High-throughput protein detection method based on ortho DNA (deoxyribonucleic acid) coding

CN121605310APending Publication Date: 2026-03-03MGI TECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202380100939.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-09-13
Publication Date
2026-03-03

AI Technical Summary

Technical Problem

It is difficult to achieve high-throughput, high-sensitivity protein detection in the prior art, especially when detecting key proteins with low abundance and large sample cohorts, there are signal shift problems caused by excessive background signals and nonlinear amplification.

Method used

Using a probe composition-based method, the probe composition includes a first probe, a second probe and a third probe, bound to the protein to be tested and gene sequencing, the background signal is eluted with streptavidin magnetic beads, and the bias introduced by PCR amplification is circumvented by increasing the UMI sequence.

Benefits of technology

High-throughput and high-sensitivity protein detection is achieved, which reduces background signals, improves detection accuracy, and effectively avoids signal deviations introduced by PCR amplification.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000018_0000
    Figure 00000018_0000
  • Figure 00000018_0001
    Figure 00000018_0001
  • Figure 00000018_0002
    Figure 00000018_0002
Patent Text Reader

Abstract

Provided is a probe composition comprising: a first probe comprising a first oligonucleotide chain and a first antibody, the 5'terminal of the first oligonucleotide chain being linked to the first antibody, the first antibody having an activity to bind to a predetermined protein; the second probe comprises a second oligonucleotide chain and a second antibody, the 5'end of the second oligonucleotide chain is connected with the second antibody, and the second antibody has the activity of being combined with the predetermined protein; at least part of the sequence at the 3'end of the first oligonucleotide chain is suitable for being reversely and complementarily paired with at least part of the sequence at the 3 'end of the second oligonucleotide chain; the third probe comprises a third oligonucleotide chain, and at least partial sequence of the 5'end of the third oligonucleotide chain is complementarily paired with partial sequence of the 3 'end of the second oligonucleotide chain.
Need to check novelty before this filing date? Find Prior Art

Description

A high-throughput protein detection method based on adjacent DNA encoding Technical Field

[0001] The present application relates to the field of biotechnology. Specifically, the present application relates to a high-throughput protein detection method based on adjacent DNA encoding. Background Art

[0002] Proteins are the primary carriers of biological functions, serving as chemical catalysts, structural components, and mediators of physiological processes. Research technologies that can accurately identify and quantify proteins can greatly advance our understanding of biology. Proteomics, a core area of ​​life science research in the post-genomic era, requires appropriate protein sequencing technology to gain a deeper understanding of proteins and further understand the molecular mechanisms of life activities and disease. However, unlike DNA or RNA, proteins have complex structures and numerous post-translational modifications. Furthermore, the abundance of different proteins varies greatly, spanning 10 orders of magnitude. Many key proteins are relatively low in abundance, making their detection challenging.

[0003] Currently available proteomics technologies are mainly divided into two categories: mass spectrometry-based and immune (antibody)-based omics detection technologies. As a basic detection technology, mass spectrometry technology is suitable for large-scale exploratory research, but it has high requirements for the abundance of the proteins to be tested. In contrast, antibody-based targeted detection technology is suitable for high-sensitivity, high selectivity, high quantitative accuracy and reproducible detection of selected proteins to be tested, but is limited by the effectiveness of antibodies, and has limited coverage and throughput. For example, fluorescent staining and mass spectrometry can also sequence or quantify proteins within a certain abundance range, but current technologies still have certain defects and shortcomings. It is difficult to simultaneously take into account ease of use, throughput, coverage, sensitivity, and the ability to simply, quickly and reproducibly measure target proteins with an abundance range across orders of magnitude, as well as the goal of routine and complete proteome quantification of large sample cohorts, which remains difficult to achieve.

[0004] Blood has long been widely used in the clinical diagnosis of cancer and many other diseases. It contains more than 10,000 proteins, of which about 5,000 are known. However, only about 150 proteins are currently used for disease diagnosis. Therefore, more sensitive and high-throughput methods are needed to screen blood markers.

[0005] Therefore, it is necessary to develop new high-throughput and high-sensitivity protein detection methods to enable faster and more efficient disease detection and drug efficacy evaluation.

[0006] Summary of the Invention

[0007] The present application aims to solve one of the technical problems in the related art at least to a certain extent.

[0008] In the first aspect of the present application, the present application proposes a probe composition. According to an embodiment of the present application, the probe composition includes: a first probe, the first probe including a first oligonucleotide chain and a first antibody, the 5' end of the first oligonucleotide chain being connected to the first antibody, and the first antibody having an activity of binding to a predetermined protein; a second probe, the second probe including a second oligonucleotide chain and a second antibody, the 5' end of the second oligonucleotide chain being connected to the second antibody, the second antibody having an activity of binding to the predetermined protein, and at least a portion of the sequence at the 3' end of the first oligonucleotide chain being suitable for reverse complementary pairing with at least a portion of the sequence at the 3' end of the second oligonucleotide chain; and a third probe, the third probe including a third oligonucleotide chain, at least a portion of the sequence at the 5' end of the third oligonucleotide chain being complementary to a portion of the sequence at the 3' end of the second oligonucleotide chain.

[0009] According to the embodiments of the present application, the probe composition is combined with a gene sequencing method to achieve high-throughput and high-sensitivity detection of proteins.

[0010] It should be noted that, in the present application, the 3' end and the 5' end represent the two endpoints of the oligonucleotide chain; the sequence at the 3' end refers to the nucleotide corresponding to the 3' end as the first nucleotide, and then the nucleotide sequence connected in sequence, which may include the nucleotide corresponding to the 5' end of the oligonucleotide chain at the longest; the sequence at the 5' end of the oligonucleotide chain refers to the nucleotide corresponding to the 5' end as the first nucleotide, and then the nucleotide sequence connected in sequence, which may include the nucleotide corresponding to the 3' end of the oligonucleotide chain at the longest.

[0011] It should be noted that the second oligonucleotide chain at least includes a sequence partially complementary to the first oligonucleotide chain and a sequence partially complementary to the third oligonucleotide chain.

[0012] According to an embodiment of the present application, the above-mentioned probe composition may further include at least one of the following additional technical features:

[0013] According to an embodiment of the present application, the 3' end of the third oligonucleotide chain is connected to an affinity tag.

[0014] According to an embodiment of the present application, the affinity label is selected from at least one of antibodies, biotin, magnetic beads and gel beads.

[0015] According to a specific embodiment of the present application, the 5' end of the first oligonucleotide chain is connected to the first antibody.

[0016] According to a specific embodiment of the present application, the 5' end of the second oligonucleotide chain is connected to the second antibody.

[0017] According to a specific embodiment of the present application, the 3' end of the third oligonucleotide chain is connected to the third antibody.

[0018] According to an embodiment of the present application, the first antibody has an activity of binding to a first position (i.e., antigenic determinant 1) of a predetermined protein, and the second antibody has an activity of binding to a second position (antigenic determinant 2) of the predetermined protein, wherein the first position is different from the second position. Specifically, the first antibody and the second antibody bind to the same protein, but at different positions.

[0019] According to an embodiment of the present application, the first antibody has an activity of binding to a first position (i.e., antigenic determinant 1) of a predetermined protein, the second antibody has an activity of binding to a second position (antigenic determinant 2) of the predetermined protein, and the third antibody has an activity of binding to a third position (antigenic determinant 3) of the predetermined protein, wherein the first position is different from the second position and the third position. Specifically, the first antibody, the second antibody, and the third antibody bind to the same protein, but at different binding positions.

[0020] According to a specific embodiment of the present application, the first antibody has an activity of binding to a predetermined first protein, and the second antibody has an activity of binding to the predetermined second protein. Specifically, the first protein and the second protein are different.

[0021] According to a specific embodiment of the present application, the first antibody has an activity of binding to a predetermined first protein, the second antibody has an activity of binding to the predetermined second protein, and the third antibody has an activity of binding to a predetermined third protein. Specifically, the first protein, the second protein, and the third protein can be the same or different.

[0022] According to a specific embodiment of the present application, the third protein can be used to enrich or purify the probe composition.

[0023] According to an embodiment of the present application, the 3' end of the first oligonucleotide chain is reverse complementary to at least a portion of the 3' end of the second oligonucleotide chain, and the length of the complementary pair is 8 to 12 bp.

[0024] It should be noted that the 3' end (first complementary region) of the first oligonucleotide chain can be complementary to the blocking sequence (cDNA1) to prevent the binding of the first probe and the second probe.

[0025] According to an embodiment of the present invention, the length of the 3' end of the first oligonucleotide chain suitable for complementary pairing with the 3' end of the second oligonucleotide chain can be 8 bp, 9 bp, 10 bp, 11 bp, or 12 bp. The inventors have found that the length of the complementary pairing sequence here can be designed according to specific experimental requirements and is not limited here. Preferably, the complementary pairing sequence is shorter to reduce hybridization of the first oligonucleotide chain and the second oligonucleotide chain that is not dependent on antigen binding, thereby avoiding false positive signals generated in protein detection.

[0026] According to an embodiment of the present application, the first oligonucleotide chain includes a forward primer binding region, an arbitrary read region, a first protein tag region, and a first complementary region.

[0027] According to a specific embodiment of the present application, the forward primer binding region is not directly connected to the arbitrary read region, the protein first tag region, and the first complementary region. There is a spacer sequence between each functional region, and the length of the spacer sequence can be designed as needed.

[0028] According to an embodiment of the present application, the arbitrary read region includes a sequencing primer region.

[0029] According to an embodiment of the present application, the arbitrary read region includes a sample tag sequence.

[0030] According to an embodiment of the present application, the forward primer and the sequencing primer may be the same or different.

[0031] According to specific embodiments of the present application, the forward primer binding region is used to complementarily pair with a forward primer used in an amplification reaction; the sequencing primer region represents the primer binding region during q-PCR or NGS sequencing; the protein tag region is used to distinguish tag sequences of different proteins; the first complementary region represents the complementary region between the first oligonucleotide chain and the second oligonucleotide chain; and the sample tag sequence is used to distinguish different biological samples. In some examples, the order and length of the functional regions of the first oligonucleotide chain can be adjusted according to experimental requirements and are not particularly limited.

[0032] According to an embodiment of the present application, the forward primer binding region includes an Ad153-F (BGISEQ / MGISEQ linker) element.

[0033] According to an embodiment of the present application, the sequencing primer region includes a sequencing primer binding region Rd1SP (Read 1 sequencing primer, first round sequencing primer binding site) element.

[0034] According to an embodiment of the present application, the first tag region of the protein includes an FBC (Forward Barcode) element.

[0035] According to an embodiment of the present application, the first complementary region includes a Hyb (Hybridization) element.

[0036] According to an embodiment of the present application, the second oligonucleotide chain includes a second complementary region, and the second complementary region includes a 12-complementary region and a 23-complementary region.

[0037] According to a specific embodiment of the present application, the 5' end of the 12 complementary region is connected to the 3' end of the 23 complementary region.

[0038] According to a specific embodiment of the present application, the 3' ends of the 12 complementary region and the 23 complementary region are not directly connected, and there is a spacer sequence between the two functional regions. The length of the spacer sequence can be designed according to experimental requirements.

[0039] According to an embodiment of the present application, the 12 complementary region is reverse complementary to the first complementary region. According to a specific embodiment of the present application, the schematic structural diagram of the second oligonucleotide chain is shown in FIG2 .

[0040] According to an embodiment of the present application, the 12 complementary regions include Hyb elements.

[0041] According to an embodiment of the present application, the 23 complementary region includes a second protein tag RBC (Reverse Barcode) and an RS2 element.

[0042] According to an embodiment of the present application, the third oligonucleotide chain at least includes a third complementary region, a molecular tag (Unique molecμLar identifier, UMI) and a reverse primer binding region (Primer-1).

[0043] According to an embodiment of the present application, the third oligonucleic acid chain includes a sequencing primer binding region, and the sequencing primer binding region and the reverse primer binding region may be the same or different.

[0044] According to an embodiment of the present application, the third oligonucleic acid chain includes a second label region, and the second label region can be used to distinguish different biological samples.

[0045] According to a specific embodiment of the present application, the 3' end of the third complementary region is connected to the 5' end of the molecular tag, and the 3' end of the molecular tag is connected to the 5' end of the reverse primer binding region. The structural schematic diagram of the third oligonucleotide chain is shown in Figure 3.

[0046] According to a specific embodiment of the present application, the third complementary region is not directly connected to the molecular tag and the reverse primer binding region, and there is a spacer sequence between each functional region. The length of the spacer sequence can be designed according to experimental needs.

[0047] According to an embodiment of the present application, the third complementary region includes at least one of an RBC element and an S2 element.

[0048] According to an embodiment of the present application, the molecular tag is a random sequence.

[0049] According to the embodiments of the present application, the molecular tag is 10 to 20 bases long. The molecular tag is a randomly synthesized oligonucleotide. According to the embodiments of the present application, the inventors found that in the prior art, when amplifying the signal through multiple rounds of PCR (35 rounds) during protein detection, it is difficult to avoid signal deviation caused by nonlinear amplification. Therefore, the inventors increased the molecular tag (UMI) sequence to circumvent the signal deviation caused by multiple rounds of PCR.

[0050] It should be noted that the UMI sequence is used to label molecules in the sample before sequencing. During the signal processing stage, the repeated signals generated during the PCR process can be normalized, thereby avoiding the bias introduced by PCR amplification and duplication in sequencing, and improving the accuracy of quantitative analysis.

[0051] According to an embodiment of the present application, the first complementary region is suitable for complementary pairing with the 12-complementary region of the second complementary region, and the third complementary region is suitable for complementary pairing with the 23-complementary region of the second complementary region.

[0052] According to an embodiment of the present application, the Hyb element of the first complementary region is suitable for complementary pairing with the Hyb element of the 12 complementary region.

[0053] According to an embodiment of the present application, the RBC element of the third complementary region is suitable for complementary pairing with the RRBC element of the 23 complementary region.

[0054] According to an embodiment of the present application, the S2 element of the third complementary region is suitable for complementary pairing with the RS2 element of the 23 complementary region.

[0055] According to a specific embodiment of the present application, the first oligonucleotide chain, the second oligonucleotide chain and the third oligonucleotide chain after complementary pairing can be shown in FIG4 .

[0056] According to another specific embodiment of the present application, the first oligonucleotide chain, the second oligonucleotide chain and the third oligonucleotide chain after complementary pairing can be shown in Figure 7 or Figure 8 (bottom).

[0057] In a second aspect of the present application, a kit is provided. According to an embodiment of the present application, the kit comprises: the probe composition described in the first aspect of the present application and a ligase. According to an embodiment of the present application, the kit is used for protein detection and has advantages such as portability and low cost.

[0058] According to an embodiment of the present application, the above-mentioned kit further includes at least one of the following additional technical features:

[0059] According to an embodiment of the present application, the kit further includes at least one of a primer, a DNA polymerase, a buffer solution and dNTP.

[0060] According to an embodiment of the present application, the kit may further include at least one of a linker, a probe, a sample tag, and a protein tag.

[0061] It should be noted that the sample index is a DNA sequence or molecular marker used to label different samples. The sample index library refers to a collection of sample indexes. The size of the library depends on the detection throughput. The role of the sample index is to distinguish different samples, so that multiple samples can be processed in parallel during the sequencing process and the sequencing reads can be correctly attributed to the corresponding samples. The sample index is selected from at least one of the sample index libraries.

[0062] It should be noted that the protein barcode, including FBC and RBC, refers to a DNA sequence or molecular marker that labels different proteins to be tested. The protein label library refers to a collection of a series of sample labels, and the size of the library depends on the number of proteins to be tested. The role of the protein label is to distinguish different test proteins so that multiple proteins can be processed in parallel during the sequencing process and the sequencing reads can be correctly attributed to the corresponding proteins. The protein label is selected from at least one of the protein label library.

[0063] According to an embodiment of the present application, the linker is Ad153-F (BGISEQ / MGISEQ linker).

[0064] In the third aspect of the present application, the present application proposes a method for detecting a protein. According to an embodiment of the present application, the method comprises: mixing a first probe, a second probe, and a third probe with a protein to be detected to obtain a sequencing library; sequencing the sequencing library to detect the protein to be detected; wherein the first probe comprises a first oligonucleotide chain and a first antibody, the 5' end of the first oligonucleotide chain is connected to the first antibody, and the first antibody has an activity of binding to a predetermined protein; the second probe comprises a second oligonucleotide chain and a second antibody, the 5' end of the second oligonucleotide chain is connected to the second antibody, the second antibody has an activity of binding to the predetermined protein, and at least a portion of the sequence at the 3' end of the first oligonucleotide chain is suitable for reverse complementary pairing with at least a portion of the sequence at the 3' end of the second oligonucleotide chain; the third probe comprises a third oligonucleotide chain, and at least a portion of the sequence at the 5' end of the third oligonucleotide chain is complementary to a portion of the sequence at the 3' end of the second oligonucleotide chain.

[0065] According to the embodiments of the present application, protein detection using the above method can effectively reduce background signals and improve detection accuracy.

[0066] According to an embodiment of the present application, the above protein detection method further includes at least one of the following additional technical features:

[0067] According to an embodiment of the present application, the protein detection method further includes a ligation process for generating a nucleic acid sequence including the first probe and the third probe sequence. In some examples of the present application, only the ligation process step may be performed based on experimental requirements.

[0068] According to an embodiment of the present application, the protein detection method further includes an extension process and a ligation process for generating a nucleic acid sequence including the first probe and the third probe sequence. In other examples of the present application, an extension process step can be added before the ligation process step based on experimental requirements.

[0069] According to an embodiment of the present application, the 3' end of the third oligonucleotide chain is connected to an affinity tag, and the affinity tag is selected from at least one of antibodies, biotin, magnetic beads and gel beads.

[0070] According to an embodiment of the present application, the ligation process further includes at least one of the following steps: a. amplifying the ligation product using primers; b. capturing the ligation product using affinity tags.

[0071] According to an embodiment of the present application, the mixing treatment is performed in the following manner: performing a first mixing treatment on the first probe, the second probe and the protein to be detected; and performing a hybridization treatment on the first mixing treatment product and the third probe.

[0072] According to a specific embodiment of the present application, the first antibody in the first probe can bind to the protein to be detected; the second antibody in the second probe can also bind to the protein to be detected, thereby bringing the first probe and the second probe into close proximity, so that at least a portion of the sequence at the 3' end of the first oligonucleotide chain is complementary to at least a portion of the sequence at the 3' end of the second oligonucleotide chain, forming a first mixed treatment product. The first mixed treatment product is further hybridized and ligated with a third probe to form a sequencing library.

[0073] According to a specific embodiment of the present application, the mixing treatment is carried out in the following manner: the first probe, the second probe, the third probe and the protein to be tested are mixed, wherein the 5' terminal partial sequence of the third oligonucleotide chain of the third probe is complementary to at least another partial sequence of the 3' end of the second oligonucleotide chain of the second probe to form a double-stranded region.

[0074] According to a specific embodiment of the present application, in the third mixing treatment, the first probe, the second probe, the third probe, cDNA1 and the protein to be tested are mixed, wherein at least a portion of the sequence at the 5' end of the third oligonucleotide chain of the third probe is complementary to at least another portion of the sequence at the 3' end of the second oligonucleotide chain of the second probe to form a double-stranded region, and at least a portion of the cDNA1 forms a double strand with the first complementary region of the first probe. During the mixing process, the first antibody can bind to the protein to be tested, and the second antibody can also bind to the protein to be tested. At this time, the first complementary region of the first probe is blocked by cDNA1 and cannot bind to the 12-complementary region of the second probe. At this time, the biotin group at the 3' end of the third probe is bound by magnetic beads to capture the first probe-protein to be tested-double-stranded complex, and the probe unbound to the protein can be removed by washing. cDNA2 is added to the mixture, and cDNA2 can complementarily bind to cDNA1, displacing cDNA1 from the first probe. At this time, the first probe can approach the partial duplex formed by the second and third probes. At the same time, the 3' end of the second oligonucleotide chain of the partial duplex still has a single-stranded region, i.e., the corresponding 12-complementary region. At this time, at least a portion of the sequence at the 3' end of the first oligonucleotide chain can complementarily pair with at least a portion of the sequence at the 3' end of the second oligonucleotide chain, thereby achieving complementary pairing between the first complementary region in the first oligonucleotide chain and the 12-complementary region of the second oligonucleotide chain. The first and third oligonucleotide chains are then connected to form a single oligonucleotide chain using a ligase.

[0075] According to an embodiment of the present application, the ligation process is performed under the action of a ligase.

[0076] According to an embodiment of the present application, the ligase is Taq DNA ligase.

[0077] According to an embodiment of the present application, the capture process is performed in the presence of streptavidin magnetic beads. The inventors discovered that the prior art suffers from excessively high background signals during protein detection. By using streptavidin magnetic beads for elution, the background signal is reduced.

[0078] According to a specific embodiment of the present application, when the first probe, the second probe and the protein to be tested are incubated, cDNA1 is added to bind to the first complementary region of the first probe, thereby preventing the binding of the first probe and the second probe, thereby reducing the hybridization of the first probe and the second probe that is independent of the formation of the protein to be tested; then, magnetic bead purification is performed to elute the probe that has not formed the first probe-antigen-second probe complex; then, cDNA2 is used to elute cDNA1 from the first complementary region, and the first probe and the second probe are connected, thereby reducing the "false positive" signal.

[0079] Additional aspects and advantages of the present application will be given in part in the following description and in part will become obvious from the following description or will be learned through practice of the invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0080] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the following description of the embodiments with reference to the accompanying drawings, in which:

[0081] FIG1 is a schematic diagram of a first oligonucleotide chain according to an embodiment of the present invention;

[0082] FIG2 is a schematic diagram of a second oligonucleotide chain according to an embodiment of the present invention;

[0083] FIG3 is a schematic diagram of a third oligonucleotide chain according to an embodiment of the present invention;

[0084] FIG4 is a schematic diagram of the connection of the first, second, and third oligonucleotide chains according to an embodiment of the present invention;

[0085] FIG5 is a schematic diagram of a flow chart of a protein detection scheme 1 according to an embodiment of the present invention;

[0086] FIG6 is a schematic diagram of a flow chart of a protein detection scheme 2 according to an embodiment of the present invention;

[0087] FIG7 is a schematic structural diagram of a protein detection scheme 1 according to an embodiment of the present invention;

[0088] FIG8 is a schematic structural diagram of a protein detection scheme 2 according to an embodiment of the present invention;

[0089] FIG9 is a schematic diagram of the library structure of protein detection scheme 1 according to an embodiment of the present invention;

[0090] FIG10 is a schematic diagram of the library structure of protein detection scheme 2 according to an embodiment of the present invention;

[0091] FIG11 is a diagram showing the detection results of VEGF (vascular endothelial growth factor) within a low concentration range according to an embodiment of the present invention;

[0092] FIG. 12 is a graph showing the detection results of VEGF (vascular endothelial growth factor) and CCL2 (chemokine ligand 2) within a high concentration range according to an embodiment of the present invention. DETAILED DESCRIPTION

[0093] The following describes embodiments of the present invention in detail, examples of which are shown in the accompanying drawings, wherein the same or similar reference numerals throughout represent the same or similar elements or elements having the same or similar functions. The embodiments described below with reference to the accompanying drawings are exemplary and are intended to be used to explain the present invention, and are not to be construed as limiting the present invention.

[0094] Definition and Description

[0095] As used herein, unless otherwise indicated, the singular forms "a," "an," and the like include plural referents (more than one); "a set" or "a plurality" refers to two or more.

[0096] In this document, unless otherwise specified, the terms "first", "second", "third", "fourth", etc. are used for descriptive purposes only and are not to be understood as indicating or implying relative importance or implicitly indicating the number of technical features indicated; features specified as "first", "second", etc. may explicitly or implicitly include one or more of the said features.

[0097] As used herein, unless otherwise indicated, nucleotides refer to the four natural nucleotides (e.g., dATP, dCTP, dGTP, and dTTP, or ATP, CTP, GTP, and UTP) or their derivatives, and are sometimes also directly represented by the bases they contain (A, T / U, C, and G). A person of ordinary skill in the art will be able to identify the reference to a nucleotide or base in a specific embodiment based on the context.

[0098] In this article, the so-called "sequencing" is sequence determination, which is the same as "nucleic acid sequencing" or "gene sequencing", referring to the determination of the base order in a nucleic acid sequence; it includes synthesis sequencing (sequencing by synthesis, SBS) and / or ligation sequencing (sequencing by ligation, SBL); it includes DNA sequencing and / or RNA sequencing; it includes long fragment sequencing and / or short fragment sequencing, and the so-called long fragments and short fragments are relative, such as nucleic acid molecules longer than 1Kb, 2Kb, 5Kb or 10Kb can be called long fragments, and those shorter than 1Kb or 800bp can be called short fragments; it includes double-end sequencing, single-end sequencing and / or paired-end sequencing, etc., and the so-called double-end sequencing or paired-end sequencing can refer to the reading of any two segments or two parts of the same nucleic acid molecule that do not completely overlap.

[0099] Unless otherwise specified in this article, the term "sequencing read" and the term "read" or "read segment" can be used interchangeably to refer to a nucleic acid sequence obtained during sequencing. This sequence is referred to as a "sequencing read segment" or "read" in this article.

[0100] In this article, the sequencing platforms that can be used to perform the above sequencing methods include but are not limited to the Hiseq / Miseq / Nextseq / Novaseq sequencing platforms of IllUMina, the Ion Torrent platform of Thermo Fisher / Life Technologies, the BGISEQ and MGISEQ / DNBSEQ platforms of BGI, and the single-molecule sequencing platform.

[0101] It should be noted that the proteins described in this application include antigens, polypeptides, etc.

[0102] It should be noted that the sequence display of each element described in this application is from 5' end to 3' end.

[0103] It should be noted that the connection mentioned in this application includes direct connection or indirect connection.

[0104] Existing technology

[0105] Proximity Extension Assay (PEA) technology uses paired antibodies to recognize and capture the protein being tested. Each antibody is coupled to a nucleic acid sequence encoding the corresponding protein, forming a pair of probes. These probes are then orthogonally extended, amplified, and sequenced to achieve signal amplification and readout. Combined with an NGS sequencing platform, this technology enables high-sensitivity, simultaneous detection of a large number of samples (96 samples) and a high throughput (384 marker combinations).

[0106] However, this technology currently has the following shortcomings in protein detection:

[0107] On the one hand, because the entire PEA detection process is carried out in liquid phase, there is no elution step for uncaptured antibodies. The forward encoding probe (probe F, coupled to the forward oligo) and the reverse encoding probe (probe R, coupled to the reverse oligo) coupled to the antibody, which carry protein-coding information, carry oligo fragments containing complementary sequences. In the liquid phase, probe F and probe R will produce a large number of orthogonal proteins that are independent of protein capture, thereby generating "false positive" signals.

[0108] On the other hand, due to different initial template concentrations, multiple PCR amplifications will produce nonlinear amplification, resulting in deviations, which cannot be effectively corrected by relying solely on the quality control system (amplification control and other amplification indicators).

[0109] Protein detection methods

[0110] In one aspect, this application proposes a protein detection method that reduces background signal intensity to improve protein detection sensitivity. This protein detection method utilizes streptavidin magnetic beads to elute antibody-protein-antibody complexes, removing complexes formed independently of proteins (including antigens). Furthermore, embodiments of this application improve protein detection accuracy by adding a UMI sequence to the third oligonucleotide chain to facilitate deduplication correction during subsequent library construction and sequencing.

[0111] According to an embodiment of the present application, there is provided:

[0112] The first probe comprises a first oligonucleotide chain and a first antibody, wherein the 5' end of the first oligonucleotide chain is connected to the first antibody, and the first antibody has an activity of binding to a predetermined protein.

[0113] According to an embodiment of the present application, the first oligonucleotide chain includes a forward primer binding region, a sequencing primer region, a first protein tag region, and a first complementary region.

[0114] According to an embodiment of the present application, the forward primer binding region includes an ad153-F element.

[0115] According to an embodiment of the present application, the sequencing primer region includes an Rd1SP element.

[0116] According to an embodiment of the present application, the first tag region of the protein includes an FBC element.

[0117] According to an embodiment of the present application, the first complementary region includes a Hyb element.

[0118] According to a specific embodiment of the present application, the first probe is connected from left to right as follows: the first antibody is connected to the 5' end of the Ad153-F element, the 3' end of the Ad153-F element is connected to the 5' end of the Rd1SP element, the 3' end of the Rd1SP element is connected to the 5' end of the FBC element, and the 3' end of the FBC element is connected to the 5' end of the Hyb element.

[0119] The second probe comprises a second oligonucleotide chain and a second antibody, the 5' end of the second oligonucleotide chain is connected to the second antibody, the second antibody has the activity of binding to the predetermined protein, and at least a partial sequence of the 3' end of the first oligonucleotide chain is suitable for complementary pairing with at least a partial sequence of the 3' end of the second oligonucleotide chain.

[0120] According to an embodiment of the present application, the second oligonucleotide chain includes a second complementary region, and the second complementary region includes a 12-complementary region and a 23-complementary region.

[0121] According to an embodiment of the present application, the 12 complementary regions include Hyb elements.

[0122] According to an embodiment of the present application, the 23 complementary region includes at least one of RRBC and RS2 elements.

[0123] According to a specific embodiment of the present application, the second probe is connected from left to right as follows: the 3' end of the Hyb element is modified with ddC, the 5' end of the Hyb element is connected to the 3' end of the RRBC element, the 5' end of the RRBC element is connected to the 3' end of the RS2 element, and the 5' end of the RS2 element is connected to the second antibody.

[0124] The third probe comprises a third oligonucleotide chain, wherein at least a portion of the 5' end sequence of the third oligonucleotide chain is complementary to a portion of the 3' end sequence of the second oligonucleotide chain.

[0125] According to a specific embodiment of the present application, the 3' end of the third oligonucleotide chain is connected to biotin.

[0126] According to an embodiment of the present application, the third oligonucleotide chain includes a third complementary region, a molecular tag (UMI), and a reverse primer binding region.

[0127] According to an embodiment of the present application, the third complementary region includes at least one of RBC and S2 elements.

[0128] According to an embodiment of the present application, the molecular tag (UMI) is a randomly synthesized oligonucleotide sequence with a length of 10-20 bases.

[0129] According to an embodiment of the present application, the reverse primer binding region includes a primer-1 element.

[0130] According to a specific embodiment of the present application, the third probe is connected from left to right in the following manner: the 3' end of the RBC element is connected to the 5' end of the UMI element, the 3' end of the UMI element is connected to the 5' end of the primer-1 element, and the 3' end of the primer-1 element is connected to biotin; or the 3' end of the RBC element is connected to the 5' end of the S2 element, the 3' end of the S2 element is connected to the 5' end of the UMI element, the 3' end of the UMI element is connected to the 5' end of the primer-1 element, and the 3' end of the primer-1 element is connected to biotin.

[0131] According to an embodiment of the present application, the method includes: using a probe composition to capture the protein to be tested, the first antibody and the second antibody have the activity of binding to the protein to be tested; and constructing a sequencing library based on the capture treatment product; sequencing the sequencing library to detect the protein to be tested.

[0132] According to an embodiment of the present application, cDNA1 (an oligonucleotide sequence complementary to a partial sequence of Probe F) can be complementary to the 3' end of the first probe to block the binding of the first probe and the second probe; the first probe-antigen-second probe complex is then captured using magnetic beads, and the first probe that is not bound to the antigen is washed away; cDNA2 (an oligonucleotide sequence partially complementary to cDNA1) is then added to competitively bind to cDNA1 and elute cDNA1 from the first probe; at this time, the first probe can bind to the second probe through the 3' end complementary region.

[0133] The technical solution of the present application is described in detail below with reference to the accompanying drawings.

[0134] Protein detection scheme 1, refer to Figures 5, 7 and 9,

[0135] Incubation, probe captures antigen (Figure 5, left): By incubating two probes (probe F, the first probe) and probe R (probe R, the second probe) with oligos (oligonucleotide chains) with the antigen, the specific antibodies carried on the probes capture the antigen and hybridize through the complementary region at the end of the oligos;

[0136] Hybridization, L oligo hybridizes with probe R (Figure 5): Then, L oligo (the third probe) is added to the incubation system. The 3' end of L oligo is modified with biotin and carries a 10-20 bp UMI barcode sequence. L oligo binds to a partial region of probe R oligo.

[0137] Ligation: connect the L oligo to probe F (Figure 5, right): Then add the ligation system to connect the L oligo to the oligo of probe F;

[0138] The ligated system was further purified using streptavidin magnetic beads to remove unligated probes. The purified product was then amplified by PCR to prepare a library (Figure 11) for on-machine testing. The signal intensity was used to reflect the protein concentration in the sample.

[0139] Protein detection scheme 2, referring to Figures 6, 8 and 10, according to an embodiment of the present application, the method includes:

[0140] When probe F (probe F, the first probe) and probe R (probe R, the second probe) are prepared, L oligo (the third probe) is first hybridized with probe R oligo, and the hybridized double strands are then coupled to the antibody;

[0141] Co-incubation of antibodies, antigens, and cDNA1 (Figure 6, left): Probe F, probe R, cDNA1, and antigens are incubated, and the specific antibodies carried on the probes capture the antigens (Figure 8, top);

[0142] Free probe F is washed away, and cDNA1 is washed away with cDNA2 (Figure 6, center). Simultaneously, a portion of cDNA1 binds to the first complementary region of probe F. The probe F-antigen-probe R complex is purified using magnetic beads, free probe F is washed away, and then cDNA2 competitively binds to cDNA1, eluting cDNA1 from probe F (Figure 8, center).

[0143] Ligation of L oligo and probe F (Figure 6 right): probe F hybridizes with a partial region of probe R, and ligase is added to the retention system to connect L oligo to the oligo of probe F (Figure 8 bottom).

[0144] The ligation system is further washed to remove impurities, and the purified product is tested by q-PCR. The signal intensity or expression level is used to reflect the concentration of the protein in the sample.

[0145] The following examples illustrate this application, but this should not be construed as limiting the scope of the subject matter of this application to the following examples. All technologies implemented based on the above content of this application fall within the scope of this application. The compounds or reagents used in the following examples are commercially available or prepared by conventional methods known to those skilled in the art; the experimental instruments used are commercially available.

[0146] Example 1

[0147] This embodiment corresponds to technical solution 1 of the present application.

[0148] 1. Take 20 μg of antibody (1 mg / mL) and add DBCO-PEG5-NHS at a molar ratio of 1:10. After reacting at room temperature for 3 hours, remove excess DBCO-PEG5-NHS using a Zeba spin column. Then, add F oligo at a ratio of antibody:oligo (oligonucleotide) = 1:3. Some oligo sequences are shown in Table 1.

[0149] Table 1: Oligo sequences

[0150] 2. Take 20 μg of antibody (1 mg / mL) and add DBCO-PEG5-NHS at a molar ratio of 1:10. After reacting at room temperature for 3 hours, remove the excess DBCO-PEG5-NHS using a zeba spin. Then add R oligo at a ratio of antibody:oligo = 1:3;

[0151] 3. Prepare sample mixes (samples 1-5) by diluting six proteins in different proportions to different concentration gradients (0-750 pg / ml) or (50 pg / mL-1000 pg / mL) using sample dilution buffer (0.1% BSA, PBS pH 7.2).

[0152] 4. Take 1 μL of diluted protein and add 1 μL of blocking buffer (0.3 mg / mL blocking reagent, 100 μg / mL ssDNA, 0.1% BSA, 4 mM EDTA, 0.2% Triton X-100, 0.02% sodium disulfide). Mix by pipetting 10 times and incubate at 25°C for 20 min.

[0153] 5. Take the forward probe (Probe F) and reverse probe (Probe R) corresponding to the six proteins and dilute them to 100 pM with probe dilution buffer (25 mM Tris-HCl pH 7.2, 5 mM EDTA, 1 mM biotin, 26 μg ssDNA, 0.01% sodium dihydrochloride). Take 2 μL of the diluted probe mix and add it to the corresponding sample.

[0154] 6. Mix by pipetting 20 times and incubate at 4°C for at least 16 hours;

[0155] 7. Add 46 μL of L ligation mix (1X HiFi Taq DNA ligase buffer), 1 μL of HiFi Taq DNA ligase (NEB, M0647S), and L oligo (435 nM, XXXXXXXXNNNNNNNNNNGCTTGGAGTCTCTAGTATCAGT, X-barcode; N-random sequence) corresponding to each probe to the incubation system and incubate at 45°C for 15 min.

[0156] 8. Take 5 μL of streptavidin magnetic beads, wash them three times with 1X BW (5 mM Tris-HCl, 0.5 mM EDTA, 1 M NaCl), resuspend them in 250 μL of 2X BW, and divide the magnetic bead suspension into 5 equal portions, 50 μL each;

[0157] 9. Add the ligated samples to streptavidin magnetic beads (Thermo, 11206D), incubate at room temperature for 15 min, wash twice with 1X BW, and resuspend in 50 μL TE buffer;

[0158] 10. Perform the first round of PCR on the magnetic beads. A 20 μL PCR system includes: 1X Thermopol reaction buffer (NEB B9004S), 0.25 μM primers (forward primer: Ad153_PCR2_1 5'P-GAACGACATGGCTACGA-3'; reverse primer: primer1 5'-ACTGATACTAGAGACTCCAAGC-3'), 250 μM dNTPs, 0.2 μL HotStart Taq (NEB M0495L), and 2 μL magnetic bead sample. The amplification program is as follows: pre-denaturation at 98°C for 3 min; denaturation at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 15 s, for 25 cycles; and extension at 72°C for 5 min.

[0159] 11. Perform the second round of PCR amplification in 20 μL of the following system: 1X Thermopol reaction buffer (NEB B9004S), 0.25 μM primers (forward primer: Ad153_PCR2_1 5'P-GAACGACATGGCTACGA-3'; reverse primer: Index primer 5'-TGTGAGCCAAGGAGTTGATCGCCAGACTGATACTAGAGACTCCAAGC-3'), 250 μM dNTPs, 0.2 μL HotStart Taq (NEB M0495L), and 2 μL of the first round PCR sample. The amplification program was as follows: initial denaturation at 98°C for 3 min; 10 cycles of denaturation at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 15 s; and extension at 72°C for 5 min.

[0160] 12. Prepare DNBs using the one-step DNB preparation kit (940-000034-00): add 30 μL of DNB preparation reaction solution 1 to 10 μL of DNA sample; denature at 95°C for 3 min, anneal at 57°C for 3 min, and maintain at 4°C; then add 22 μL of DNB preparation reaction solution 2 (DNB polymerase mixture I, DNB polymerase mixture II) to the reaction system, react at 30°C for 25 min, and maintain at 4°C; after determining the DNB concentration, sequence the DNA.

[0161] Figure 11 shows the results of VEGF165 detection at low (left) and high (right) concentrations. The results demonstrate a positive linear correlation between signal intensity and antigen concentration at both concentrations. The detection range for VEGF is at least 20 pg / mL to 800 pg / mL.

[0162] Example 2

[0163] This embodiment corresponds to technical solution 2 of this application.

[0164] 1. Take 20 μg of antibody (1 mg / mL) and add DBCO-PEG5-NHS at a molar ratio of 1:10. After reacting at room temperature for 3 hours, remove the excess DBCO-PEG5-NHS using a zeba spin. Then add F oligo at a ratio of antibody:oligo = 1:3; the partial oligos are shown in Table 2:

[0165] Table 2: Oligo sequences

[0166] 2. Take 20 μg (1 mg / mL) of antibody and add DBCO-PEG5-NHS at a molar ratio of 1:10. After reacting at room temperature for 3 hours, remove the excess DBCO-PEG5-NHS using a zeba spin. Mix L oligo and probe R oligo in TE at an equal molar ratio, incubate at 95°C for 3 minutes, and slowly cool to 25°C at a rate of 0.5°C / s. Then add annealed double-stranded oligo at a ratio of antibody:oligo = 1:3.

[0167] 3. Protein samples were diluted to different concentrations (0-500 pg / mL) with sample dilution buffer (0.1% BSA, PBS pH 7.2);

[0168] 4. Take 1 μL of the diluted sample and add 1 μL of blocking buffer (0.3 mg / mL blocking reagent, 100 μg / mL ssDNA, 0.1% BSA, 4 mM EDTA, 0.2% Triton X-100, 0.02% sodiμM azide), incubate at 25°C for 20 min, then add 2 μL of probe mix (25 mM Tris-HCl pH 7.2, 5 mM EDTA, 1 mM biotin, 26 μg ssDNA, 0.01% sodiμM azide, 100 pM probe F, 100 pM probe R, 1 nM cDNA1), and incubate at 4°C for at least 16 h;

[0169] 5. Take 5 μL of streptavidin magnetic beads, wash them three times with 1X BW (5 mM Tris-HCl, 0.5 mM EDTA, 1 M NaCl), resuspend them in 250 μL of 2X BW, and divide the magnetic bead suspension into 5 equal parts, 50 μL each;

[0170] 6. Add the incubated sample to streptavidin magnetic beads (Thermo, 11206D), incubate at room temperature for 15 minutes, and wash three times with 1X BW;

[0171] 7. Add 20 μL cDNA2 solution (1XTE, 10 nM cDNA2) to the incubation system and incubate at 4°C for 30 min;

[0172] 8. Wash the magnetic beads once with 1X BW, add 20 μL cDNA2 solution (1XTE, 10 nM cDNA2), and incubate at 4°C for 30 min;

[0173] 9. Wash the magnetic beads 3 times with 1XBW;

[0174] 10. Add ligation mix: 1X HiFi Taq DNA ligase buffer, 1 μL HiFi Taq DNA ligase (NEB, M0647S), and incubate at 45°C for 15 min.

[0175] 11. Wash once with 1X BW and resuspend in 20 μL TE buffer;

[0176] 12. The ligated samples were subjected to two-step q-PCR detection (95°C pre-denaturation for 30 s; 95°C denaturation for 5 s, 60°C annealing and extension for 30 s, 40 cycles). 20 μL q-PCR system included: 1X TB Green Premix Ex Taq II (TAKARA RR82WR), 0.4 μM primers (forward primer: q-PCR-F GCTCACAGAACGACATGGCTA, reverse primer: q-PCR-R ACTGATACTAGAGACTCCAAGC), and 2 μL ligated sample.

[0177] 13. The detection results of VEGF and CCL2 are shown in Figure 12. The results show that the signal intensity is positively correlated with the antigen concentration, and the detection range can reach at least 5pg / mL-500pg / mL (VEGF) and 10pg / mL-500pg / mL (CCL2).

[0178] Furthermore, the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of the technical features being referred to. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one such feature. In the description of the present invention, "plurality" means at least two, such as two, three, etc., unless otherwise specifically defined.

[0179] In the description of this specification, the reference terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" mean that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine different embodiments or examples described in this specification and features of different embodiments or examples without contradiction.

[0180] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.

Claims

1. A probe composition, characterized in that include: A first probe, wherein the first probe comprises a first oligonucleotide chain and a first antibody, wherein the 5' end of the first oligonucleotide chain is connected to the first antibody, and the first antibody has an activity of binding to a predetermined protein; A second probe, wherein the second probe comprises a second oligonucleotide chain and a second antibody, wherein the 5' end of the second oligonucleotide chain is connected to the second antibody, the second antibody has an activity of binding to the predetermined protein, and at least a portion of the sequence at the 3' end of the first oligonucleotide chain is suitable for reverse complementary pairing with at least a portion of the sequence at the 3' end of the second oligonucleotide chain; The third probe comprises a third oligonucleotide chain, wherein at least a partial sequence at the 5' end of the third oligonucleotide chain is complementary to a partial sequence at the 3' end of the second oligonucleotide chain.

2. The probe composition according to claim 1, characterized in that The 3' end of the third oligonucleotide chain is connected with an affinity tag.

3. The probe composition according to claim 2, characterized in that The affinity marker is selected from at least one of antibodies, biotin, magnetic beads and gel beads.

4. The probe composition according to claim 1, characterized in that The first antibody has an activity of binding to a first position of a predetermined protein, and the second antibody has an activity of binding to a second position of the predetermined protein, wherein the first position is different from the second position.

5. The probe composition according to claim 1, characterized in that The 3' end of the first oligonucleotide chain is reversely complementary to at least a portion of the sequence of the 3' end of the second oligonucleotide chain, and the length of the complementary pair is 8 to 12 bp.

6. The probe composition according to claim 1, characterized in that The first oligonucleotide chain includes a forward primer binding region, an arbitrary read region, a first protein tag region, and a first complementary region.

7. The probe composition according to claim 6, characterized in that The arbitrary read region includes a sequencing primer region.

8. The probe composition according to claim 1, characterized in that The second oligonucleotide chain includes a second complementary region, and the second complementary region includes a 12-complementary region and a 23-complementary region.

9. The probe composition according to claim 8, characterized in that The 12 complementary region is reverse complementary to the first complementary region.

10. The probe composition according to claim 1, characterized in that The third oligonucleotide chain includes a third complementary region, a molecular tag and a reverse primer binding region.

11. The probe composition according to claim 10, characterized in that The molecular tags are random sequences.

12. The probe composition according to claim 10, characterized in that The length of the molecular tag is 10 to 20 bases.

13. The probe composition according to claims 6 to 12, characterized in that: The first complementary region is suitable for complementary pairing with the 12-complementary region of the second complementary region, and the third complementary region is suitable for complementary pairing with the 23-complementary region of the second complementary region.

14. A kit, characterized in that: The method comprises the probe composition according to any one of claims 1 to 13 and a ligase.

15. The kit according to claim 14, characterized in that The method further comprises at least one of a primer, a DNA polymerase, a buffer solution and dNTPs.

16. A method for detecting a protein, characterized in that: include: Mixing the first probe, the second probe and the third probe with the protein to be detected to obtain a sequencing library; Sequencing the sequencing library to detect the protein to be tested; in, The first probe comprises a first oligonucleotide chain and a first antibody, wherein the 5' end of the first oligonucleotide chain is connected to the first antibody, and the first antibody has the activity of binding to a predetermined protein; The second probe comprises a second oligonucleotide chain and a second antibody, the 5' end of the second oligonucleotide chain is connected to the second antibody, the second antibody has the activity of binding to the predetermined protein, and at least a part of the sequence at the 3' end of the first oligonucleotide chain is suitable for reverse complementary pairing with at least a part of the sequence at the 3' end of the second oligonucleotide chain; The third probe comprises a third oligonucleotide chain, and at least a partial sequence at the 5' end of the third oligonucleotide chain is complementary to a partial sequence at the 3' end of the second oligonucleotide chain.

17. The method according to claim 16, characterized in that Further including: The ligation process is used to generate a nucleic acid sequence including the first probe and the third probe sequences.

18. The method according to claim 16, characterized in that Further including: The extension process and the ligation process are used to generate a nucleic acid sequence including the first probe and the third probe sequences.

19. The method according to claim 16, characterized in that The 3' end of the third oligonucleotide chain is connected with an affinity tag, and the affinity tag is selected from at least one of antibodies, biotin, magnetic beads and gel beads.

20. The method according to claim 17, characterized in that The connection process further comprises at least one of the following steps: a. amplifying the ligation product using primers; b. Capture the ligation product using an affinity tag.

21. The method according to claim 16, characterized in that The mixing process is carried out in the following manner: Performing a first mixing process on the first probe, the second probe and the protein to be detected; and The product of the first mixing process is subjected to a second mixing process with the third probe.

22. The method according to claim 16, characterized in that The mixing process is carried out in the following manner: The first probe, the second probe, the third probe and the protein to be detected are mixed. The 5' terminal partial sequence of the third oligonucleotide chain of the third probe is complementary to at least another partial sequence of the 3' terminal of the second oligonucleotide chain of the second probe to form a double-stranded region.

23. The method according to claim 17, characterized in that The ligation process is performed under the action of a ligase.

24. The method according to claim 23, characterized in that The ligase is Taq DNA ligase.

25. The method according to claim 20, characterized in that The capture process is performed in the presence of streptavidin magnetic beads.