Bordetella pertussis mRNA (messenger Ribonucleic Acid) vaccine and application thereof
By designing a Bordetella pertussis mRNA vaccine containing nucleic acid sequences encoding pertussis toxin, hemagglutinin, and adhesin, and modifying its untranslated regions and nucleotides, and delivering it using liposome nanoparticles, the safety and efficacy issues of existing vaccines have been addressed, achieving highly efficient immune protection and reducing production costs.
Patent Information
- Application Number
- CN202511561347.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-29
- Publication Date
- 2026-03-03
AI Technical Summary
Existing pertussis vaccines have problems such as high safety risks, insufficient efficacy, and high production and quality control costs. In particular, acellular vaccines have low protective efficacy and are difficult to effectively control the spread of pertussis.
A Bordetella pertussis mRNA vaccine was developed, comprising a nucleic acid sequence encoding the first 180 amino acids of the pertussis toxin S1 subunit (PTS1c180), a filamentous hemagglutinin polypeptide (FHA1073-2440AA), and pertussis adhesiveness (PRN), with untranslated region and nucleotide modifications, and liposome nanoparticles as a delivery carrier to elicit a TH1 immune response.
It achieves highly efficient immune protection, stimulates a good TH1/TH17 immune response, significantly improves the protective efficacy of the vaccine, effectively clears respiratory colonies, and reduces production costs and safety risks.
Smart Images

Figure CN121592674A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedicine and vaccine technology, specifically relating to a Bordetella pertussis mRNA vaccine and its application. Background Technology
[0002] The information disclosed in the background section of this invention is intended only to enhance the understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.
[0003] Bordetella pertussis (whooping cough) Bordetella pertussis Bordetella pertussis (BP), also known as pertussis bacillus, belongs to the order Burkholderia, family Alcaligenes, and genus Bordetella. It is an obligate aerobe, Gram-negative, short rod-shaped bacterium with darker staining at both ends, and lacks flagella. Bordetella pertussis expresses various virulence factors, producing large amounts of toxins and bioactive products. The most important virulence factor is pertussis toxin (PT), which has mitogenic activity, affects lymphocyte circulation, and acts as an adhesin for bacterial binding to respiratory ciliated cells. Patients and carriers of pertussis are the main sources of infection, and the population is generally susceptible. Reports indicate that pertussis can induce serious complications such as cerebral hemorrhage, edema, leading to seizures, confusion, brain damage, and intellectual disability. Most deaths in children with pertussis are due to secondary pneumonia and bronchitis, which are fundamentally caused by post-infection disruption of the body's immune microenvironment, leading to secondary infections by other microorganisms.
[0004] Currently, the clinical treatment of pertussis infection mainly relies on macrolide antibiotics, such as azithromycin, erythromycin, roxithromycin, or clarithromycin. However, macrolide-resistant strains have emerged. Although symptomatic treatment with drugs such as sulfamethoxazole can be used for these resistant strains, the use of these drugs in children carries a significant risk of hepatotoxicity and nephrotoxicity. Therefore, proactive prevention of pertussis infection through vaccination remains one of the most effective strategies.
[0005] The development of pertussis vaccines has undergone significant changes. In 1914, the United States approved the whole-cell pertussis vaccine (wPV), and in 1948, the diphtheria-tetanus-whole-cell pertussis combined vaccine (DTwP) was introduced. Although DTwP effectively reduced the incidence of pertussis, serious adverse reactions in children led to a decline in vaccination rates. In 1981, Japan developed the acellular pertussis vaccine (DTaP), which significantly improved safety, but its protective efficacy, particularly its ability to block transmission in the population, was lower than that of DTwP. Studies have shown that DTwP induces a Th1 / Th17 immune response, while DTaP primarily induces a Th2 / Th17 response; the Th2 response has limitations in clearing respiratory bacterial colonization, resulting in ineffective control of transmission risk, which explains the insufficient efficacy of DTaP.
[0006] In response to the resurgence of pertussis, there is an urgent need to develop novel vaccines that combine good safety and high protective efficacy (especially the ability to induce Th1-biased immunity). The current leading candidate vaccine is the live attenuated pertussis vaccine BPZE1. Studies have shown that a single nasal administration of BPZE1 effectively protects animal models, induces potent local and systemic immune responses including IL-17-mediated tissue-resident memory T cells (TRM), and has demonstrated safety and immunogenicity in humans. However, as a live attenuated vaccine, its development and production quality control costs are relatively high. Summary of the Invention
[0007] To address the shortcomings of existing technologies, the present invention aims to provide a Bordetella pertussis mRNA vaccine and its application. Specifically, the present invention successfully prepared an mRNA vaccine against Bordetella pertussis, which can provide immune protection against current Bordetella pertussis control measures and provides technical support for Bordetella pertussis control. Based on the above research results, the present invention is thus completed.
[0008] To achieve the above-mentioned technical objectives, the present invention provides the following technical solution: A first aspect of the present invention provides an mRNA molecule comprising: a polypeptide encoding the first 180 amino acids of the pertussis toxin S1 subunit with amino acid mutations at positions 19 and 129 (PT). S1c180 ), filamentous hemagglutinin polypeptide (FHA) of amino acids 1073-2440 1073-2440AA Nucleic acid sequences of pertussis adhesivein (PRN); Furthermore, the mRNA molecule includes any one of (a1)-(a3): (a1) An mRNA molecule having one or more of the nucleotide sequences shown in SEQ ID NO. 1-3; (a2) A nucleotide sequence defined in (a1) that has been substituted, deleted, or added with one or more nucleotides, encoding PT. S1c180 FHA 1073-2440 and / or PRN-functional mRNA molecules derived from (a1) that have the same percentage of GC base pairs as the original nucleic acid sequence; (a3) An mRNA molecule that hybridizes under strict conditions to the mRNA molecule defined by (a1) or (a2) and has the function of encoding PTS1c180, FHA and / or PRN.
[0009] In a second aspect, the present invention provides a pharmaceutical composition comprising the above-described mRNA molecule.
[0010] A third aspect of the present invention provides a DNA molecule that can be transcribed to yield the above-mentioned mRNA molecule.
[0011] In a fourth aspect, the present invention provides an expression vector, expression cassette, or host cell containing the above-described mRNA or DNA molecules.
[0012] A fifth aspect of the present invention provides a method for preparing the above-mentioned mRNA molecule, comprising transcribing the above-mentioned DNA molecule.
[0013] A sixth aspect of the present invention provides the use of the above-described mRNA molecule, DNA molecule, expression vector, expression cassette or host cell, pharmaceutical composition, and mRNA vaccine in the preparation of a drug having any one or more of the following effects; (b1) Prevention or treatment of diseases mediated by Bordetella pertussis; (b2) Prevention, treatment or detection of Bordetella pertussis.
[0014] A seventh aspect of the present invention provides a method for preventing and / or treating diseases mediated by Bordetella pertussis, the method comprising administering to a subject the aforementioned mRNA molecule, DNA molecule, expression vector, expression cassette or host cell, pharmaceutical composition or mRNA vaccine.
[0015] The beneficial technical effects of one or more of the above technical solutions are as follows: Compared to other vaccine production methods, the pertussis mRNA vaccine formulation provided by the above technical solution allows for in vitro transcription of mRNA, which does not rely on cell amplification. This makes it easy to monitor and control all production processes, and saves time and economic costs by eliminating processes such as cell culture, antigen extraction and purification.
[0016] The pertussis mRNA vaccine formulation provided by the above technical solution involves untranslated region modifications and nucleotide modifications to achieve the best immunization effect of the mRNA vaccine. These modifications include 5' capping modification by co-transcription, introduction of 5' and 3' untranslated region sequences, introduction of 3' polyadenylate sequences, and nucleotide modifications such as pseudouridine replacing uridine. These modifications can further improve mRNA stability, increase protein translation efficiency, and enhance vaccine immunization effect.
[0017] The above technical solution is based on the immune response advantage of mRNA vaccines. It uses mRNA to encode three modified pertussis antigens, which can stimulate the body to produce a good TH1 immune response, thereby achieving the colonization and clearance of pertussis bacteria in the respiratory tract, and ultimately greatly improving the protective efficacy of the vaccine. It has good practical application value. Attached Figure Description
[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.
[0019] Figure 1 The mRNA sequence design of three antigens of Bordetella pertussis in Example 1 of this invention (A) and the in vitro synthesis and preparation of mRNA and the results of agarose gel electrophoresis in Example 2 (B).
[0020] Figure 2 This is a graph showing the LNP-mRNA particle size characterization results of Example 3 of the present invention.
[0021] Figure 3 The diagram shows the results of the in vivo immunogenicity evaluation of the pertussis mRNA vaccine in Example 4 of this invention; where A is the mouse immunization process plan; B is the result of the antigen-specific IgG titer in mice after vaccine immunization; and C is the result of the number of spleen cells secreting IFN-γ produced by mice after vaccine immunization.
[0022] Figure 4 The results of the in vivo evaluation of the protective effect of the pertussis mRNA vaccine against Bordetella pertussis in Example 5 of this invention are as follows: A is the mouse experimental procedure plan; B is the bacterial load statistics of mouse lung tissue in the infection protection experiment; and C is the bacterial culture results of mouse lung tissue in the infection protection experiment. Detailed Implementation
[0023] It should be noted that the following detailed description is illustrative and intended to provide further explanation of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0024] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments of the present invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof. The present invention utilizes techniques and methods conventional in the fields of genetic engineering and molecular biology. Those skilled in the art can employ other conventional techniques, methods, and reagents in the art based on the embodiments provided in this invention, without being limited to the specific embodiments of the present invention.
[0025] As mentioned earlier, vaccines currently designed for pertussis generally have problems such as high safety risks, insufficient efficacy, and high development and production quality control costs.
[0026] As a cutting-edge vaccine development platform, mRNA vaccines tend to induce a TH-1 biased immune response through interferon signaling. This may be because the delivery of mRNA molecules into cells activates TLR7 / 8 pattern recognition receptors to a certain extent, producing a large amount of type I interferon, thereby promoting the formation of a Th1 immune bias. Since mRNA molecules themselves can elicit a high level of cellular immune response, from an immunological perspective, the mRNA technology platform has an immunological advantage in pertussis vaccine development. At the same time, the mRNA vaccine platform also offers advantages such as simultaneous quality control of multiple antigens, shorter development cycles, and no need for additional adjuvants.
[0027] In view of this, the present invention provides an mRNA molecule, said mRNA molecule comprising encoding pertussis toxin (PTS1c180) and FHA. 1073-2440AA The nucleic acid sequence of pertussis adhesivein (PRN); In another specific embodiment of the present invention, the mRNA molecule includes any one of (a1)-(a3): (a1) An mRNA molecule having one or more of the nucleotide sequences shown in SEQ ID NO. 1-3; (a2) A nucleotide sequence defined in (a1) that has been substituted, deleted, or added with one or more nucleotides, encoding PT. S1c180 FHA 1073-2440AA and / or PRN-functional mRNA molecules derived from (a1) that have the same percentage of GC base pairs as the original nucleic acid sequence; (a3) hybridizes with mRNA molecules defined by (a1) or (a2) under strict conditions and has the encoding PT S1c180 FHA 1073-2440AA and / or mRNA molecules with PRN function.
[0028] In another specific embodiment of the present invention, in order to achieve the best immunization effect of the mRNA vaccine, the mRNA molecule includes one or more modifications, including untranslated region modifications and nucleotide modifications.
[0029] In another specific embodiment of the present invention, the untranslated region modification includes at least one of the following: 5' cap structure modification, introduction of 5' and 3' end untranslated region sequences (5'UTR; 3'UTR), and introduction of 3' end polyadenylate (PolyA tail); In another specific embodiment of the present invention, the nucleotide modification includes at least one of the following: pseudouridine, 5-methoxyuridine, 5-methylcytidine, 2-thiouridine, N6-methyladenosine (m6A), N1-methyladenosine (m1A), 2'-O-methylation, N6-methyladenosine (m6A), 5-methylcytosine (m5C), 5-hydroxymethylcytosine (5hmC), N4-methylcytidine (m4C), 7-methylguanosine (m7G), N2-methylguanosine (m2G), N1-methylpseudouridine, m2,7G, m2,2,7G, and Nm.
[0030] In another specific embodiment of the present invention, the pseudouridine is selected from at least one of the following: 4-thiopseudouridine, 2-thiopseudouridine, 1-carboxymethylpseudouridine, 1-propynylpseudouridine, 1-tauronic acid methylpseudouridine, N1-methylpseudouridine, 4-thio-1-methylpseudouridine, 2-thio-1-methylpseudouridine, 1-methyl-1-deazopseudouridine, 2-thio-1-methyl-1-deazopseudouridine, dihydropseudouridine, 2-thio-dihydropseudouridine, 4-methoxypseudouridine, and 4-methoxy-2-thiopseudouridine, wherein N1-methylpseudouridine is preferred.
[0031] In another specific embodiment of the present invention, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of the nucleotides in the mRNA sequence are modified. In yet another specific embodiment of the present invention, the mRNA sequence includes the same or different nucleotide modifications.
[0032] In another specific embodiment of the present invention, a pharmaceutical composition is provided, the pharmaceutical composition comprising the above-mentioned mRNA molecule.
[0033] In another specific embodiment of the present invention, the pharmaceutical composition further includes a delivery carrier, which includes, but is not limited to, liposome nanoparticles (LNP), liposomes, polymers, micelles, plasmids, viruses, or combinations thereof; wherein, preferably, liposome nanoparticles.
[0034] In another specific embodiment of the present invention, the liposome nanoparticles include cationic lipids, auxiliary phospholipids, sterol lipids, and PEG-modified lipids.
[0035] In another specific embodiment of the present invention, the cationic lipid is an ionizable cationic lipid, including but not limited to: dioleoyl-3-trimethylammonium propane, DLin-MC3-DMA, SM-102, ALC-0315 and DLin-KC2-DMA; wherein, SM-102 is preferred.
[0036] In another specific embodiment of the present invention, the auxiliary phospholipid is preferably one or more of distearylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylserine (DOPS) and dioleoylphosphatidylethanolamine (DOPE), with DSPC being the most preferred.
[0037] In another specific embodiment of the present invention, the sterol lipids are selected from one or more of cholesterol, cholesterol esters, sterol hormones, sterol vitamins and phytosterols, more preferably from one or more of cholesterol, cholesterol esters and phytosterols, and most preferably cholesterol.
[0038] In another specific embodiment of the present invention, the polyethylene glycol (PEG) modified lipid is preferably one or more selected from DAG-PEG, DAA-PEG, DMG-PEG, Cer-PEG, and DSPE-PEG, more preferably DMG-PEG. Preferably, the relative molecular mass of the PEG is 2000-5000, for example, 2000, 3000, 4000, or 5000; most preferably, the polyethylene glycol (PEG) modified lipid is DMG-PEG2000.
[0039] In another specific embodiment of the present invention, the liposome nanoparticles are prepared by selecting a combination of SM-102, DSPC, cholesterol and DMG-PEG2000.
[0040] In another specific embodiment of the present invention, the molar ratio of SM-102, DSPC, cholesterol and DMG-PEG2000 in the liposome nanoparticles is 30-70:1-20:20-50:0.1-5, preferably 50:10:38.5:1.5.
[0041] In another specific embodiment of the present invention, an mRNA vaccine is provided, the mRNA vaccine comprising the above-mentioned mRNA molecule and liposome nanoparticles encapsulating the mRNA.
[0042] The lipid nanoparticles were prepared by combining SM-102, DSPC, cholesterol and DMG-PEG2000.
[0043] In another specific embodiment of the present invention, the molar ratio of SM-102, DSPC, cholesterol, and DMG-PEG2000 in the liposome nanoparticles is 30-70:1-20:20-50:0.1-5, preferably 50:10:38.5:1.5. These liposome nanoparticles exhibit excellent antigen presentation performance.
[0044] In another specific embodiment of the present invention, the mRNA vaccine may be administered via intravenous, intramuscular, subcutaneous, or local routes.
[0045] In another specific embodiment of the present invention, a DNA molecule that can be transcribed to obtain the above-mentioned mRNA molecule is provided.
[0046] In another specific embodiment of the present invention, an expression vector, expression cassette, or host cell containing the above-mentioned mRNA or DNA molecules is provided.
[0047] In another specific embodiment of the present invention, a method for preparing the above-mentioned mRNA molecule is provided, which includes transcribing the above-mentioned DNA molecule.
[0048] In another specific embodiment of the present invention, the use of the above-mentioned mRNA molecule, DNA molecule, expression vector, expression cassette or host cell, pharmaceutical composition, and mRNA vaccine in the preparation of a drug having any one or more of the following effects is provided; (b1) Prevention or treatment of diseases mediated by Bordetella pertussis; (b2) Prevention, treatment or detection of Bordetella pertussis.
[0049] In the application (b1), the disease mediated by Bordetella pertussis includes pertussis.
[0050] Specifically, this invention demonstrates through experiments that the mRNA vaccine, especially the three-component vaccine (PT), is effective. S1c180 FHA 1073-2440AA (and PRN) can stimulate the body to produce a good TH1 / TH17 immune response, thereby achieving the colonization and clearance of pertussis bacteria in the respiratory tract, and ultimately greatly improving the protective efficacy of the vaccine.
[0051] In another specific embodiment of the present invention, a method for preventing and / or treating diseases mediated by Bordetella pertussis is provided, the method comprising administering to a subject the aforementioned mRNA molecule, DNA molecule, expression vector, expression cassette or host cell, pharmaceutical composition or mRNA vaccine.
[0052] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available. Unless otherwise specified, the experimental methods described are conventional methods in the art.
[0053] Example 1: Design of pertussis mRNA vaccine sequence mRNA candidate sequence design: Bordetella pertussis can produce various virulence factors, including pertussis toxin (PT), filamentous hemagglutinin (FHA) and pertussis adhesin (PRN), fim2 and fim3 agglutinogens, tracheal cytotoxin (TCT), and adenylate cyclase toxin (ACT). Among these, PT, FHA, and PRN are the main effective antigenic components of pertussis vaccines. This invention selects PT, FHA, and PRN as target antigens. For the PT antigen, amino acids 1-180 of its S1 subunit are selected, and point mutations are made at amino acids 9 and 129, namely R9K and E129G. Furthermore, for the FHA antigen, amino acid fragments 1073-2440 are selected to cover the epitopes of T and B cell responses. No modifications are made to the PRN antigen. Finally, we replaced the original signal peptide with a validated signal peptide: (ATGGAAACCCCAGCGCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGATACCACCGGA) or added a front end without a signal peptide antigen sequence.
[0054] In addition, the vaccine design used the mRNA vaccine backbone from BioNTech, in which... 5'UTR (AGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACC) 3'UTR (CTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAA GCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACC).
[0055] PolyA tail (AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA) Because bacterial proteins are expressed at low levels in mammals, codon optimization is employed to increase their expression. The optimization scheme is primarily based on two parameters: the Codon Adaptation Index (CAI) and the Minimum Free Energy (MFE). The CAI parameter is related to codon bias. While any amino acid in an organism corresponds to multiple different codons, one codon often dominates in translation. When using CAI as a parameter for sequence optimization, the preferred codon is used as much as possible, thereby increasing the translation rate and accelerating protein synthesis. The MFE parameter is related to the stability of mRNA secondary structure; the lower the MFE, the more stable the secondary structure of the mRNA molecule and the longer its half-life. Optimizing codons based on MFE will improve the in vivo stability of the mRNA molecule, ensuring relatively long-term sustained expression of the antigen. Three sequences were obtained after optimization for the mRNA sequences of PT, FHA, and PRN antigens.
[0056] Example 2: mRNA preparation 2.1 Full gene synthesis of template plasmid: The template plasmid was obtained by tandemly combining the open reading frame (ORF) sequence, T7 promoter sequence, 5'UTR sequence, 3'UTR sequence and polyA sequence of the antigen, and then using Puc57 as a vector for full gene synthesis.
[0057] 2.2 Obtaining the transcribed template DNA sequence by PCR: Using a linearized template plasmid as a template, along with polyT long primers, high-fidelity DNA polymerase, and dNTPs, and setting an appropriate program on the PCR machine, the transcribed template DNA was successfully obtained.
[0058] 2.3 In vitro transcription reaction for mRNA preparation (using a 40 μL reaction system as an example): The prepared IVT template was mixed with T7 RNA polymerase, mononucleotides, and other raw materials according to the specified ratio. The co-transcription capping method was used, and the transcription reaction was carried out at 37°C for 2 hours. After the transcription reaction, the IVT template was digested using DNase I (purchased from Novizan) to reduce the risk of residual DNA template.
[0059] 2.4 Purification: The mRNA from the IVT reaction was purified using an RNA purification kit (NEB). The purified mRNA was dissolved in TE buffer and ready for subsequent formulation coating. Electrophoresis results ( Figure 1 B) shows that the mRNA purity is good, and the final nucleotide sequences of the mRNAs targeting the three antigens PT, FHA, and PRN are shown in SEQ ID NO.1-3.
[0060] Example 3: Preparation and quality control of pertussis mRNA vaccine formulation 3.1 Preparation of lipid solution: SM-102 (molar concentration of 2.112 mmol / L):DSPC:cholesterol:DMG-PEG2000 were dissolved in ethanol solution in a molar ratio of 50:10:38.5:1.5; 3.2 mRNA solution preparation: The three pertussis antigen mRNAs were diluted to 1 μg / μL using TE buffer, and then the three mRNAs were separately extracted and dispersed in 10 mM citrate buffer solution at pH=4.0 to prepare a solution with a concentration of 50 μg / mL. 3.3 Preparation of lipid nanoparticles: The prepared mRNA solution and lipid solution were extracted at a ratio of 3:1, inserted into the nanomedicine preparation chip, and the flow rate ratio parameter of the nanomedicine preparation system was adjusted to 3:1 with a total flow rate of 16 mL / min. After automatic injection by the nanomedicine preparation system, the lipid nanoparticle solution was obtained. 3.4 Ultrafiltration Equilibrium: The lipid nanoparticle solution was added to an ultrafiltration tube and centrifuged for ultrafiltration. The solution was replaced multiple times with phosphate buffer to obtain the final product.
[0061] 3.5 Prepare 2% Triton reagent and lyse the formulation at 37°C for 10 min. Detect the concentration of mRNA-LNP using the Qubit™ RNA High Sensitivity (HS) kit according to the manufacturer's instructions. 3.6 The encapsulation efficiency of mRNA-LNP was detected using the Qubit™ RNA High Sensitivity (HS) Kit.
[0062] 3.7 The particle size and PDI (Particle Size Index) of the vaccine formulation were analyzed and tested using a particle size analyzer.
[0063] 3.8 Three antigen mRNA-LNP preparations were prepared according to the mouse administration dose of 15 μg / mouse. 5 μg of each mRNA-LNP was extracted and mixed to prepare the final mRNA-LNP immunization preparation.
[0064] The particle size characterization results of the pertussis mRNA vaccine are as follows: Figure 2 As shown in Table 1. Figure 2 As shown, the particle size of the three vaccines is mainly concentrated in the range of 90-110 nm, and the distribution is relatively concentrated, indicating that the prepared LNP-mRNA vaccine has good particle size uniformity and meets the basic requirements of vaccine formulation for particle size.
[0065] Table 1 records the particle size (nm) and PDI values of three vaccines—LNP-PRN, LNP-FHA1073-2440AA, and LNP-PTs1c180—in three repeated assays (Test 1, Test 2, and Test 3). The data from the three repeated assays showed minimal fluctuation. These data quantitatively validate that the LNP-mRNA vaccine has an appropriate particle size and stable uniformity, further demonstrating the good reproducibility and reliability of the vaccine formulation's preparation process.
[0066] Table 1. Particle size and PDI (polydispersity index) results of LNP-mRNA vaccines.
[0067] Example 4: Evaluation of in vivo immunogenicity of pertussis vaccine 1. Immunization of laboratory animals Ten female C57BL / 6 mice (primarily immunized at 6 weeks gestation, purchased from Vital River Laboratory Animal Technology Co., Ltd.) were vaccinated via intramuscular injection in the thigh of each mouse at a dose of 15 μg. Prior to immunization, 15 μg of mRNA-LNP was dispersed in 100 μL of sterile PBS to normalize the injection volume between groups. Therefore, the final immunization dose was 15 μg, with an injection volume of 100 μL, administered bilaterally via intramuscular injection, 50 μL per side. Blood samples of 150 μL were collected from the orbital vein on days 7 and 21 after animal immunization. The blood was allowed to stand at 4°C for 30 min, and the serum was separated at 3000 rpm for 10 min. The obtained serum was then frozen and stored at -80°C for later use.
[0068] On day 28 post-immunization, mice were euthanized, and their spleens were harvested. After grinding through a 70µm filter, the filter was rinsed with culture medium, and the spleen cell suspension was collected. After centrifugation at 1500 rpm for 5 min, the supernatant was discarded, and the cells were resuspended and washed once with PBS. Then, erythrocytes were lysed with erythrocyte lysis buffer (Solepro) at room temperature for 5 min. The erythrocytes in the obtained spleen cell suspension were treated, and after stopping lysis with PBS, the cells were centrifuged again at 1500 rpm for 5 min, the supernatant was discarded, and the cells were resuspended again with PBS. Finally, single-cell suspensions of spleen cells from each group of mice were obtained for subsequent T-cell immune response level detection. The mouse vaccine immunization and experimental flowchart is shown below. Figure 3 As shown in Figure A.
[0069] 2. Detection of serum antibody titers after mouse immunization The pertussis PT, FHA, and PRN antigens were obtained from the National Institutes for Food and Drug Control (NIFDC). After being dissolved in sterile PBS, the concentration was adjusted to 0.5 μg / mL, aliquoted, and stored at -80°C. Simultaneously, 100 μL of antigen dilution buffer (1 μg / mL) was added to each well of a 96-well high-binding ELISA plate for antigen coating. Coating was performed overnight at 4°C. The next day, the solution was discarded, and 200 μL of PBST was added to each well for washing three times. 200 μL of blocking buffer was added to each well, and the plate was incubated at 30°C for 2 hours. After incubation, the solution was discarded, and the plate was cleaned. Serum was diluted three-fold with PBS on the dilution plate, for a total of eight dilutions. 100 μL of the diluted serum was added to the prepared ELISA plate and incubated at 30°C for 2 hours. The liquid in the ELISA plate was discarded, and the plate was washed three times with PBST. Dilute the HRP-conjugated goat anti-mouse secondary antibody 1:5000, then add 100 μL of the secondary antibody to each well of the microplate and incubate at 30°C for 1 h. After incubation, wash the plate 5 times with PBST. Add 100 μL of TMB substrate solution to all wells. Incubate at room temperature in the dark for approximately 10 min. To stop the development: add 100 μL of TMB stop solution to each well. The blue wells will turn yellow after adding the stop solution. Avoid generating air bubbles in the wells, as this may interfere with absorbance readings. Reading: Before measurement, wipe the bottom of the 96-well plate with lens paper dampened with alcohol, then wipe with dry lens paper. Read the absorbance at 450 nm using a microplate reader.
[0070] Experimental results are as follows Figure 3 As shown in Example B, 15 μg of the pertussis mRNA vaccine induced good levels of antigen-specific antibodies in mice.
[0071] 3. Detection of T cell response levels after immunization in mice IFN-γ detection kits (all purchased from MABTECH): Prepare ELISPOT plates (sterile) one day before the experiment. Dilute the coating antibody with PBS to a concentration of 15 μg / ml, calculating the required volume as 100 μL per well. Pre-activate the ELISPOT plates: Remove the PVDF plate and pre-wet it with 35% ethanol (20 μL / well, maximum 1 min). Wash the plate 5 times with sterile water (200 μL / well). Add 100 μL of coating antibody per well and incubate overnight at 4-8°C. ELISpot plates were rinsed 5 times with PBS at 200 μL / well, blocked with 1640 medium containing 10% FBS at 200 μL / well, and placed in a cell culture incubator for at least 30 min. The ELISpot plates were then removed, the medium was discarded, and 100 μL / well of protein (4 μg / ml) was added. For the negative control, 100 μL of medium was added. Finally, 100 μL / well of cell suspension (2 x 10⁻⁶ cells) was added. 5Place the plate in a cell culture incubator for 18-24 hours. Prepare antibody dilution buffer and chromogenic buffer BCIP / NBT-plus. Filter the chromogenic buffer using a 0.45μm filter. Remove the ELISpot plate, discard the liquid, wash 5 times with PBS, 200μL / well, and blot dry. Dilute the primary antibody with antibody dilution buffer at a ratio of 1:1000, add 100μL to each well, and incubate at room temperature for 2 hours. Discard the primary antibody, wash 5 times with PBS, 200μL / well, and blot dry. Secondary antibody incubation: Dilute the secondary antibody (Streptavidin-ALP) with antibody dilution buffer at a ratio of 1:1000, add 100μL to each well, and incubate at room temperature for 1 hour. Discard the secondary antibody, wash 5 times with PBS, 200μL / well, and blot dry. Chromogenic development: Add 100μL of filtered chromogenic buffer BCIP / NBT-plus to each well, protect from light, and observe the chromogenic status in real time. Termination: Rinse the plate under running water, air dry, store at room temperature away from light, and read the plate using an ELISpot reader.
[0072] Experimental results are as follows Figure 3 As shown, the spleen ( Figure 3 In C), the antigen-specific T cells that can be significantly activated after immunization with the pertussis mRNA vaccine in the examples.
[0073] Example 5: Evaluation of protection against Bordetella pertussis infection in vivo using pertussis vaccine 1. Grouping and immunization of laboratory animals Forty-two female C57BL / 6 mice (primarily immunized at 5 weeks gestation, purchased from Vital River Laboratory Animal Technology Co., Ltd.) were used in the experiment. Three groups were established: a PBS group, an mRNA vaccine group, and a DTaP vaccine group. All vaccines were administered via intramuscular injection in the thigh of the mice. The mRNA vaccine dose was 15 μg per mouse, and the DTaP vaccine dose was 0.1 times the human dose. Before immunization, 15 μg of mRNA-LNP and the experimentally designed immunization dose of DTaP vaccine were dispersed in 100 μL of sterile PBS to normalize the injection volume between groups. The final immunization dose was 15 μg and 0.1 times the human dose, with an injection volume of 100 μL, administered bilaterally via intramuscular injection (50 μL per side). Peripheral blood was collected from the mice on day 28 post-immunization. The mouse immunization and experimental flowchart is shown below. Figure 4 As shown in Figure A.
[0074] Bordetella pertussis (ATCC-9797) was derived from the Chinese Center for Disease Control and Prevention and is currently stored in the P2 laboratory at -80℃ in the Translational Medicine Laboratory of China Pharmaceutical University. The charcoal agar selective medium was provided by Zhongchuang Kehui Biotechnology Co., Ltd. The Bordetella pertussis culture was placed on ice, and a single-use sterile inoculation loop was used to spread a loopful onto charcoal agar medium. The plates were then incubated upside down at 37℃ for 72 hours. After bacterial colony formation, the colony was scraped and placed in 1 mL of sterile physiological saline. The OD530 was adjusted to 0.5 using a UV spectrophotometer, at which point the bacterial concentration was 1×10⁻⁶. 11 CFU / mL. All the above procedures were performed in a P2 biosafety laboratory.
[0075] Two infection dose groups were set up, with doses of 5 × 10⁻⁶ and 10⁻ 8 CFU / mL and 5×10 9 CFU / mL. Seven mice were included in each vaccine group within each infection dose group. On day 30 after primiparity, mice were anesthetized with isoflurane, and 50 μL of the prepared bacterial suspension was administered intranasally. Lung tissue from all mice was collected on day 7 post-infection for bacterial load and pathological damage detection. The mouse infection protection experiment procedure is as follows: Figure 4 As shown in A; the left lung sample collected was ground and diluted 100 times and 400 times, then spread and inoculated onto charcoal agar selective medium, and incubated at 37°C upside down for 72 hours before counting the bacterial load in the lung tissue. Experimental results are as follows Figure 4 As shown, the results of bacterial culture and counting in lung tissue ( Figure 4 (B) In the examples, at both infection doses, immunization with the pertussis mRNA vaccine produced a more effective protective effect than the marketed vaccine DTaP.
[0076] Antigen-optimized sequence design: PT S1C180 mRNA Sequence (including coded and non-coded regions) FHA 1073-2440AA mRNA sequence (including coding and non-coding regions) PRN mRNA sequence (including coding and non-coding regions) Matters not covered in this invention are common knowledge.
[0077] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. An mRNA molecule, characterized in that, An mRNA molecule comprising: a polypeptide encoding the first 180 amino acids of the pertussis toxin S1 subunit with amino acid mutations at positions 19 and 129 (PT). S1c180 ), filamentous hemagglutinin polypeptide (FHA) of amino acids 1073-2440 1073-2440AA The nucleic acid sequences of ) and pertussis adhesive (PRN).
2. The mRNA molecule as described in claim 1, characterized in that, The mRNA molecule includes any one of (a1)-(a3): (a1) An mRNA molecule having one or more of the nucleotide sequences shown in SEQ ID NO. 1-3; (a2) A nucleotide sequence defined in (a1) that has been substituted, deleted, or added with one or more nucleotides, encoding PT. S1c180 FHA 1073-2440AA and / or PRN-functionalized mRNA molecules derived from (a1) that have the same percentage of GC base pairs as the original nucleic acid sequence; (a3) An mRNA molecule that hybridizes under strict conditions to the mRNA molecule defined by (a1) or (a2) and has the function of encoding PTS1c180, FHA and / or PRN.
3. The mRNA molecule as described in claim 1, characterized in that, The mRNA molecule includes one or more modifications, including untranslated region modifications and nucleotide modifications; Furthermore, the untranslated region modification includes at least one of the following: 5' cap structure modification, introduction of 5' and 3' end untranslated region sequences, and introduction of 3' end polyadenylate.
4. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises the mRNA molecule according to any one of claims 1-3.
5. The pharmaceutical composition according to claim 4, characterized in that, The pharmaceutical composition further includes a delivery carrier, which includes liposome nanoparticles (LNPs), liposomes, polymers, micelles, plasmids, viruses, or combinations thereof; wherein, preferably, liposome nanoparticles.
6. The pharmaceutical composition according to claim 5, characterized in that, The liposome nanoparticles include cationic lipids, cofactor phospholipids, sterol lipids, and PEG-modified lipids. Furthermore, the liposome nanoparticles are prepared from a combination of SM-102, DSPC, cholesterol, and DMG-PEG2000; Furthermore, the molar ratio of SM-102, DSPC, cholesterol, and DMG-PEG2000 in the liposome nanoparticles is 30-70:1-20:20-50:0.1-5, preferably 50:10: 38.5:1.5。 7. An mRNA vaccine, characterized in that, The mRNA vaccine comprises the mRNA molecule as described in any one of claims 1-3 and liposome nanoparticles encapsulating the mRNA; Furthermore, the lipid nanoparticles are prepared from a combination of SM-102, DSPC, cholesterol, and DMG-PEG2000; Furthermore, the molar ratio of SM-102, DSPC, cholesterol, and DMG-PEG2000 in the liposome nanoparticles is 30-70:1-20:20-50:0.1-5, preferably 50:10: 38.5:1.5。 8. A DNA molecule that yields the mRNA molecule of any one of claims 1-3 through transcription.
9. An expression vector, expression cassette, or host cell containing any one of the mRNA molecules of claims 1-3 or the DNA molecule of claim 8.
10. The use of the mRNA molecule of any one of claims 1-3, the DNA molecule of claim 8, the expression vector, the expression cassette or host cell, the pharmaceutical composition of any one of claims 4-6, or the mRNA vaccine of claim 7 in the preparation of a drug having any one or more of the following effects; (b1) Prevention or treatment of diseases mediated by Bordetella pertussis; (b2) Prevention, treatment or detection of Bordetella pertussis; in, In the application (b1), the disease mediated by Bordetella pertussis includes pertussis.