Targeting vector for targeting goat Rosa26 gene and application thereof

Abstract

The invention provides a targeting vector for specifically targeting a goat Rosa26 gene, a cell line for site-specific integration of an exogenous gene and a construction method of the cell line. By adopting the targeting vector disclosed by the invention, the melatonin synthetase gene and other functional genes are integrated at the Rosa26 site in a fixed-point manner, so that the specific traits of goats can be improved.

Description

Technical Field

[0001] This disclosure belongs to the field of molecular biology technology, specifically relating to targeted goats. Rosa26 Gene targeting vectors and their applications. Background Technology

[0002] Melatonin has a wide range of synthetic pathways, and it can be synthesized by animals, plants, and microorganisms. In vertebrates, melatonin is mainly synthesized by the pineal gland and released directly into the circulatory system via the bloodstream. It is a pleiotropic amine hormone widely distributed in nature and in both plants and animals. Recent studies have found that while the pineal gland is the primary synthesizer, other tissues, organs, and cells can also synthesize melatonin. Melatonin synthesis is synchronized with photoperiod for 24 hours. Melatonin synthesis and secretion vary with the diurnal rhythm and are strictly regulated. Compared to daytime, melatonin synthesis and metabolic activity are higher at night, with serum melatonin levels reaching their peak in the early morning. As a hormone secreted by the pineal gland, melatonin plays a crucial regulatory role in the reproductive system while regulating the diurnal rhythm. It primarily affects the secretion of gonadotropins (GnRH, LH, FSH) through the hypothalamic-pituitary-gonadal axis (HPG axis), thereby indirectly regulating ovarian and testicular function. In the ovary, melatonin exhibits significant antioxidant and anti-apoptotic effects, reducing oxidative stress damage to oocytes, improving follicle development quality, promoting corpus luteum function, and regulating estrogen secretion levels. In the testes, melatonin protects sperm from oxidative stress by regulating hormone secretion from interstitial cells, thereby improving sperm motility and quality. Furthermore, melatonin demonstrates unique roles in seasonally reproducing animals, with its secretion levels closely related to the photocycle, playing a crucial role in initiating or inhibiting reproductive activity in different seasons. The role of melatonin in reproductive-related diseases has also received widespread attention. For example, in polycystic ovary syndrome (PCOS), its antioxidant properties help improve the ovarian microenvironment and follicle development; in the treatment of male infertility, it improves semen quality by reducing sperm oxidative damage. Assisted reproductive technology (ART) studies have found that appropriate melatonin supplementation during in vitro fertilization (IVF) can significantly improve oocyte quality, embryo developmental potential, and implantation success rate.

[0003] However, light pollution and sleep disorders in modern society significantly suppress the endogenous secretion of melatonin, potentially leading to reproductive dysfunction. This provides new directions for further research into the mechanism of melatonin's role in reproductive health, including exploring its regulation of mitochondrial function and cellular metabolism, as well as developing melatonin-based reproductive intervention strategies. In summary, melatonin demonstrates its multifunctionality in reproductive regulation and offers new insights and potential applications for reproductive medicine and the treatment of related diseases.

[0004] Therefore, developing cell lines that can highly express melatonin is of great significance for further exploring the related physiological functions of melatonin. Summary of the Invention

[0005] This disclosure provides a highly efficient and specific targeting goat. Rosa26 Gene targeting vectors, cell lines for site-specific integration of exogenous genes, and methods for their construction. This disclosure can be used for breeding new dairy goat breeds, for example, through... Rosa26 Site-specific integration of melatonin gene expression into cell lines can enhance the economic value of dairy goats. Melatonin possesses multiple biological functions, including immunomodulation, anti-inflammation, and anti-apoptosis. Developing cell lines with site-specific integration of melatonin gene expression can provide new ideas and methods for gene therapy of goat diseases, thereby improving the health of goats.

[0006] To achieve the above objectives, this disclosure provides the following technical solutions: The first aspect of this disclosure provides a composition comprising a guide RNA or DNA encoding a guide RNA, wherein the guide RNA comprises a DNA targeting segment that targets a guide RNA target sequence at a genomic safe harbor locus and a protein binding segment that binds to a Cas protein, wherein the guide RNA target sequence is located at coordinates chr22:17032029-17032052 on goat chromosome 22, or comprises the sequence shown in SEQ ID NO:6.

[0007] In some embodiments, the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO:8.

[0008] In some embodiments, the composition comprises the DNA encoding the guide RNA.

[0009] In some embodiments, the DNA encoding the guide RNA is contained in a nucleic acid vector.

[0010] In some embodiments, the composition comprises the guide RNA in the form of RNA.

[0011] In some embodiments, the guide RNA is a single guide RNA (sgRNA).

[0012] In some embodiments, the composition further comprises the Cas protein or nucleic acid encoding the Cas protein.

[0013] In some embodiments, the Cas protein is the Cas9 protein. In some embodiments, the Cas9 protein is derived from Streptococcus pyogenes Cas9 protein, Staphylococcus aureus Cas9 protein, Campylobacter jejuni Cas9 protein, Streptococcus thermophilus Cas9 protein, or Neisseria meningitidis Cas9 protein.

[0014] In some embodiments, the nucleic acid encoding the Cas protein is codon-optimized for expression in mammalian or human cells. In some embodiments, the nucleic acid encoding the Cas protein comprises DNA or mRNA encoding the Cas protein.

[0015] In some embodiments, the composition further comprises a nucleic acid construct containing a nucleic acid operatively linked to a promoter, wherein the nucleic acid is selected from reporter genes and / or functional genes.

[0016] In some embodiments, the reporter gene includes one or more of the following: fluorescent protein gene, chloramphenicol acetyltransferase (CAT) gene, β-galactosidase gene, dihydrofolate reductase gene, luciferase gene, and alkaline phosphatase gene.

[0017] In some embodiments, the functional gene includes one or more of the following: melatonin synthase gene, growth rate-related gene, meat quality-related gene, or disease resistance-related gene.

[0018] In some embodiments, the functional genes include the melatonin synthase AANAT and ASMT genes.

[0019] In some embodiments, the nucleic acid construct does not contain homologous arms. In some embodiments, the nucleic acid construct is inserted into a target genomic locus via non-homologous end joining. In some embodiments, the nucleic acid construct contains homologous arms. In some embodiments, the nucleic acid construct is inserted into a target genomic locus via homology-directed repair. In some embodiments, the nucleic acid construct is single-stranded DNA or double-stranded DNA.

[0020] In some embodiments, the homologous arm comprises the sequences shown in SEQ ID NO:13 and SEQ ID NO:14.

[0021] In some embodiments, the nucleic acid construct is contained in a nucleic acid carrier or lipid nanoparticles.

[0022] The second aspect of this disclosure provides a goat Rosa26 A 26-gene targeting vector, the targeting vector being formulated for goats Rosa26The sgRNA sequence designed from the targeting site sequence of 26 genes and the backbone vector constitute the structure, wherein the targeting site has the nucleotide sequence shown in SEQ ID NO: 6.

[0023] In some embodiments, the sgRNA sequence includes the following sequence: AGGCGATGACGAGATCGCGG (SEQ ID NO: 8).

[0024] This disclosure provides, in a third aspect, the composition described in the first aspect or the goat described in the second aspect. Rosa26 26-gene targeting vectors specifically recognize and / or target goats Rosa26 Genes, goats Rosa26 Site-specific integration of exogenous genes into genes, preparation Rosa26 Cell lines for targeted integration of exogenous genes, preparation of transgenic goats, goat breeding, preparation Rosa26 Applications of gene function research in cell or animal models.

[0025] A fourth aspect of this disclosure provides a method for inserting a foreign gene into a safe harbor locus in vivo or in vitro, the method comprising introducing the following into the animal or cell: (a) a nuclease reagent targeting a target site in the safe harbor locus or one or more nucleic acids encoding the nuclease reagent; and (b) a foreign donor nucleic acid comprising the foreign gene sequence. The nuclease reagent cleaves the target site, and the exogenous gene sequence is inserted into the safe harbor locus to produce a modified safe harbor locus. The target site is located on goat chromosome 22 at coordinates chr22:17032029-17032052, or contains the sequence shown in SEQ ID NO:6.

[0026] In some embodiments, the nuclease reagent comprises: (a) Zinc finger nuclease (ZFN); (b) Transcription activator-like effector nucleases (TALENs); or (c)(i) a Cas protein or a nucleic acid encoding the Cas protein; and (ii) a guide RNA or one or more DNA sequences encoding the guide RNA, wherein the guide RNA comprises a DNA targeting segment that targets a guide RNA target sequence, and wherein the guide RNA binds to the Cas protein and targets the Cas protein to the guide RNA target sequence.

[0027] In some embodiments, the Cas protein is the Cas9 protein. In some embodiments, the Cas9 protein is derived from *Streptococcus pyogenes* Cas9 protein, *Staphylococcus aureus* Cas9 protein, *Campylobacter jejuni* Cas9 protein, *Streptococcus thermophilus* Cas9 protein, or *Neisseria meningitidis* Cas9 protein. In some embodiments, the nucleic acid encoding the Cas protein is codon-optimized for expression in mammalian or human cells. In some embodiments, the nucleic acid encoding the Cas protein comprises DNA or mRNA encoding the Cas protein.

[0028] In some embodiments, the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO:8.

[0029] In some embodiments, the exogenous gene is selected from reporter genes and / or functional genes.

[0030] In some embodiments, the reporter gene includes one or more of the following: fluorescent protein gene, chloramphenicol acetyltransferase (CAT) gene, β-galactosidase gene, dihydrofolate reductase gene, luciferase gene, and alkaline phosphatase gene.

[0031] In some embodiments, the functional gene includes one or more of the following: melatonin synthase gene, growth rate-related gene, meat quality-related gene, or disease resistance-related gene.

[0032] In some embodiments, the functional genes include the melatonin synthase AANAT and ASMT genes.

[0033] In some embodiments, the exogenous donor nucleic acid does not contain homologous arms. In some embodiments, the nucleic acid construct is inserted into the target genomic locus via non-homologous end joining. In some embodiments, the exogenous donor nucleic acid contains homologous arms. In some embodiments, the nucleic acid construct is inserted into the target genomic locus via homology-directed repair.

[0034] In some embodiments, the animal includes a goat. In some embodiments, the cells are goat somatic cells and / or goat zygotes. In some embodiments, the cells are goat fetal fibroblasts. In some embodiments, the goat includes a dairy goat.

[0035] The fifth aspect of this disclosure provides animals or cells obtained by the methods described in the fourth aspect of this disclosure.

[0036] The sixth aspect of this disclosure provides a method for constructing a cell line that integrates a foreign gene at a specific site, the method comprising: using CRISPR / Cas9 gene editing technology to integrate a foreign gene at a specific site into recipient cells. Rosa26 The 26 gene targeting sites have the nucleotide sequence shown in SEQ ID NO: 6.

[0037] In some embodiments, the method includes the following steps: (1) The sgRNA determined according to the target site is linked to the backbone vector to construct the sgRNA target vector; (2) Construct a donor plasmid containing a foreign gene and homologous arms for homologous recombination at both ends of the target site; (3) The sgRNA expression vector and the donor plasmid are co-transfected into recipient cells.

[0038] In some embodiments, the sgRNA sequence includes the following sequence: AGGCGATGACGAGATCGCGG (SEQ ID NO: 8).

[0039] In some embodiments, the exogenous gene includes a reporter gene and / or a functional gene.

[0040] In some embodiments, the reporter gene includes one or more of the following: fluorescent protein gene, chloramphenicol acetyltransferase (CAT) gene, β-galactosidase gene, dihydrofolate reductase gene, luciferase gene, and alkaline phosphatase gene.

[0041] In some embodiments, the functional gene includes one or more of the following: melatonin synthase gene, growth rate-related gene, meat quality-related gene, or disease resistance-related gene.

[0042] In some embodiments, the functional genes include the melatonin synthase AANAT and ASMT genes.

[0043] In some embodiments, the recipient cells are goat somatic cells and / or goat zygotes.

[0044] In some embodiments, the recipient cells are goat fetal fibroblasts.

[0045] In some embodiments, the goat includes a dairy goat.

[0046] The seventh aspect of this disclosure provides a cell line for site-directed integration of exogenous genes obtained by the construction method described in the sixth aspect.

[0047] In some embodiments, the cell line is knocked out Rosa26The gene integrates the melatonin synthase AANAT and ASMT genes.

[0048] In some embodiments, the cell line is a goat cell line that expresses melatonin at a high level compared to wild-type goat cell lines.

[0049] This disclosure provides, in its eighth aspect, the method described in the fourth aspect, or the animal or cell described in the fifth aspect, or the construction method described in the sixth aspect, or the cell line described in the seventh aspect, in the preparation of… Rosa26 Applications in gene function research using cell or animal models, in the preparation of transgenic goats, or in goat breeding.

[0050] In some embodiments, the cell line is used to regulate the reproductive cycle of goats, improve goat reproductive efficiency and lambing rate, prolong the active period of goat mammary glands, enhance goat stress resistance, or enhance goat disease resistance.

[0051] In some embodiments, the goat includes a dairy goat.

[0052] The compositions disclosed herein enable efficient insertion of exogenous genes into the goat genome, ensuring safe and stable expression. For example, when the exogenous gene is a melatonin synthase gene, cell lines producing high levels of melatonin can be obtained. By increasing melatonin expression, the reproductive cycle of dairy goats can be effectively regulated, improving reproductive efficiency and lambing rate, prolonging the active period of mammary glands, thereby increasing milk yield and improving dairy product quality. Simultaneously, this method enhances the stress resistance and disease immunity of dairy goats, reduces disease incidence and production losses during the breeding process, helps reduce antibiotic use, and protects the ecological environment.

[0053] The compositions provided in this disclosure can be used to breed high-quality new dairy goat breeds, improve the level of germplasm resources, meet the market demand for high-quality dairy products, especially to develop value-added melatonin-functional dairy products, and promote the dairy goat industry to develop in a high-efficiency and sustainable direction.

[0054] The compositions provided in this disclosure can be used to improve specific traits of goats. For example, by integrating genes related to growth rate, meat quality, or disease resistance, goat breeds with superior traits can be developed, thereby improving farming efficiency. Attached Figure Description

[0055] Figure 1 It shows the results of cattle, mice, pigs, and sheep. Rosa26 Results of gene sequence comparison.

[0056] Figure 2 Showing goat's Rosa26 A diagram illustrating the gene sequence.

[0057] Figure 3 Showing Rosa26 Electrophoresis diagrams of various tissues in goats.

[0058] Figure 4 Showing Figure 3 of Rosa26 Quantitative statistical results of expression levels in various tissues of goats.

[0059] Figure 5 The designs of four sgRNAs are shown.

[0060] Figure 6 Enzyme digestion experiments of four sgRNAs are shown.

[0061] Figure 7 The cleavage efficiency of four sgRNAs is compared.

[0062] Figure 8 Light microscopy and fluorescence images show the successful editing of goat fetal fibroblasts using a targeting plasmid constructed based on R2 sgRNA.

[0063] Figure 9 A schematic diagram of plasmids overexpressing melatonin synthases AANAT and ASMT is shown.

[0064] Figure 10 The sequencing results of positive monoclonal cells are shown.

[0065] Figure 11 The results of AANAT and ASMT RT-qPCR detection are shown, with the left figure showing the AANAT results and the right figure showing the ASMT results. The vertical axis represents the relative expression level.

[0066] Figure 12 The results of AANAT and ASMT WB detection are displayed.

[0067] Figure 13 The results of the melatonin content test are displayed. Detailed Implementation

[0068] Gene safe harbors (GSHs) are sites where foreign genes can be safely and stably inserted and expressed. This concept has become increasingly important in the era of rapid advancements in gene editing technology, especially with the widespread application of technologies such as CRISPR / Cas9. This ensures that foreign genes do not undergo random loss or unstable mutations in the genome, providing a reliable gene expression platform for research. Gene safe harbors are typically located in regions that can regulate gene expression. This ensures that foreign genes are regulated by normal endogenous genes to maintain appropriate expression levels and do not negatively impact normal cellular function. Furthermore, the selection of gene safe harbors also considers minimal impact on cells. This means that the insertion of foreign genes should cause as little interference as possible with the normal physiological processes of the host cell.

[0069] Another key feature of gene safe harbors is their ease of editing, allowing researchers to modify them using gene-editing technologies such as CRISPR / Cas9 to better suit their research needs. Gene safe harbors suitable for basic research in human gene therapy, such as AAV, CCR5, and H11, have also been found to be applicable in animals like pigs, cattle, and rabbits. Through gene safe harbors, researchers can more precisely control the integration and expression of exogenous genes, providing reliable support for scientific research and innovation. The continued development of this field will shape the future application of gene-editing technologies and the direction of gene transfer research.

[0070] Goats were the first genetically modified animals approved for production. Initial methods for producing transgenic goats often involved pronuclear microinjection, where DNA fragments were injected into the embryo at the fertilized egg stage. However, this method was inefficient and often led to disappointing results, primarily due to unpredictable transgene expression caused by random integration, which did not conform to expectations.

[0071] With the emergence of new methods such as the Transposons system, lentivirus-mediated transgenesis, zinc finger nucleases, and the CRISPR / Cas system, the CRISPR / Cas9 genome editing tool has received increasing attention. Unlike ZFN and TALEN, the CRISPR / Cas9 endonuclease is not physically limited by DNA recognition function, thus simultaneously delivering multiple single guide RNAs actually provides untapped multiplex editing opportunities. Current research has used CRISPR / Cas9 to knock out monoallelic and bialelic genes in goat fetal fibroblasts. By disrupting four genes in goat cells and using them for somatic cell nuclear transfer (SCNT), gene-edited goats carrying bialelic mutations were successfully produced.

[0072] However, there is currently relatively little research into gene safe harbors related to goats, which severely limits the production of gene-edited goats. In this disclosure, rapid cDNA end cloning (RACE) was used to obtain goat genes. Rosa26 The full-length cDNA of the gene was disclosed. A donor vector containing F2A-EGFP was constructed by precisely screening the first intron sequence of the gene for target sites. The exogenous F2A-EGFP fragment was successfully and efficiently integrated into the goat genome using CRISPR / Cas9-mediated homology-directed repair (HDR). This disclosure reveals a gene safe harbor for the efficient expression of exogenous genes in the goat genome, providing a stable editing site for the future production of gene-edited goats.

[0073] This disclosure provides specific targeting sites for safe sites in dairy goats. Rosa26 By utilizing sgRNA and CRISPR / Cas9 to perform site-specific knockout and integration of melatonin synthase genes AANAT and ASMT, a cell line capable of high melatonin expression was successfully constructed.

[0074] This disclosure first utilizes bioinformatics methods to predict Rosa26 The complete sequence of the site was obtained, and four sgRNAs were designed targeting this site. A targeting vector based on the CRISPR / Cas9 system was constructed, and the guiding efficiency of the sgRNAs was validated. The sgRNA with the highest editing efficiency was selected. The sgRNAs and homologous integration vectors were co-transfected into dairy goat fetal fibroblasts, yielding... Rosa26 Cell lines that integrate AANAT and ASMT genes at specific sites.

[0075] This disclosure describes sgRNA-specific guidance of Cas9 pairs. Rosa26 The site-specific cleavage efficiency reached approximately 69.1%, effectively reducing off-target effects inherent in the CRISPR / Cas9 system and minimizing mutations in non-target gene sequences caused by non-specific cleavage. Adding exogenous serotonin (5HT) to the obtained positive cell lines revealed that these cell lines highly expressed melatonin. The Cas9 / gRNA expression vector can achieve expression at the cellular, embryonic, and even individual levels. Rosa26 The specific knockout or knock-in of a site allows for the study of the expression of specific genes, providing technical support for subsequent research on the physiological effects of melatonin and the breeding of new goat breeds with high melatonin levels.

[0076] To make the objectives, technical solutions, and advantages of this disclosure clearer, the following detailed description is provided in conjunction with the accompanying drawings and embodiments. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the scope of this disclosure in any way. Furthermore, descriptions of well-known structures and techniques are omitted in the following description to avoid unnecessarily obscuring the concepts of this disclosure. Such structures and techniques have also been described in numerous publications.

[0077] the term The terms “protein,” “polypeptide,” and “peptide,” used interchangeably herein, encompass amino acids of any length in polymeric form, including coding and non-coding amino acids, as well as amino acids modified or derived chemically or biochemically. These terms also include modified polymers, such as polypeptides having a modified peptide backbone. The term “domain” refers to any portion of a protein or polypeptide that has a specific function or structure.

[0078] As used herein, the term "exogenous" molecules or sequences include molecules or sequences that are not normally present in cells in the form described. Normal presence includes presence with respect to a specific developmental stage of the cell and environmental conditions. For example, exogenous molecules or sequences may include mutant forms of corresponding endogenous sequences within the cell (such as humanized forms of endogenous sequences), or sequences that correspond to endogenous sequences within the cell but are different in form (i.e., not within chromosomes). In contrast, endogenous molecules or sequences include molecules or sequences that are normally present in a specific cell in the form described under specific environmental conditions, at a specific developmental stage.

[0079] The term “codon optimization” (i.e., “codon-optimized” sequence) as used herein utilizes the degeneracy of codons, as demonstrated by the diversity of codon combinations for a given amino acid tribase pair, and generally involves modifying a nucleic acid sequence to enhance expression in a specific host cell by replacing at least one codon of the natural sequence with a codon that is more frequently or most frequently used in the host cell’s gene while maintaining the natural amino acid sequence. For example, a nucleic acid encoding a polypeptide of interest can be modified to replace a codon that has a higher frequency of use in a given prokaryotic or eukaryotic cell, including bacterial cells, yeast cells, human cells, non-human cells, mammalian cells, rodent cells, mouse cells, rat cells, hamster cells, or any other host cell, compared to the naturally occurring nucleic acid sequence. Codon usage tables are readily available, for example, at “Codon Usage Databases”. These tables can be modified in various ways. See Nakamura et al., (2000) Nucleic Acids Res. 28(1):292, the full text of which is incorporated herein by reference for all purposes. Computer algorithms for codon optimization of specific sequences expressed in a particular host are also available (see, for example, Gene Forge).

[0080] As used in this article, the term "locus" refers to a specific location of a gene (or significant sequence), DNA sequence, polypeptide coding sequence, or its position on a chromosome within an organism's genome. For example, " Rosa26 "Locus" can refer to Rosa26 Gene, Rosa26 Specific location of DNA sequence or Rosa26 Location on chromosomes of an organism's genome, where such sequences are identified as the locations where they reside. Rosa26 "Locus" may include Rosa26 Regulatory elements of a gene include, for example, enhancers, promoters, 5' and / or 3' untranslated regions (UTRs), or combinations thereof.

[0081] As used herein, the term "gene" refers to a DNA sequence in a chromosome that, if naturally present, may contain at least one coding region and at least one non-coding region. The DNA sequence of a chromosome encoding a product (e.g., but not limited to RNA products and / or polypeptide products) may contain a coding region interrupted by non-coding introns and a sequence located adjacent to the coding region at both the 5' and 3' ends such that the gene corresponds to a full-length mRNA sequence (containing the 5' and 3' untranslated sequences). Additionally, other non-coding sequences, including regulatory sequences (e.g., but not limited to promoters, enhancers, and transcription factor binding sites), polyadenylation signals, internal ribosome entry sites, silencers, insulating sequences, and matrix attachment regions, may be present in a gene. These sequences may be located near the coding region of the gene (e.g., but not limited to within 10 kb) or at distant sites, and these sequences may influence the level or rate of transcription and translation of the gene.

[0082] As used herein, the term "operable link" or "operably linked" includes juxtaposing two or more components (e.g., a promoter and another sequence element) such that both components function normally and allow at least one component to mediate a function imposed on at least one other component. For example, a promoter can be operably linked to a coding sequence if it controls the transcriptional level of a coding sequence in response to the presence or absence of one or more transcriptional regulatory factors. Operable links may include sequences that are adjacent to each other or act in a trans-regulatory manner (e.g., regulatory sequences may act at a distance to control the transcription of a coding sequence).

[0083] Compositions or methods that "comprise" or "contain" one or more of the listed elements in this document may include other elements not specifically listed. For example, a composition "comprises" or "contains" a protein may contain a protein alone or in combination with other ingredients. The transitional phrase "consistently of..." means that the scope of the claims should be interpreted to cover the specified elements listed in the claims as well as those elements that do not substantially affect the essential and novel characteristics of the claimed invention. Therefore, when used in the claims of this disclosure, the term "consistently of..." should not be construed as equivalent to "comprises".

[0084] A sequence of at least 17 nucleotides in a 20-nucleotide sequence is understood to include 17, 18, 19, or 20 nucleotides in the provided sequence, thus providing an upper limit, even if no upper limit is explicitly provided as would be clearly understood. Similarly, a sequence of at most 3 nucleotides will be understood to cover 0, 1, 2, or 3 nucleotides, thus providing a lower limit, even if no lower limit is explicitly provided. When “at least,” “at most,” or other similar language modifies a number, it can be understood to modify each number in the series.

[0085] In this document, “and / or” means and covers any and all possible combinations of one or more of the listed items, as well as the absence of combinations when interpreted in the alternative (“or”) context.

[0086] Unless the context clearly indicates otherwise, the singular forms “an,” “a,” and “the” used herein include plural referents. For example, the terms “protein” or “at least one protein” can include multiple proteins, including mixtures thereof.

[0087] Sequence information The sequence information involved in the embodiments of this disclosure is shown in Table 1: Table 1: Sequence Information

[0088] Example 1 name: Rosa26 Locus; Location: Chr22 (17030817~17033107).

[0089] The cow ( Bovine (See Wang M, et al., Sci Rep. 2018 Jul 10;8(1):10385.), mice ( Mouse (GenBank: NC 000072.7), Pig ( Pig (See Yang D, et al., Sci Rep. 2016 Apr27;6:25161.), sheep ( Sheep (See Wu M, et al., Sci Rep. 2016 Apr 11;6:24360) Four species Rosa26 Gene sequences are obtained and sequence alignment is performed to identify conserved sequences.

[0090] Specific primers were designed based on conserved sequences. 3' and 5' RACE analyses were performed using a RACE kit (Novizan). Following the manufacturer's instructions, cDNA templates for 3' and 5' RACE were synthesized and subjected to polymerase chain reaction (PCR). Vector ligation was then performed using a kit for Sanger sequencing (Shanghai Sangon Biotech). Based on currently published studies in cattle, mice, pigs, and sheep... Rosa26 Sequence comparison of the gene revealed a highly homologous 71 bp sequence (see [link]). Figure 1 Based on this sequence, specific primers were designed and RACE cloning was performed.

[0091] The obtained 5'RACE and 3'RACE sequences were spliced ​​together and compared using an online tool, revealing goat... Rosa26 The gene has four exons, and the cDNA sequence is approximately 2000 bp in length. Figure 2 The specific sequence is shown in SEQ ID NO: 1.

[0092] Total RNA was extracted from different goat tissues (heart, kidney, liver, lung, ovary, small intestine, spleen, testis, and uterus), and first-strand cDNA was synthesized using an RT kit (Novizan). Rosa26 Relative expression levels were analyzed using primers (SEQ ID NO: 2, 3), with goat GAPDH used as an internal control (primers shown in SEQ ID NO: 4, 5). Results from quantitative real-time qPCR (primers same as SEQ ID NO: 2-3) revealed that g... Rosa26 The gene exhibits high expression levels across different tissues (see...) Figure 3 and Figure 4 ).

[0093] Example 2 g obtained in Example 1 Rosa26 The sequence between the first and second exons of the gene (SEQ ID NO: 6) was used as the target site for sgRNA screening, and a total of 4 sgRNAs were obtained. Figure 5 (Signature), SEQ ID NO: 7-10.

[0094] In vitro digestion experiments were performed using an sgRNA in vitro transcription kit (Invitrogen) and a Cas9 in vitro digestion kit (Novizan). The results showed that R2's in vitro cleavage efficiency was significantly higher than that of other sgRNAs (see [link to relevant documentation]). Figure 6 ).

[0095] Four sgRNAs were ligated into the px459 vector and introduced into goat fetal fibroblasts via electroporation. Genomic DNA from the transfected cells was collected and PCR was performed using specific primers (as shown in SEQ ID NO: 11 and 12). The results were entered into the TIDE online tool website to calculate the targeting efficiency. Figure 7 The results showed that R2 had a significantly higher cleavage efficiency than other sgRNAs (69.1%).

[0096] Example 3: Carrier Design and Transfection 1. Constructing an EGFP green fluorescent protein donor plasmid The oligonucleotide encoding R2 sgRNA was denatured using a thermal cycler with the following program: 37°C for 5 minutes, 95°C for 30 minutes, and then incubated at room temperature for 1 hour. The annealed oligonucleotide was then ligated into a BBSI-digested pX459-SpCas9-NG vector (Addgene, #171370) to obtain the sgRNA targeting vector.

[0097] Donor plasmids (Puc19-F2A-EGFP-KI donor) were constructed using Puc19 as the backbone. Homologous arms (SEQ ID NO: 13, 14), the EGFP sequence (SEQ ID NO: 15), and the F2A sequence (SEQ ID NO: 16) were ligated together using standard overlap PCR and then inserted into the Puc19 vector (Addgene, #50005). Rosa26 The left and right homologous arms of the homologous recombination event at the locus are up to 800 bp long.

[0098] 2. Fixed-point insertion Rosa26 Screening of stable cell lines for EGFP at the site To knock in foreign genes, donor plasmids and sgRNA targeting vectors were co-transfected into goat fetal fibroblasts.

[0099] Cell resuscitation: Goat fetal fibroblasts (GFF) were resuscitated with cell culture medium containing 10% FBS. The cells were passaged once before transfection to bring them into the logarithmic growth phase. When the cells grew to 70%-80% of the volume of a 100mm culture dish, the cell pellet was collected for plasmid transfection.

[0100] Cell transfection: Electroporation was used. Cells with 95% confluence as observed under an inverted microscope were used for transfection. After digestion and centrifugation, the supernatant was discarded. Using the Lonza electroporation kit, 100 μl of electroporation buffer and 10 ng of the sgRNA targeting vector and donor plasmid constructed in step 1 (1:1.5) were added and thoroughly mixed by pipetting. The mixture was then transferred to an electroporation cuvette and mixed well. The cuvette was placed in the Lonza electroporator, and electroporation was performed using the A03 electroporation program. After successful electroporation, the mixture in the cuvette was gently aspirated, and complete DMEM / F-12 medium containing 20% ​​FBS was added. The mixture was incubated for 10 minutes. After centrifugation to wash away the electroporation buffer, the cells were thoroughly mixed by pipetting and transferred to 6-well plates and incubated at 37°C. After 48 hours, the cell electroporation efficiency was detected by flow cytometry.

[0101] Drug screening: After transfection, cells were cultured in DMEM / F-12 medium containing 2 μg / ml puromycin for 48 hours, and then in DMEM / F-12 medium containing 20% ​​fetal bovine serum for 48 hours.

[0102] Single-cell clones were collected and subjected to fluorescence detection, revealing that the cells produced green fluorescence (see [link]). Figure 8 This indicates that cell editing was successful.

[0103] Example 4: Cell Acquisition and Functional Verification The sequences containing melatonin synthases AANAT (Gene ID: 102190991) and ASMT (Gene ID: 100861249) and their homologous arms (shown in SEQ ID NO: 13, 14) were inserted into the pUC19 vector to obtain the donor plasmid ASMT-P2A-AANAT expressing AANAT and ASMT (see [link to pUC19]). Figure 9 ).

[0104] Gene editing of goat fetal fibroblasts was performed using the sgRNA targeting vector constructed in Example 3 of this disclosure and the donor plasmid ASMT-P2A-AANAT. Positive monoclonal cell lines were produced via electroporation, following the same method as in Example 3. Sequencing results of the positive monoclonal cells are shown below. Figure 10 The sequencing primers for positive monoclonal cells are shown in SEQ ID NO: 17 and 18.

[0105] RT-qPCR and WB analysis of the obtained cell lines revealed AANAT and ASMT RNA in the cells. Figure 11 ) and protein expression ( Figure 12 The number of fibroblasts was significantly increased compared to unedited goat fetus fibroblasts (control). RT-qPCR primers are shown in SEQ ID NO: 19-22.

[0106] Add 10 using external source -7 Gene-edited cells were cultured in a complete medium containing μg / μL of 5-hydroxytryptamine (5HT), and unedited goat fetal fibroblasts were cultured as a control. The melatonin content in the cell culture medium was detected after 3 hours.

[0107] Serum and cell culture medium were mixed with methanol at a ratio of 1:4, vortexed, and then centrifuged (10,000 r / min, 10 min). The supernatant was filtered through a 0.22 μm microporous membrane and used for later use. Melatonin detection was performed at the Central Laboratory of the Beijing Institute of Animal Husbandry and Veterinary Medicine, Chinese Academy of Agricultural Sciences, using high-performance liquid chromatography-mass spectrometry (Agilent 1290-G6470, Santa Clara, USA). The results showed that the melatonin content in the gene-edited cell culture medium was significantly higher than that in unedited goat fetal fibroblasts (control). Figure 13 ).

[0108] The technical solutions disclosed herein are not limited to the specific embodiments described above. Any technical modifications made based on the technical solutions disclosed herein shall fall within the protection scope of this disclosure.

Claims

1. A composition comprising a guide RNA or DNA encoding a guide RNA, wherein the guide RNA comprises a DNA-targeting segment that targets a guide RNA target sequence in a genomic safe harbor locus and a protein-binding segment that binds to a Cas protein, wherein the guide RNA target sequence is located in goat chromosome 22 coordinates chr22: 17032029-17032052, or comprises a sequence set forth in SEQ ID NO:

6.

2. The composition of claim 1, wherein, the DNA-targeting segment comprises at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the sequence set forth in SEQ ID NO: 8; preferably, the composition comprises the DNA encoding the guide RNA; preferably, the DNA encoding the guide RNA is in a nucleic acid vector; preferably, the composition comprises the guide RNA in RNA form; preferably, the guide RNA is a single guide RNA (sgRNA).

3. The composition of claim 1, wherein, the composition further comprises the Cas protein or a nucleic acid encoding the Cas protein; preferably, the Cas protein is a Cas9 protein; preferably, the Cas9 protein is derived from a S. pyogenes Cas9 protein, a S. aureus Cas9 protein, a C. jejuni Cas9 protein, a S. thermophilus Cas9 protein, or a N. meningitidis Cas9 protein; preferably, the nucleic acid encoding the Cas protein is codon-optimized for expression in a mammalian cell or a human cell; preferably, the nucleic acid encoding the Cas protein comprises DNA or mRNA encoding the Cas protein.

4. The composition of claim 1, wherein, the composition further comprises a nucleic acid construct, wherein the nucleic acid construct comprises a nucleic acid operably linked to a promoter, wherein the nucleic acid is selected from the group consisting of a reporter gene and / or a functional gene, preferably, the reporter gene comprises one or more of a fluorescent protein gene, a chloramphenicol acetyltransferase (CAT) gene, a beta-galactosidase gene, a dihydrofolate reductase gene, a luciferase gene, and an alkaline phosphatase gene; preferably, the functional gene comprises one or more of a melatonin synthesis enzyme gene, a growth rate-related gene, a meat quality-related gene, or a disease resistance-related gene; preferably, the functional gene comprises melatonin synthesis enzyme AANAT and ASMT genes; preferably, the nucleic acid construct does not comprise homology arms; preferably, the nucleic acid construct comprises homology arms; preferably, the homology arms comprise sequences set forth in SEQ ID NO: 13 and SEQ ID NO: 14; preferably, the nucleic acid construct is in a nucleic acid vector or a lipid nanoparticle.

5. The composition of any one of claims 1 to 5 for use in specifically recognizing and / or targeting a goat Rosa26 gene, a goat Rosa26 cell line for site-specific integration of a foreign gene into a goat Rosa26 transgenic goat, breeding of a goat, preparation Rosa26 Rosa26 application in a cell model or an animal model for studying the function of a goat 6. A method for inserting an exogenous gene into a safe harbor locus in an animal or a cell in vitro, the method comprising introducing into the animal or the cell: (a) a nuclease agent that targets a target site in the safe harbor locus or one or more nucleic acids encoding the nuclease agent; and (b) an exogenous donor nucleic acid comprising the exogenous gene sequence, wherein the nuclease agent cleaves the target site and the exogenous gene sequence is inserted into the safe harbor locus to produce a modified safe harbor locus; wherein the target site is located in goat chromosome 22 coordinates chr22: 17032029-17032052, or comprises a sequence set forth in SEQ ID NO:

6.

7. The method of claim 6, wherein, the nuclease agent comprises: (a) a zinc finger nuclease (ZFN); (b) a transcription activator-like effector nuclease (TALEN); or (c) (i) a Cas protein or a nucleic acid encoding the Cas protein; and (ii) a guide RNA or one or more DNA encoding the guide RNA, wherein the guide RNA comprises a DNA-targeting segment that targets a guide RNA target sequence, and wherein the guide RNA binds to and targets the Cas protein to the guide RNA target sequence; preferably, the Cas protein is a Cas9 protein; preferably, the DNA-targeting segment comprises at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the sequence set forth in SEQ ID NO:

8.

8. The method of claim 6, wherein, the animal comprises a goat; preferably, the cell is a goat somatic cell and / or a goat zygote; preferably, the cell is a goat fetal fibroblast cell; preferably, the goat comprises a dairy goat.

9. An animal or a cell obtained by the method of any one of claims 6 to 8.

10. Use of the method of any one of claims 6 to 8 or the animal or cell of claim 9 in the manufacture of Rosa26 a cell model or animal model for gene function studies, a transgenic goat, or in the breeding of goats. preferably, the cell line is used for regulating the reproductive cycle of a goat, improving the reproductive efficiency and lambing rate of a goat, prolonging the mammary gland active period of a goat, enhancing the anti-stress ability of a goat, or enhancing the disease resistance of a goat; preferably, the goat comprises a dairy goat.

Images