Preparation method and application of microneedle array patch based on SERS microneedle patch integrated CHA-HCR cascade amplification technology

Abstract

The invention discloses a preparation method and application of a microneedle array patch based on an SERS microneedle patch integrated CHA-HCR cascade amplification technology, and belongs to the technical field of material synthesis and biosensing. The invention discloses a preparation method of a microneedle array patch based on an SERS microneedle patch integrated CHA-HCR cascade amplification technology. The preparation method comprises the following steps: synthesizing UG NP (at) PDA (at) Ag NPs; the design thought of CHA-HCR is combined; and constructing the SERS microneedle biosensing patch device. The microneedle patch device prepared by the invention is expected to be used for in-situ, minimally invasive and rapid detection of trace ESAT6-CFP10 protein in early skin tuberculosis.

Description

Technical Field

[0001] This invention relates to the fields of materials synthesis and biosensing technology, and more specifically to a method for preparing a microneedle array patch integrating SERS microneedle patch with CHA-HCR cascade amplification technology, and its application in in-situ capture and ultrasensitive detection of skin tuberculosis-related ultra-low abundance biomarkers. Background Technology

[0002] Tuberculosis (TB) is one of the most challenging public health problems globally, caused by infection with Mycobacterium tuberculosis (MTB). Cutaneous tuberculosis (CTB), an important subtype of extrapulmonary tuberculosis, is caused by MTB directly invading the skin. Because early CTB occurs in situ on the skin, and the lesions are highly similar in morphology to various skin diseases such as eczema, sarcoidosis, and fungal infections, it is easily misdiagnosed or missed in clinical practice, seriously threatening patients' lives and health. Therefore, developing a non-invasive, rapid, and ultrasensitive in situ early CTB infection detection technology can achieve accurate identification and intervention in the early stages of infection, significantly reducing the risk of secondary infections and providing key clinical value for improving the tuberculosis prevention and control system.

[0003] Traditional CTB diagnosis relies on MTB culture after lesion aspiration, but this invasive procedure not only causes pain and reduces patient compliance but also carries the risk of secondary infection or cross-infection due to wound exposure, especially in individuals with large lesion areas and weakened immune systems. Therefore, developing novel in situ interstitial fluid (ISF) diagnostic methods is crucial for the early diagnosis and treatment of CTB. In recent years, the development of microneedle-based biosensor technology has garnered significant attention. Microneedle (MN) patches offer advantages such as minimal invasiveness, painlessness, and immediate sampling, and are widely used in ISF in situ analysis. MNs are typically ≤ 800 μm in length, allowing them to penetrate the stratum corneum without reaching pain nerve endings. Only light pressure is needed to continuously extract ISF from the epidermal-dermal junction, offering superior trauma and sampling depth compared to traditional punctures. After TB spreads to the skin through tiny wounds or the bloodstream, it forms microgranulomas, at which point the bacterial load at the infection focus is low and inflammation is mild. Early-stage secretory antigens of tuberculosis (TB), such as ESAT-6-CFP-10, are initially released into the intracellular fluid (ISF) adjacent to the infection site, resulting in elevated ESAT-6-CFP-10 levels in the ISF while serum levels remain at baseline. Therefore, directly detecting ESAT-6-CFP-10 protein in the ISF using microneedle patch technology enables in-situ early diagnosis, potentially improving the sensitivity and specificity of early CTB screening. Coupling microneedle sampling with advanced biosensing technologies such as electrochemistry, electronic communication, surface-enhanced Raman spectroscopy, nucleic acid signal amplification, and immuno / proteomics can create integrated microneedle patches that provide "instant sampling-instant detection-instant output." These devices combine the advantages of in-situ, real-time, and minimally invasive detection, offering a new example for in-situ detection of trace biomarkers.

[0004] However, the detection of low-abundance ESAT6-CFP10 is still limited by the weak response signal of the sensing unit, restricting the linear detection range and detection limit of the biomarker. To address this, enzyme-free nucleic acid signal amplification technology, catalytic hairpin assembly (CHA) and hybridization chain reaction (HCR), was introduced into the construction of the biosensor to achieve cascade amplification. CHA / HCR requires no protease, has high specificity and low background, and can efficiently amplify the target signal in complex skin exudates, significantly broadening the linear range and lowering the detection limit. The detection sensitivity of biosensors based on nucleic acid signal amplification technology has been further improved and has been widely used in the rapid and sensitive analysis and detection of various substances.

[0005] Surface-enhanced Raman spectroscopy (SERS) is a technique in which the Raman signal is significantly enhanced when the analyte is adsorbed onto the "hotspot" surface of a noble metal nanostructure such as gold, silver, or copper. 4 -10 10This technology offers several advantages. SERS possesses the following unique benefits: (a) its ultra-high sensitivity allows for high-sensitivity detection even in early-stage tuberculous lesions where the ESAT6-CFP10 protein marker in ISF is present at extremely low levels; (b) it provides fingerprint information of biological samples, enabling the identification of interfering substances and the elimination of interference from skin lipids, pigments, etc., through a special fingerprint spectrum; and (c) its excellent resistance to photobleaching and autofluorescence, exhibiting strong photostability under continuous light exposure and different physiological conditions, thus supporting repeated detection of the same patch. Based on these advantages, SERS technology has become a research hotspot for non-destructive and rapid detection of disease biomarkers.

[0006] Therefore, providing a method for fabricating and applying a microneedle array patch integrating SERS microneedle patch with CHA-HCR cascade amplification technology is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0007] In view of this, the present invention provides a method for preparing a microneedle array patch integrating CHA-HCR cascade amplification technology for SERS microneedle patches and its application in in situ detection of trace markers of skin tuberculosis ESAT6-CFP10 protein.

[0008] This invention discloses a method for preparing a SERS probe (UGNPs@PDA@Ag NPs, UPAg NPs) that combines high signal enhancement, high stability, and good biocompatibility. First, high-density, urchin-like gold nanoparticles (UG NPs) with sharp protrusions on their surface are synthesized to increase the specific surface area and provide sites for subsequent loading. Then, a layer of polydopamine (PDA), exhibiting good biocompatibility and strong adhesion, is polymerized in situ on its surface as a transition layer to induce and stabilize silver nanoparticles (Ag NPs). Next, uniformly sized Ag NPs are uniformly generated on the PDA layer through mild chemical reduction, forming numerous sub-nanometer gap "hot spots," significantly enhancing the Raman enhancement effect. The prepared UPAg NPs exhibit uniform morphology and good dispersibility, demonstrating excellent SERS sensitivity, long-term storage stability, and batch reproducibility. Furthermore, the process is simple, the conditions are mild, and it is easy to scale up, making it suitable for large-scale production.

[0009] This invention provides a design concept for CHA-HCR cascade amplification: the marker first binds to the aptamer in the aptamer-complementary strand (Apt-c DNA) duplex with higher affinity, releasing the free complementary strand. The complementary strand further opens the hairpin H1, and the exposed sequence then binds complementary to the double hairpin 2H2, forming an H1-2H2 duplex and releasing the complementary strand; the released complementary strand can cyclically trigger a new round of reactions, thereby achieving exponential signal enhancement in a short time. 2H2 and 2H3 are designed as a self-assembling double hairpin structure, and the exposed 2H2 sequence then binds complementary to the hairpin 2H3. Therefore, under the initiation of the marker, a cascade reaction can be triggered to form a long-chain nucleic acid polymer, thereby amplifying the signal.

[0010] This invention constructs a minimally invasive, painless, and highly sensitive SERS microneedle biosensor. By combining nucleic acid signal amplification technology, SERS technology, and microneedle patch technology, when the microneedle patch is inserted into the skin lesion site of tuberculosis, the needle, which contains a mixture of SERS probes, DNA sequences, and methylpolyacrylamide hyaluronic acid (MeHA), absorbs ISF and swells. The ESAT6-CFP10 protein marker highly affinity adapts to Apt in the Apt-C DNA double strand, releasing the free complementary strand. The free complementary strand first opens the hairpin H1 modified on the SERS probe, and the exposed sequence then binds to the hairpin 2H2, forming an H1-2H2 double strand and releasing the complementary strand again. The complementary strand cycle repeats, cascading and triggering a large amount of H1 / 2H2 polymerization. 2H2 further opens 2H3 and binds to it, triggering a cascade reaction that rapidly generates ultra-long nucleic acid chains, resulting in a high-density enrichment of a large number of Raman reporter molecules in the SERS hotspot region. Therefore, even at trace concentrations of the ESAT6-CFP10 protein marker, exponential signal amplification can be achieved. By detecting the intensity of the Cy5 Raman fingerprint characteristic peak of the labeled molecule enriched on the 2H2 of the SERS probe, the concentration of the ESAT6-CFP10 protein biomarker is directly reflected, thereby achieving real-time in-situ detection and accurate quantification of ESAT6-CFP10 protein, greatly increasing detection sensitivity and reducing background signal interference. The use of microneedle patches avoids the pain of traditional puncture sampling, while the high efficiency and high sensitivity of the combination of nucleic acid signal amplification technology and SERS technology ensure accurate detection of ESAT6-CFP10 protein concentration, providing a more comfortable and convenient early detection method for patients with cutaneous tuberculosis and offering new possibilities for the precise management of tuberculosis.

[0011] To achieve the above objectives, the present invention adopts the following technical solution:

[0012] The technical solutions of this invention are as follows: 1) Synthesis of UG NP@PDA@Ag NPs; 2) Design concept of CHA-HCR; 3) Construction of SERS microneedle biosensing patch device; 4) Application of microneedle patch device integrating nucleic acid signal amplification technology and surface-enhanced Raman technology to detect trace skin tuberculosis markers.

[0013] A method for fabricating a microneedle array patch integrating SERS microneedle patch CHA-HCR cascade amplification technology, the specific steps of which are as follows:

[0014] 1) Synthesis and preparation methods of UPAg NPs

[0015] (1) Add 10 mL of 20-40 mM AgNO3 solution to 60-100 mL of ultrapure water and heat to boiling; then quickly add 0.8 mL of 5-10 mM sodium citrate aqueous solution and continue boiling for 5 minutes; after stirring at room temperature for 1 hour, the solution color changes from colorless to yellow-green, add ultrapure water to make up to 80 mL, and obtain Ag NPs solution, which is stored at 4℃ protected from light for later use;

[0016] (2) Mix 8 mL of ultrapure water and 3 mL of 5-10 mM HAuCl4 aqueous solution evenly, quickly add 4 mL of AgNPs and sonicate to mix, then add 8 mL of 15-20 mM levodopa solution to obtain UG NPs solution; then, mix 0.5 g of poloxamer and 0.15 g of dopamine hydrochloride and dissolve in 4 mL of ultrapure water, then add 80-100 μL of 1,3,5-trimethylbenzene and sonicate for 10 minutes to mix; add 1 mL of the above-prepared UG NPs solution, add 400-420 μL of ammonia water under rapid stirring and react for 1 hour; after the reaction is completed, centrifuge at 8000 rpm for 10 minutes and resuspend in 1 mL of ultrapure water to obtain UG@PDA NPs solution;

[0017] (3) Add 500 μL of UG@PDA NPs solution to 5 mL of ultrapure water and mix well. Quickly add 160 μL of 10-15 mM AgNO3 solution and stir for 10 minutes. Then add 200 μL of 10-15 mM NaBH4 solution dropwise and stir for 30 minutes. After stopping stirring, centrifuge the solution obtained from the reaction at 8000 rpm for 15 minutes and resuspend it in 2 mL of ultrapure water. Store it in the dark at 4 °C to obtain UPAg NPs solution.

[0018] 2) Combined use of CHA and HCR

[0019] (1) Mix the ESAT6-CFP10 protein-specific aptamer (Apt) and aptamer complementary strand C DNA in a 1:1 volume ratio, and denature and anneal at 95℃ for 10 min. Then, place it in a water bath at 37℃ for 2 hours to obtain a 10 μM Apt - C DNA double-stranded solution.

[0020] The Apt sequence is as follows: GCCTGTTGTGAGCCTCCTAACCCCATCTTATACGTATATGGACTCATCTCGACCCCCGATAGGCTTGGTACATGCTTATTCTTGTCTCCC;

[0021] The c DNA strand sequence is as follows: GGTTAGGAGGCTCACAACAGGCTTT;

[0022] (2) The thiol (HS-) modified H1, 2H3 and anthocyanin 5 (Cy5) labeled 2H2 were denatured and annealed at 95℃ for 10 min, and then placed in a water bath at 37℃ for 2 hours to obtain a 10 μM solution of HS-H1, Cy5-2H2 and 2H3.

[0023] The H1 sequence of the thiol-modified group is as follows: HS-AAAAAAAGCATGATGTGAGCCTCCTAACCAAAAAACTATGTGTAGTGGTTAGGAGGCTC;

[0024] The anthocyanin 5-labeled 2H2 sequence is as follows: Cy5-AAAATAACCACTACACATACTTTTTTGGTTAGGAGGCTCACTATGTGTAGTCCCCCCGTACTCGAGTACG;

[0025] The 2H3 sequence is as follows: AAAAAAAGCCTGTTGTGAGCCTCCTAACCAAAAAAACTATGTGTACTGGTTAGGAGGCTCACCCCCCCATGCGCGCGCATG;

[0026] 3) Fabrication of SERS microneedle biosensing patch device

[0027] Mix 1 mL of UPAg NPs with 100 μL of 100 μM HS-H1 solution and incubate at 25 °C and 220 rpm for 12 hours; then add 100 μL of 1% BSA and continue incubation for 2 hours. Centrifuge at 12000 rpm for 6 minutes and resuspend in 1 mL of PBS to obtain UPAg NPs@HS-H1 solution.

[0028] 400 μL UPAg NPs@HS-H1 solution, 20 μL 10 μM Apt-c DNA solution, 30 μL 10 μM Cy5-2H2 solution, 25 μL 10 μM 2H3 solution, 40 mg MeHA, and 1 mL 0.25% (w / v) LAP photoinitiator solution were mixed thoroughly and centrifuged at 2000 rpm for 4 minutes to remove air bubbles and fill the PDMS mold. The mixture was then placed in a vacuum dryer and vacuumed at 0.08 MPa for 30 minutes, followed by drying at 37°C for 8 hours. This process was repeated twice. The microneedle mold was then cross-linked by irradiating it with blue light for 20 seconds. Subsequently, 1 mL of NOA61 UV-curable adhesive was added to the mold, and the mixture was centrifuged at 4000 rpm for 3 minutes to fill the mold as a backing layer. After UV curing, the microneedle patch was demolded to obtain the microneedle patch.

[0029] Furthermore, the microneedle array patch prepared by the method.

[0030] Furthermore, the microneedle array patch is used in the preparation of a device for detecting trace amounts of ESAT6-CFP10 protein in skin tuberculosis.

[0031] A microneedle patch device integrating CHA-HCR cascade amplification technology for SERS microneedle patch is expected to be used for in situ, minimally invasive, and rapid detection of trace amounts of ESAT6-CFP10 protein in early CTB.

[0032] As can be seen from the above technical solution, compared with the prior art, the present invention discloses a method for preparing and applying a microneedle array patch integrating SERS microneedle patch CHA-HCR cascade amplification technology, which has the following beneficial effects:

[0033] (1) Superior SERS performance: ① High enhancement effect: The surface of the urchin-like UG NPs is densely covered with sharp protrusions, which expands the specific surface area and creates conditions for the uniform loading of PDA layer and Ag NPs. A large number of sub-nanometer gaps are formed between Ag NPs, providing high-density Raman hot spots, which significantly enhances the enhancement effect of UPAg NPs. ② High stability and reproducibility: PDA has both good biocompatibility and adhesion. As an intermediate layer, it stably adsorbs Ag NPs, ensuring that the probe maintains high stability throughout the preparation and use stages. At the same time, through strict process and quality control, the performance of different batches of probes is highly consistent, achieving excellent reproducibility.

[0034] (2) Combining nucleic acid signal amplification technology with SERS technology: The DNA hairpin structure designed by CHA and HCR is stably closed before being triggered, reducing non-specific binding; the priming strand in the designed CHA reaction is released after each cycle and participates in the reaction again, achieving efficient recovery of the priming strand; HCR further linearly amplifies the product, improving detection sensitivity and reducing costs; the combination of enzyme-free isothermal amplification, cascade signal amplification and SERS probes breaks through the sensitivity and operation bottlenecks of traditional nucleic acid amplification technology, and has multiple advantages such as high sensitivity, low cost, simple operation and strong adaptability, making it a powerful tool for detecting trace markers.

[0035] (3) The detection method is non-invasive, painless and highly sensitive: the use of microneedle patches avoids the pain of traditional puncture sampling and improves the patient's comfort and acceptance.

[0036] (4) SERS technology has the advantage of high sensitivity and can accurately detect the Raman signal intensity of markers, ensuring the accuracy of detection of low abundance ESAT6-CFP10 protein in early skin tuberculosis infection.

[0037] (5) The preparation process is simple, easy to control, and suitable for large-scale production: The entire preparation process includes the synthesis of SERS probes and the construction of microneedle patches, with clear, simple, and easy-to-control steps. The experimental conditions used in the preparation process are mild and will not damage the materials or affect their performance. The preparation process of this invention is suitable for large-scale production and can meet the large market demand for early detection devices for skin tuberculosis. Attached Figure Description

[0038] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0039] Figure 1 Transmission electron microscopy image of UPAg NPs (scale bar: 200 nm).

[0040] Figure 2 The image shows the EDX mapping of UPAg NPs; the top and bottom rows represent two nanomaterials.

[0041] Figure 3This is a Native-PAGE image; lane 1: C DNA; lane 2: H1; lane 3: 2H2; lane 4: 2H3; lane 5: C DNA, H1; lane 6: C DNA, 2H2; lane 7: C DNA, 2H3; lane 8: H1, 2H2; lane 9: 2H2, 2H3; lane 10: H1, 2H3; lane 11: H1, 2H2, 2H3; lane 12: C DNA, H1, 2H2 (H1 and 2H2 concentrations are 300 nM); lane 13: C DNA, H1, 2H2 (H1 and 2H2 concentrations are 500 nM); lane 14: C DNA, H1, 2H2, 2H3; the concentrations of C DNA, H1, 2H2, and 2H3 in the remaining lanes are all 500 nM.

[0042] Figure 4 The circular dichroism spectrum of the interaction between the aptamer and the ESAT6-CFP10 protein.

[0043] Figure 5 This is a drawing of a PDMS mold.

[0044] Figure 6 This is a scanning electron microscope (SEM) image of the microneedle.

[0045] Figure 7 This is a light microscope image of a SERS microneedle patch.

[0046] Figure 8 To detect SERS Raman spectra of ESAT6-CFP10 protein at different concentrations.

[0047] Figure 9 To and Figure 8 The corresponding concentration of ESAT6-CFP10 protein was 1361 cm⁻¹. -1 The characteristic peak standard curve at that location. Detailed Implementation

[0048] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0049] Example 1: Synthesis and Characterization of UPAg NPs

[0050] 10 mL of 20 mM AgNO3 solution was added to 60 mL of ultrapure water and heated to boiling. Then, 0.8 mL of 5 mM sodium citrate aqueous solution was quickly added, and boiling continued for 5 minutes. After stirring at room temperature for 1 hour, the solution color changed from colorless to yellow-green. Ultrapure water was added to bring the volume to 80 mL to obtain the Ag NPs solution, which was stored at 4°C protected from light until later use. 8 mL of ultrapure water and 3 mL of 5 mM HAuCl4 aqueous solution were mixed thoroughly, and 4 mL of Ag NPs was quickly added and sonicated. Then, 8 mL of 15 mM L-DOPA solution was added to obtain the UG NPs solution. Next, 0.5 g of poloxamer and 0.15 g of dopamine hydrochloride were dissolved in 4 mL of ultrapure water, followed by the addition of 80 μL of 1,3,5-trimethylbenzene (TMB) and sonicated for 10 minutes. 1 mL of the UG NPs solution prepared above was added, and 400 μL of ammonia water was added with rapid stirring, followed by a reaction time of 1 hour. After the reaction was complete, the solution was centrifuged at 8000 rpm for 10 minutes and resuspended in 1 mL of ultrapure water to obtain the UG@PDA NPs solution. 500 μL of the UG@PDA NPs solution was added to 5 mL of ultrapure water and mixed thoroughly. Then, 160 μL of 10 mM AgNO3 solution was quickly added and stirred for 10 minutes. Subsequently, 200 μL of 10 mM NaBH4 solution was added dropwise and stirred for 30 minutes. After stopping stirring, the resulting solution was centrifuged at 8000 rpm for 15 minutes and resuspended in 2 mL of ultrapure water. The solution was stored in the dark at 4 °C to obtain the UG@PDA@Ag NPs (UPAg NPs) solution.

[0051] The UPAg NPs prepared above were characterized in terms of performance and morphology. Figure 1 Transmission electron microscopy results showed that they were all composite spherical nanomaterials with a diameter of about 150-200 nm. The core was UG NPs with spike-like protrusions, and Ag NPs were uniformly adhered to the outer surface, showing good dispersibility. UPAg NPs were successfully prepared. Figure 2 The EDX mapping diagram of UPAg NPs shows that UG NPs are the central core of UPAg NPs, which are uniformly surrounded by a layer of Ag.

[0052] Example 2: Design of Combined CHA and HCR

[0053] First, in the absence of ESAT6-CFP10 protein, Apt and cDNA maintain a tight complementary pairing, preserving the Apt-cDNA double helix. In the presence of ESAT6-CFP10 protein, due to its stronger affinity for Apt, it can competitively displace the cDNA strand from the Apt-cDNA pair, forming the ESAT6-CFP10-Apt complex. The released free cDNA strand can then open the stem-loop in the H1 strand, forming a cDNA-H1 double helix. Subsequently, 2H2 binds to the H1 strand on the cDNA-H1 pair, forming a more stable H1-2H2 chain. The released cDNA strand then binds to other H1 chains, repeatedly participating in the cyclic reaction. 2H3 binds to the 2H2 of the H1-2H2 chain, forming an n(2H2-2H3) long chain, which ultimately aggregates densely on the surface of the SERS probe, resulting in a dual nucleic acid signal amplification effect.

[0054] Specifically, the ESAT6-CFP10 protein was used as the detection target. A 25 bp complementary DNA sequence, cDNA (the initiating strand), was designed based on the ESAT6-CFP10 aptamer sequence. The ESAT6-CFP10 protein releases cDNA upon binding to the aptamer (Apt). H1 is a 59 bp single hairpin DNA sequence. The cDNA specifically recognizes the H1 stem sequence, causing the double-stranded region of the stem to unwind. The cDNA binds to the H1 stem, forming a double strand, exposing the H1 hairpin region. The H1 hairpin region sequence specifically recognizes and binds to the 70 bp double hairpin DNA sequence 2H2, competitively releasing the cDNA into a free single strand. This process continues, opening the next H1 stem, triggering the CHA cycle, until all H1 and 2H2 hairpin structures are opened. The 80 bp double hairpin DNA sequence 2H3 is further opened by 2H2 and binds to it, forming a long-chain nucleic acid polymer. The mentioned DNA sequences are shown in Table 1.

[0055] Table 1 DNA Sequence

[0056]

[0057] (1) Mix the ESAT6-CFP10 protein-specific aptamer Apt and C DNA strands in a 1:1 volume ratio and denature them (95℃, 10 min). Then, place them in a water bath at 37℃ for 2 hours to obtain a 10 μM Apt-C DNA double-stranded solution.

[0058] (2) The thiol (HS-) modified H1, 2H3 and anthocyanin 5 (Cy5) labeled 2H2 were subjected to denaturation annealing (95℃, 10 min) and then placed in a water bath at 37℃ for 2 hours to obtain 10 μM HS-H1, Cy5-2H2 and 2H3 solutions.

[0059] Prepare 10% PAGE gels for electrophoresis analysis: Mix 4 mL ultrapure water, 100 μL APS (10%), 2 mL 5×TBE buffer, 4 mL 30% Acr-bis (29:1), and 6 μL TEMED and polymerize at room temperature for 1 hour. Mix 12 μL of DNA reaction sample with 2.4 μL 6× Loading Buffer solution. Add 3 μL of 20 bp DNA ladder as a DNA indicator to the leftmost lane (i.e., the left side of sample well lane 1), and then add the prepared samples to the lanes sequentially. Subsequently, electrophoresis is performed in 1×TBE buffer at 100 V for 90 minutes. The gel is then incubated with EB dye (1 μg / mL) for 10 minutes to stain. The stained DNA bands are imaged using a Tocan 240 gel imaging system under UV excitation.

[0060] Nucleic acid gel electrophoresis imaging results as follows Figure 3 As shown in the diagram, lane 5 clearly demonstrates that the cDNA effectively opens the hairpin structure of H1 and forms a stable double-stranded structure with it. Furthermore, the large DNA band appearing in lane 14 indicates that the n(H1-2H2-2H3) complex has been successfully formed. Native-PAGE experiments verified that the DNA strand substitution reaction can be successfully initiated in the presence of cDNA, triggering the CHA cycle and subsequent HCR cascade reactions. This fully demonstrates that the sequence designed in this invention has high rationality and feasibility, and can effectively drive the operation of the entire reaction system.

[0061] To verify the high-affinity binding characteristics of the aptamer to the ESAT6-CFP10 protein, 500 μL of 100 µg / mL ESAT6-CFP10 protein was incubated with 500 μL of 1 μM Apt at 37°C for 30 minutes. Circular dichroism spectroscopy was then used to confirm the binding and determine the conformational changes of the ESAT6-CFP10 protein and its aptamer. Figure 4As shown, the ESAT6-CFP10 protein alone exhibits a negative peak at 218 nm, a characteristic peak reflecting its inherent secondary structure. After the addition of the aptamer, a significant change in the protein's spectral characteristics was observed, indicating that a specific binding between the aptamer and the ESAT6-CFP10 protein induced a conformational rearrangement of the aptamer. This result demonstrates a high-affinity, specific binding between the aptamer and the ESAT6-CFP10 protein.

[0062] Example 3: Preparation and Characterization of SERS Microneedle Biosensing Patch Device

[0063] Mix 1 mL of UPAg NPs and 100 μL of 100 μM HS-H1 solution and incubate at 25 °C and 220 rpm for 12 hours. Then add 100 μL of 1% BSA and continue incubation for 2 hours. Centrifuge at 12000 rpm for 6 minutes and resuspend in 1 mL of PBS to obtain the HS-H1@UG@PDA@Ag NPs (UPAg NPs@HS-H1) solution.

[0064] 400 μL of UPAg NPs@HS-H1 solution, 20 μL of 10 μM Apt-c DNA solution, 30 μL of 10 μM Cy5-2H2 solution, 25 μL of 10 μM 2H3 solution, 40 mg MeHA, and 1 mL of 0.25% (w / v) LAP photoinitiator solution were mixed thoroughly and centrifuged at 2000 rpm for 4 minutes to remove air bubbles. The mixture was then filled into a PDMS mold (12×12 pyramid-shaped needles with a height of 600 µm, a base of 300 µm, and a tip distance of 600 µm, custom-made by Microdot Technology Co., Ltd.). The mold was placed in a vacuum desiccator and vacuumed at 0.08 MPa for 30 minutes to remove air bubbles. It was then dried at 37°C for 8 hours. After repeating the above steps twice, the microneedle mold was irradiated with blue light for 20 seconds for cross-linking treatment. Then, 1 mL of NOA61 UV-curable adhesive was added to the mold, centrifuged at 4000 rpm for 3 minutes to fill it as a backing layer, and after UV curing, it was demolded from the mold to obtain the microneedle patch.

[0065] See PDMS mold drawing Figure 5 See the scanning electron microscope image of the microneedle. Figure 6 ; Figure 7 The image shows a microneedle patch with a regular shape and a rectangular pyramid shape, which successfully constructed a minimally invasive and painless SERS microneedle sensor.

[0066] Example 4: In-situ, ultrasensitive detection of ESAT6-CFP10 protein using SERS microneedle patch integrated CHA-HCR cascade amplification technology.

[0067] In this invention, when the ESAT6-CFP10 protein triggers the CHA-HCR cascade reaction, an enriched ultralong nucleic acid polymer H1-n (2H2-2H3) is formed on the surface of the SERS probe. Accompanying this chain extension, the Raman reporter molecule Cy5, labeled on 2H2, approaches the plasma "hot spot" on the probe surface, with a length of 1361 cm⁻¹. -1 The Raman characteristic peak signal is thus captured with high sensitivity. Therefore, Cy5 at 1361 cm⁻¹ -1 The Raman signal intensity at the location is the local concentration of ESAT6-CFP10 protein in the microenvironment of the microneedle SERS sensor.

[0068] SERS microneedle patches were inserted into agarose gel (containing 500 μL of ESAT6-CFP10 protein solutions of different concentrations). -1 -10 6 The mixture of 1 g / mL agarose solution and 5 mL of 1 g / mL agarose solution was reacted at 37 °C for 20 minutes. After removing the microneedle, it was placed on a slide of a Raman analyzer microscope, and the spectrum was acquired using a portable 633 nm Raman spectrometer with the power set to 50 mW and the acquisition time set to 1 s.

[0069] Figure 8 This shows that as the concentration of ESAT6-CFP10 protein gradually decreases, the concentration at 1361 cm⁻¹ decreases. -1 The characteristic Raman peak intensity at the specified location showed a clear decreasing trend, and the linear range for the detection of ESAT6-CFP10 protein by this sensor was determined to be 10. -1 -10 6 Within this range, the ESAT6-CFP10 protein concentration is ng / mL and 1361 cm⁻¹. -1 A significant linear relationship was observed between the Raman signal intensity at the location, with a correlation coefficient of 0.99732. Figure 9 This indicates that the sensor can sensitively respond to changes in the concentration of ESAT6-CFP10 protein and achieve quantitative analysis through changes in the intensity of characteristic peaks.

[0070] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A method for fabricating a microneedle array patch integrating SERS microneedle patch with CHA-HCR cascade amplification technology, characterized in that, The specific steps are as follows: 1) Synthesis and preparation methods of UPAg NPs (1) Add 10 mL of 20-40 mM AgNO3 solution to 60-100 mL of ultrapure water and heat to boiling; then quickly add 0.8 mL of 5-10 mM sodium citrate aqueous solution and continue boiling for 5 minutes; after stirring at room temperature for 1 hour, the solution color changes from colorless to yellow-green, add ultrapure water to make up to 80 mL, and obtain Ag NPs solution, which is stored at 4℃ protected from light for later use; (2) Mix 8 mL of ultrapure water and 3 mL of 5-10 mM HAuCl4 aqueous solution evenly, quickly add 4 mL of Ag NPs and sonicate to mix evenly, then add 8 mL of 15-20 mM levodopa solution to obtain UG NPs solution; then, mix 0.5 g of poloxamer and 0.15 g of dopamine hydrochloride and dissolve in 4 mL of ultrapure water, then add 80-100 μL of 1,3,5-trimethylbenzene and sonicate for 10 minutes to mix evenly; add 1 mL of the UG NPs solution prepared above, add 400-420 μL of ammonia water under rapid stirring and react for 1 hour; after the reaction is completed, centrifuge at 8000 rpm for 10 minutes and resuspend in 1 mL of ultrapure water to obtain UG@PDA NPs solution; (3) Add 500 μL of UG@PDA NPs solution to 5 mL of ultrapure water and mix well. Quickly add 160 μL of 10-15 mM AgNO3 solution and stir for 10 minutes. Then add 200 μL of 10-15 mM NaBH4 solution dropwise and stir for 30 minutes. After stopping stirring, centrifuge the solution obtained from the reaction at 8000 rpm for 15 minutes and resuspend it in 2 mL of ultrapure water. Store it in the dark at 4 °C to obtain UPAg NPs solution. 2) Combined use of CHA and HCR (1) Mix the ESAT6-CFP10 protein-specific aptamer Apt and C DNA strands in a 1:1 volume ratio, and denature and anneal at 95°C for 10 min. Then, place the mixture in a water bath at 37°C for 2 hours to obtain a 10 μM Apt-C DNA double-stranded solution. The Apt sequence is as follows: GCCTGTTGTGAGCCTCCTAACCCCATCTTATACGTATATGGACTCATCTCGACCCCCGATAGGCTTGGTACATGCTTATTCTTGTCTCCC; The c DNA strand sequence is as follows: GGTTAGGAGGCTCACAACAGGCTTT; (2) The thiol-modified H1, 2H3 and anthocyanin 5-labeled 2H2 were denatured and annealed at 95℃ for 10 min, and then placed in a water bath at 37℃ for 2 hours to obtain a 10 μM solution of HS-H1, Cy5-2H2 and 2H3. The H1 sequence of the thiol-modified group is as follows: HS-AAAAAAAGCATGATGTGAGCCTCCTAACCAAAAAACTATGTGTAGTGGTTAGGAGGCTC; The anthocyanin 5-labeled 2H2 sequence is as follows: Cy5-AAAATAACCACTACACATACTTTTTTGGTTAGGAGGCTCACTATGTGTAGTCCCCCCGTACTCGAGTACG; The 2H3 sequence is as follows: AAAAAAAGCCTGTTGTGAGCCTCCTAACCAAAAAAACTATGTGTACTGGTTAGGAGGCTCACCCCCCCATGCGCGCGCATG; 3) Fabrication of SERS microneedle biosensing patch device Mix 1 mL of UPAg NPs with 100 μL of 100 μM HS-H1 solution and incubate at 25 °C and 220 rpm for 12 hours; then add 100 μL of 1% BSA and continue incubation for 2 hours. Centrifuge at 12000 rpm for 6 minutes and resuspend in 1 mL of PBS to obtain UPAg NPs@HS-H1 solution. 400 μL of UPAg NPs@HS-H1 solution, 20 μL of 10 μM Apt-c DNA solution, 30 μL of 10 μM Cy5-2H2 solution, 25 μL of 10 μM 2H3 solution, 40 mg MeHA, and 1 mL of 0.25% (w / v) LAP photoinitiator solution were mixed thoroughly and centrifuged at 2000 rpm for 4 minutes to remove air bubbles and fill the PDMS mold. The mixture was then placed in a vacuum dryer and vacuumed at 0.08 MPa for 30 minutes, followed by drying at 37°C for 8 hours. This process was repeated twice. The microneedle mold was then cross-linked by irradiating it with blue light for 20 seconds. Subsequently, 1 mL of NOA61 UV-curable adhesive was added to the mold, and the mixture was centrifuged at 4000 rpm for 3 minutes to fill the mold as a backing layer. After UV curing, the microneedle patch was demolded to obtain the microneedle patch.

2. The microneedle array patch prepared by the method of claim 1.

3. The application of the microneedle array patch according to claim 2 in the preparation of a device for detecting trace amounts of ESAT6-CFP10 protein in skin tuberculosis.

Images