpm for 30 hours. After culture, the concentration of L-arginine in the medium was determined by HPLC (Agilent), and the results are shown in Table 5 below. The yield (Yp / s) (%) in Table 5 shows the amount of L-arginine produced relative to the consumed sugar, and C-recovery (C-recovery) (%) represents the carbon recovery rate per unit time.
[0090] Table 4
[0091]
[0092] Table 5
[0093] strains OD610 L-arginine (%) Total carbohydrates (%) Yield (Yp / S) (%) C-Recovery (%) Parental strain 34.1 2.29 6.57 34.86 51.72 DA-1 37.5 2.47 6.62 37.31 55.72 DA-2 38.6 2.60 6.67 38.98 57.79 DA-3 38.2 2.21 6.59 33.54 52.37
[0094] As shown in Table 5 above, when the gene encoding the transcriptional regulator LysG included a substitution at base 78 (DA-1), or a substitution involving both bases 78 and 138 (DA-2), it was confirmed that L-arginine production was increased by 7.8% and 13.5%, respectively, compared to the parental strain without base variations. Increased cell mass, fermentation yield, and C-recovery were also observed. Conversely, when base 138 of the gene encoding LysG was substituted alone (DC-3), no increase in L-arginine production was observed.
[0095] Therefore, it can be concluded that the C78A variant, or the C78A and G138A variants, in the LysG gene, a transcriptional regulatory factor, are effective variants that help improve L-arginine production capacity.
[0096] So far, the invention has been studied around its preferred embodiments. Those skilled in the art will understand that the invention can be implemented in modified forms without departing from its essential characteristics. Therefore, the disclosed embodiments should be considered illustratively rather than restrictively. The scope of the invention is shown in the claims rather than in the foregoing description and should be interpreted as including all differences within its equivalent scope.
[0097] [Collection Information]
[0098] Name of depository: Korean Center for Microbial Collection (KCCM)
[0099] Accession number: KCCM13451P
[0100] Date of preservation: January 4, 2024
[0101] Classification and nomenclature of biological material: Corynebacterium glutamicum
[0102] Name of depository: Korean Center for Microbial Collection (KCCM)
[0103] Accession number: KCCM13219P
[0104] Date of preservation: June 29, 2022
[0105] Classification and nomenclature of biological material: Corynebacterium glutamicum.
Claims
1. A variant of the transcriptional regulator LysG gene, comprising the base sequence of SEQ ID NO:3 in which base number 78 of SEQ ID NO:1 is replaced by A instead of C; or The base sequence of SEQ ID NO:5, which includes the base sequence of SEQ ID NO:1, in which base 78 is replaced by A and base 138 is replaced by A.
2. A recombinant vector comprising the gene variant of claim 1.
3. A transformant, which is transformed using the recombinant vector of claim 2.
4. The transformant according to claim 3, wherein, The transformant was a strain of the genus Corynebacterium.
5. The transformant according to claim 3, wherein, The transformant has the ability to produce L-citrulline or L-arginine.
6. A method for producing L-citrulline or L-arginine, comprising the following steps: The step of culturing the transformant of claim 3 in a culture medium; as well as The step of recovering L-citrulline or L-arginine from the transformant or the culture medium for culturing the transformant.
Citation Information
Patent Citations
Method for producing L-amino acid
KR101053429B1
A microorganism of corynebacterium genus having L-arginine productivity and method for producing L-arginine using the same
KR101999454B1