Application of USP32 as target in diagnosis and treatment of triple negative breast cancer

By targeting USP32 to block the Hippo signaling pathway, and utilizing the diagnostic and inhibitory effects of USP32 gene expression levels, the challenges of TNBC treatment have been solved, achieving highly efficient and precise treatment results and prognostic monitoring.

CN121629049APending Publication Date: 2026-03-10SHENGJING HOSPITAL OF CHINA MEDICAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-12
Publication Date
2026-03-10

AI Technical Summary

Technical Problem

Existing technologies are difficult to effectively target and treat triple-negative breast cancer (TNBC), especially because direct inhibitors of the Hippo/YAP axis have problems such as poor membrane permeability, insufficient stability or high toxicity, and the role of key deubiquitinating enzymes (DUBs) in TNBC is unclear, and the activation mechanism of YAP is unknown.

Method used

Targeting USP32 as a key DUB, by blocking its interaction with the Hippo signaling pathway, using diagnostic kits and inhibitors of USP32 gene expression levels, the activity of USP32 is inhibited, the oncogenic circuit is disrupted, and YAP protein is degraded.

Benefits of technology

It provides a novel targeted therapy strategy for TNBC, reduces off-target toxicity, improves treatment efficacy, and monitors patient prognosis through USP32 expression levels, thus achieving precision medicine.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121629049A_ABST
    Figure CN121629049A_ABST
Patent Text Reader

Abstract

The invention relates to the field of biological medicine, and particularly discloses application of USP32 as a target spot in diagnosis and treatment of triple negative breast cancer. It is found that USP32 is abnormally highly expressed in TNBC and is related to poor prognosis of a patient. Functional experiments show that proliferation and invasion of TNBC cells can be remarkably inhibited and apoptosis of the TNBC cells can be induced by inhibiting USP32, and tumor growth can be effectively inhibited in an animal model. In mechanism, the USP32 stabilizes the key effector factor YAP of the Hippo pathway through the ubiquitination removal effect, the YAP can activate transcription of the USP32 on the contrary, and the USP32 and the YAP form a positive feedback loop to jointly drive the TNBC progress. On the basis, the medicine for targeted inhibition of the USP32 can be used for preparing the medicine for treating the TNBC, and the expression level of the USP32 can also be used as a prognosis diagnosis marker of the TNBC.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedicine, specifically to the application of USP32 as a target in the diagnosis and treatment of triple-negative breast cancer. Background Technology

[0002] Triple-negative breast cancer (TNBC), lacking estrogen receptor, progesterone receptor, and HER2 expression, cannot benefit from endocrine therapy or anti-HER2 targeted therapy, making it the breast cancer subtype with the worst clinical prognosis and the one most in need of novel treatment strategies. The Hippo signaling pathway plays a crucial role in regulating organ size and tumorigenesis, and abnormal activation of its downstream effector YAP / TAZ is closely related to the progression, metastasis, and chemotherapy resistance of various cancers, including TNBC. Currently, the development of direct inhibitors targeting the Hippo / YAP axis (such as drugs targeting the YAP-TEAD interaction) faces challenges such as poor membrane permeability, insufficient stability, or high toxicity.

[0003] Protein homeostasis is precisely regulated by ubiquitination and deubiquitination processes. Deubiquitinating enzymes (DUBs) counteract the fate of substrate proteins to proteasome degradation by removing ubiquitin chains from them. Although some DUBs are known to regulate YAP, the key DUBs that play a dominant role in TNBC remain unclear, and the mechanisms by which YAP remains activated even when the kinase cascade is functioning normally are not fully elucidated. Therefore, identifying the key DUBs that specifically regulate YAP stability in TNBC and elucidating their interaction mechanisms with the Hippo pathway is of great significance for developing novel TNBC-targeted therapeutic strategies. Summary of the Invention

[0004] To address the problems existing in the prior art, this invention provides the application of USP32 as a target in the diagnosis and treatment of triple-negative breast cancer. It reveals the important role of the positive feedback loop formed between USP32 and YAP in regulating TNBC progression, suggesting that targeting USP32 may be an effective strategy for treating TNBC by blocking its interaction with the Hippo signaling pathway.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solutions.

[0006] This invention discloses the application of the USP32 gene in the preparation of a diagnostic kit for triple-negative breast cancer (TNBC).

[0007] Furthermore, the diagnostic kit is used to detect the expression level of the USP32 gene in tissue samples from suspected triple-negative breast cancer patients using Western blot or quantitative PCR technology, wherein the expression level of the USP32 gene is positively correlated with the incidence of triple-negative breast cancer.

[0008] This invention also discloses the application of the USP32 gene in the preparation of a prognostic assessment kit for triple-negative breast cancer (TNBC).

[0009] Furthermore, the prognostic assessment kit is used to detect the expression level of the USP32 gene in tissue samples from triple-negative breast cancer patients using Western blot or quantitative PCR technology, wherein the expression level of the USP32 gene is negatively correlated with the prognostic survival of patients.

[0010] Furthermore, the kit described above contains specific primers for amplifying the USP32 gene, and the primer sequences are shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0011] The present invention also discloses the application of an inhibitor of USP32 gene expression level in the preparation of a drug for treating triple-negative breast cancer.

[0012] The present invention also discloses the application of an inhibitor of USP32 gene expression level in the preparation of a drug that inhibits the proliferation, invasion or metastasis of triple-negative breast cancer cells.

[0013] Furthermore, the aforementioned inhibitors include siRNA, shRNA, sgRNA, or antisense oligonucleotides that specifically target the USP32 gene.

[0014] Furthermore, the sequence of the siRNA is shown in SEQ ID NO: 3 and SEQ ID NO: 4.

[0015] The present invention also discloses a stable triple-negative breast cancer cell line with knockdown or knockout of the USP32 gene, characterized in that the cell line is constructed using the inhibitor described above and is used for mechanism research or drug screening of triple-negative breast cancer.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows.

[0017] For the first time, a positive feedback regulatory loop between the deubiquitinating enzyme USP32 and the core Hippo pathway factor YAP was revealed in TNBC. This study elucidates a novel molecular mechanism by which USP32 deubiquitinates and stabilizes YAP protein through its enzymatic activity, while YAP, in turn, transcribes and activates USP32 expression. This discovery provides a new theoretical foundation for understanding the pathogenesis of TNBC. Based on this mechanism, this invention innovatively proposes "targeting USP32" as a novel strategy for treating TNBC. By inhibiting its activity, the aforementioned oncogenic loop can be effectively disrupted, leading to YAP degradation and thus inhibiting tumor growth. This provides a novel alternative pathway to overcome the drug development bottleneck currently faced by directly targeting YAP / TEAD. Furthermore, this target exhibits high specificity, and its catalytic activity provides a clear site for designing highly selective inhibitors, helping to reduce potential off-target toxicity. In addition, the expression level of USP32 is significantly correlated with poor prognosis in TNBC patients, making it a potential biomarker for novel prognostic diagnosis or efficacy monitoring. In summary, this invention provides a systematic and novel solution with significant translational potential for precision medicine in TNBC, covering aspects from basic mechanisms and treatment strategies to diagnostic applications. Attached Figure Description

[0018] Figure 1 USP32 is a key regulator of the Hippo pathway in triple-negative breast cancer and is associated with poor prognosis. A. Schematic diagram of qPCR validation results for deubiquitinase screening and YAP target gene expression. B. Gene set enrichment analysis of USP32 expression and YAP characteristic gene set. C. Kaplan-Meier curve of USP32 expression and overall survival in TNBC patients based on public data. D. Enrichment analysis of YAP / TAZ characteristic gene set after USP32 knockdown. E. Heatmap of YAP characteristic gene expression levels after USP32 knockdown. F. Volcano plot of differentially expressed genes after USP32 knockdown. G, H. Immunohistochemical staining images of USP32 and YAP protein expression in TNBC patient tissues.

[0019] Figure 2Knockdown of USP32 impairs the Hippo / YAP pathway and inhibits tumorigenesis in triple-negative breast cancer. A, B. Immunoblot images of USP32 and YAP protein levels in TNBC cells after USP32 knockdown. C, D. qPCR results of CYR61 and CTGF mRNA levels in TNBC cells after USP32 knockdown. E, F. Luciferase reporter gene assay results of TEAD transcriptional activity in TNBC cells after USP32 knockdown. G, H. CCK-8 assay results of TNBC cell proliferation after USP32 knockdown. IL. EdU staining image (Hoechst counterstaining) of TNBC cell proliferation after USP32 knockdown. MP. Transwell staining image of TNBC cell migration after USP32 knockdown. QT. Flow cytometry scatter plot of TNBC cell apoptosis after USP32 knockdown. UW. Actual photographs of MDA-MB-231 cells with stable USP32 knockdown forming tumors in nude mice, along with statistical graphs of tumor weight and volume.

[0020] Figure 3 Overexpression of USP32 promotes the malignant phenotype of triple-negative breast cancer cells. A, B. Western blot images of USP32 protein levels in TNBC cells after USP32 overexpression. C, D. CCK-8 assay results of TNBC cell proliferation after USP32 overexpression. EH. EdU staining image (Hoechst counterstain) of TNBC cell proliferation after USP32 overexpression. IL. Transwell assay image of TNBC cell migration after USP32 overexpression. MP. Flow cytometry scatter plot of TNBC cell apoptosis after USP32 overexpression.

[0021] Figure 4The protease activity of USP32 is essential for regulating YAP stability. A. Schematic diagrams of the structures of wild-type USP32 and its catalytic mutant C743A. B. Immunoblot images of USP32 and YAP protein levels in TNBC cells overexpressing wild-type or mutant USP32. C. qRT-PCR results of CYR61 and CTGF mRNA levels in TNBC cells overexpressing wild-type or mutant USP32. D. Luciferase reporter gene assay results of TEAD transcriptional activity in MDA-MB-231 cells overexpressing wild-type or mutant USP32. EG. CCK-8 assay results and EdU staining images (Hoechst counterstaining) of MDA-MB-231 cell proliferation after overexpression of wild-type or mutant USP32. H, I. Transwell staining images of migration in MDA-MB-231 cells overexpressing wild-type or mutant USP32. J, K. Flow cytometry scatter plot of apoptosis in MDA-MB-231 cells overexpressing USP32 wild-type or mutant.

[0022] Figure 5 YAP can rescue USP32-deficiency-induced TNBC cell suppression. A, B. Immunoblot images of USP32 and YAP protein levels in TNBC cells after USP32 knockdown and YAP overexpression. C, D. qRT-PCR results of YAP target gene mRNA levels in TNBC cells after USP32 knockdown and YAP overexpression. E, F. Luciferase reporter gene assay results of TEAD transcriptional activity in TNBC cells after USP32 knockdown and YAP overexpression. G, H. CCK-8 assay results of TNBC cell proliferation after USP32 knockdown and YAP overexpression. IL. EdU staining image (Hoechst counterstaining) of TNBC cell proliferation after USP32 knockdown and YAP overexpression. MP. Transwell staining image of TNBC cell migration after USP32 knockdown and YAP overexpression. QT. Flow cytometry scatter plot of TNBC cell apoptosis after USP32 knockdown and YAP overexpression. UW. Actual photographs of MDA-MB-231 cells with stable USP32 knockdown and YAP overexpression forming tumors in nude mice, along with statistical graphs of tumor weight and volume.

[0023] Figure 6USP32 interacts with YAP and regulates YAP protein stability. A. Immunofluorescence colocalization images of endogenous YAP and USP32 in MDA-MB-231 and BT549 cells (DAPI counterstaining). B, C. Immunoblotting images of endogenous immunoprecipitation of USP32 and YAP in MDA-MB-231 and BT549 cells. D. Immunoblotting images of the effect of treatment with the proteasome inhibitor MG132 on YAP protein levels induced by USP32 knockdown. E, F. Immunoblotting images of YAP protein stability analysis after overexpression of wild-type or C743A mutant USP32 and treatment with CHX for different time periods. G, H. Immunoblotting images of YAP protein stability analysis after knockdown of USP32 and treatment with CHX for different time periods. I, J. Schematic diagrams of YAP and wild-type and truncated variants of USP32 used for interaction domain mapping. Immunoblot images of co-precipitation of K and L USP32 with different YAP truncated forms (K) and YAP with different USP32 truncated forms (L).

[0024] Figure 7 USP32 mediates YAP stability by catalyzing the deubiquitination of the K48-linked polyubiquitin chain on YAP. A, B. Immunoprecipitation-immunoblotting analysis of YAP ubiquitinated state after USP32 knockdown and conversion to different ubiquitin mutants. C, D. Immunoprecipitation-immunoblotting analysis of YAP ubiquitinated state after USP32 overexpression and conversion to different ubiquitin mutants. E, F. Immunoprecipitation-immunoblotting analysis of YAP ubiquitinated state after overexpression of wild-type or C743A mutant USP32 and conversion to different ubiquitin mutants. G. Immunoprecipitation-immunoblotting analysis of YAP ubiquitinated state after overexpression of USP32 and conversion to a series of YAP point mutants.

[0025] Figure 8YAP regulates USP32 expression, forming a positive feedback loop with USP32 in the YAP signaling pathway. A. Schematic diagram of the USP32 gene promoter region, showing the hypothesized YAP binding region. B. Chromatin immunoprecipitation agarose gel electrophoresis image of YAP binding to the USP32 promoter in MDA-MB-231 cells. C, D. ChIP-qPCR results of the USP32 promoter region in MDA-MB-231 and BT549 cells after YAP knockdown. E, F. Western blot images of USP32 and YAP protein levels in MDA-MB-231 and BT549 cells after YAP knockdown. G, H. qRT-PCR results of USP32 and CYR61 mRNA levels in MDA-MB-231 and BT549 cells after YAP knockdown. I, J. Western blot images of USP32 and YAP protein levels after treatment of TNBC cells with different concentrations of verteporfen. K, L. qRT-PCR results of USP32 and CYR61 mRNA levels after TNBC cells were treated with different concentrations of verteporfen. M, N. Immunoblot images of USP32 and YAP protein levels after TNBC cells were treated with different concentrations of XMU-MP-1. O, P. qRT-PCR results of USP32 and CYR61 mRNA levels after TNBC cells were treated with different concentrations of XMU-MP-1. Q–T. Immunofluorescence staining images (DAPI counterstaining) and fluorescence intensity statistics of endogenous USP32 in TNBC cells after verteporfen treatment or control treatment. Detailed Implementation

[0026] The present invention will be further described in detail below with reference to specific embodiments. However, this should not be construed as limiting the scope of the above-described subject matter of the present invention to the following embodiments; all technologies implemented based on the content of the present invention fall within the scope of the present invention.

[0027] Unless otherwise specified, all reagents and materials used in this invention are commercially available.

[0028] I. Materials and Methods.

[0029] Reagents: The reagents used in this study, including CHX (HY-12320), verteporfen (HY-B0146), XMU-MP-1 (HY-100526) and MG-132 (HY-13259), were all purchased from MedChemExpress (MCE).

[0030] Cell lines and cell culture. Human triple-negative breast cancer cell lines MDA-MB-231 and BT549, and human embryonic kidney cells HEK-293T, were purchased from the American Type Culture Collection. MDA-MB-231 and HEK-293T cells were cultured in DuPont modified Eagle medium, while BT549 cells were cultured in RPMI-1640 medium. All media were supplemented with 10% fetal bovine serum and 1% penicillin / streptomycin. Cells were cultured at 37°C and passaged according to ATCC standard operating procedures. To confirm cell line authenticity, short tandem repeat profiling was performed using a PowerPlex 21 system.

[0031] Plasmids and siRNA. The coding sequences for wild-type USP32 with the Flag tag, the catalytic mutant USP32 (C743A), and various truncated USP32 variants were purchased from Wuhan Miaoling Biotechnology Co., Ltd., and subsequently cloned into the pcDNA3.1 vector. Plasmids for HA-tagged ubiquitin (wild-type, K48-only, K48R-only, K63-only, K63R-only) and Myc-tagged YAP and its mutants were already available in our laboratory and have been previously described. Cell transfection with plasmids was performed using Lipofectamine 2000. For siRNA-mediated gene silencing, RNAiMAX transfection reagent was used. The siRNA sequences targeting specific genes are as follows: siUSP32#1: 5'-GGC UGC ACU UCA AUA AUU UTT-3'; siUSP32#2: 5'-GCA GGU CGA AGA UAG AAUUTT-3'; siYAP#1: 5'-GUC UCA GGA AUU GAG AAC A-3'; siYAP#2: 5'-GUC AGA GAU ACUUCU UAA A-3'; siControl (non-targeted): 5'-UUC UCC GAA CGU GUC ACG UTT-3'.

[0032] Screening of deubiquitinase siRNA libraries. To identify deubiquitinases regulating the Hippo pathway, we performed targeted siRNA screening. We transformed MDA-MB-231 cells with a siRNA library targeting 98 human DUBs. After 48 hours, the mRNA expression levels of the classic YAP / TEAD target genes CYR61 and CTGF were detected by reverse transcription quantitative PCR. Based on the screening results (suggesting that USP32 may play a role), we will focus our subsequent research on this deubiquitinase.

[0033] RNA extraction and real-time quantitative PCR. Total RNA was extracted from cells using the RNeasy Plus Mini Kit according to the manufacturer's instructions. cDNA was then synthesized using 1 µg of total RNA and HiScript II QRT SuperMix. Real-time quantitative PCR was performed using an AppliedBiosystems 7500Fast Real-Time PCR system and SYBR qRT-PCR Master Mix. Ribosomal protein 36B4 was used as an internal control for normalization. USP32 primer sequences: Forward: GGAGTCACGGATCGGATTCC; Reverse: GGCCCATGTAATATGAGAGTCCA.

[0034] Western blotting. Cells were collected and lysed in RIPA lysis buffer containing a mixture of phosphatases and protease inhibitors. Protein lysates were separated by SDS-PAGE and then transferred to PVDF membranes. After blocking with PBST containing 5% skim milk at room temperature for 1 h, the membranes were incubated overnight at 4°C with primary antibodies. After washing three times with PBST, the membranes were incubated with the corresponding secondary antibodies. After washing three more times, protein bands were visualized using an ECL detection system. Primary antibodies used included anti-β-Actin, anti-Flag, anti-USP32, anti-Myc, anti-YAP, and anti-HA. Secondary antibodies included goat anti-rabbit IgG and goat anti-mouse IgG. Signal enhancement was performed using an ECL chemiluminescence kit.

[0035] Luciferase reporter gene assay. MDA-MB-231 or BT549 cells were seeded in 48-well plates and co-transfected with the corresponding luciferase reporter plasmid and Renilla luciferase plasmid (as internal control) using Lipofectamine 2000. After transfection, the activities of firefly and Renilla luciferase were quantified using a dual-luciferase reporter gene assay system according to the manufacturer's instructions.

[0036] CCK8 assay. To assess cell viability, MDA-MB-231 and BT549 cells were seeded in 12-well plates and transfected with either control siRNA or siRNA targeting USP32. After 24 hours of incubation, the transfected cells were trypsinized and seeded at 5000 cells per well (three replicates) in 96-well plates. Cell viability was then measured at specified time points using the CCK-8 assay according to the manufacturer's protocol.

[0037] EdU assay. MDA-MB-231 and BT549 cells were cultured overnight in 96-well plates after treatment. Cell proliferation was then assessed using an EdU assay kit according to the manufacturer's protocol. In short, cells were incubated with 50 µM EdU for 2 h, fixed with 4% paraformaldehyde, and stained. Cell nuclei were counterstained with Hoechst 33342. Images were analyzed using ImageJ software, and the proportion of EdU-positive cells was calculated to assess proliferation rate.

[0038] Transwell assay. In the migration assay, 5.0 × 10⁻⁶ cells were resuspended in serum-free medium. 4 Cells were seeded in the upper chamber of a Transwell chamber. The lower chamber contained complete culture medium with 20% FBS as a chemotactic agent. After incubation for 12-14 hours, unmigrated cells on the surface of the upper chamber were removed. Migrating cells on the membrane surface of the lower chamber were fixed with anhydrous methanol and stained with 0.2% crystal violet for observation and counting.

[0039] Flow cytometry analysis. Apoptosis was assessed using the FITC Annexin V apoptosis detection kit. Briefly, treated MDA-MB-231 or BT549 cells were stained with Annexin V-FITC and propidium iodide according to the manufacturer's protocol. Fluorescence intensity was then measured using flow cytometry, and the data were analyzed using FlowJo 7.6 software.

[0040] Immunoprecipitation assay. During immunoprecipitation, cells were lysed, and the resulting lysate was incubated with recombinant bait proteins. Protein complexes were captured by adding magnetic beads that bind to antibodies specific to the bait proteins. After thorough washing, the immune complexes bound to the magnetic beads were separated using a magnet. The eluted proteins were separated by SDS-PAGE and subjected to Western blotting analysis to identify interacting proteins.

[0041] Polyubiquitination detection assays. For example, to detect K48-linked polyubiquitination, 293T cells were co-transfected with Flag-USP8 (or K48-Ub) and Myc-YAP plasmids for 24 h, and then treated with 10 µM MG132 for 6 h before protein extraction. Subsequently, the protein extract was pre-cleaned with protein A / G beads for 3 h. The protein was incubated overnight with anti-Myc antibody, and then incubated with protein A / G beads at 4 °C for 1 h. Finally, Western blotting was performed using anti-HA antibody to identify the level of K48 polyubiquitinated YAP.

[0042] Protein stability assays. Cells were transfected with the siControl / siUSP32 or Flag / Flag-USP32 / Flag-USP32 mutant plasmids. After CHX treatment for a specified time, cells were collected and analyzed by Western blot using specific antibodies. The density of YAP protein bands was quantified using ImageJ software.

[0043] Immunofluorescence assay. MDA-MB-231 and BT549 cells were fixed with 4% paraformaldehyde at room temperature for 10 min. After washing, cells were permeabilized with 0.25% Triton X-100 for 5 min, followed by blocking with 5% BSA for 1 h. Subsequently, cells were incubated overnight at 4°C with USP32 (mouse) and YAP (rabbit) primary antibodies. After washing with PBS, cells were incubated at room temperature in the dark with AF488-labeled goat anti-rabbit IgG and AF594-labeled goat anti-mouse IgG probes for 1 h. Cell nuclei were counterstained with DAPI. Fluorescence images were acquired using a confocal laser scanning microscope and analyzed using ImageJ software.

[0044] Immunohistochemistry. Human tissue samples were fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned using a semi-automatic microtome. Immunohistochemical staining was performed using an immunohistochemical kit according to the manufacturer's instructions. Sections were incubated with primary antibodies against USP32 and YAP, followed by the application of the corresponding secondary antibodies. Immunoreactivity was observed using DAB substrate staining, and cell nuclei were counterstained with hematoxylin.

[0045] Xenograft mouse model. To conduct xenograft tumor formation experiments, 4×10⁴ xenografts were suspended in 200µL PBS. 6 Cancer cells were subcutaneously injected into the mammary fat pads of 4-week-old female BALB / c mice. Tumor growth was monitored over 5 weeks, and tumor volume was assessed weekly using the formula: Volume = (Length × Width²) / 2. All animal experiments were approved by the Animal Care and Use Committee of the First Affiliated Hospital of Zhengzhou University and conducted in accordance with its ethical guidelines.

[0046] Chromatin immunoprecipitation assay. MDA-MB-231 cells were lysed after cross-linking with 1% formaldehyde and quenching with glycine, and chromatin was fragmented by sonication. Chromatin complexes were captured by immunoprecipitation using anti-YAP antibody. After decross-linking and DNA purification, the enrichment of the USP32 promoter was quantified by qPCR using specific primers (forward primer: 5'-CCCTCCCCAAGCTAACCG-3', reverse primer: 5'GGAAGATGGGACGATGCGTTA-3').

[0047] Publicly available clinical data analysis was conducted. Transcriptomic data for triple-negative breast cancer were obtained from the Cancer Genome Atlas (GDC) data portal. The association between USP32 expression and patient survival was examined using the KMPLOT database. Gene set enrichment analysis was performed using the "CORDENONSI_YAP_CONSERVED_SIGNATURE" gene set from the Molecular Characterization Database. Heatmaps were generated using the Xiantao Online platform, and all statistical analyses and chart generation were performed using GraphPad Prism 8.0 software.

[0048] RNA-seq and analysis. We investigated the effect of USP32 knockdown on transcription through gene set enrichment analysis. The results showed that the YAP / TAZ characteristic gene set was significantly suppressed in the siUSP32 group compared with the siControl group. In addition, we used a threshold |fold change|>1.5 and P value<0.05 to identify differentially expressed genes, and used OmicStudio to generate volcano plots for visualization.

[0049] Statistics. In this study, statistical tools such as Student's t-test and Pearson correlation coefficient were used to analyze the publicly available data. Data are expressed as mean ± standard deviation, and statistical significance was defined as: P < 0.05 (*), P < 0.01 (**), P < 0.001 (***).

[0050] II. Experimental Results.

[0051] 1. USP32 is associated with the activity of the Hippo / YAP axis in TNBC. First, we used TNBC gene expression data from the TCGA database. We performed a correlation analysis between the expression of deubiquitinases in TNBC and the characteristic gene clusters of the Hippo pathway, and observed that 14 members of the deubiquitinase family were positively correlated with Hippo / YAP activity (P<0.05; Figure 1 A). We further validated these deubiquitinating enzymes by quantitative PCR of CTGF and CYR61 expression, and the results showed that USP32 was the deubiquitinating enzyme that had the most significant impact on the expression of YAP target genes in TNBC (A). Figure 1 A). In the TCGA database, USP32 expression was associated with the YAP conserved gene signature set (NES=1.43; P<0.01; Figure 1 B). Survival analysis showed that high USP32 expression was associated with lower overall survival in TNBC patients (B). Figure 1 C). We performed transcriptomic analysis on TNBC cells after USP32 knockdown. RNA-seq data showed that USP32 knockdown led to downregulation of YAP target gene expression (C). Figure 1Immunohistochemical data from TNBC samples showed that USP32 expression was positively correlated with YAP protein levels (P<0.01). Figure 1 H).

[0052] 2. USP32 knockdown inhibits the Hippo / YAP axis and TNBC progression. We further knocked down USP32 in two TNBC cell types and observed that USP32 knockdown significantly reduced YAP protein levels in MDA-MB-231 and BT549 cells. Figure 2 AB). qPCR analysis showed that USP32 knockdown reduced the expression of YAP target genes (including CYR61 and CTGF) in MDA-MB-231 and BT549 cells. Figure 2 CD). Luciferase reporter gene assays showed that USP32 knockdown inhibited YAP / TEAD luciferase activity in MDA-MB-231 and BT549 cells. Figure 2 EF). CCK-8 assays demonstrated that USP32 knockdown significantly inhibited the proliferation of MDA-MB-231 and BT549 cells (EF). Figure 2 GH), and EdU incorporation experiments also showed that USP32 knockdown reduced the number of EdU-positive cells (GH), Figure 2 Trans-well assays showed that inhibiting USP32 reduced the invasive ability of MDA-MB-231 and BT549 cells (IL). Figure 2 MP). Flow cytometry analysis showed that USP32 knockdown significantly promoted the death of MDA-MB-231 and BT549 cells. Figure 2 We further constructed stably USP32-knockdown MDA-MB-231 cells and performed xenograft tumor experiments. The results showed that USP32 knockdown inhibited the growth of TNBC tumors in vivo. Figure 2 UW).

[0053] 3. USP32 overexpression promotes TNBC progression. We further overexpressed USP32 in MDA-MB-231 and BT549 cells ( Figure 3 AB). CCK-8 assays showed that USP32 overexpression significantly promoted the proliferation of MDA-MB-231 and BT549 cells (AB). Figure 3 CD), and EdU incorporation experiments also showed that USP32 overexpression increased the number of EdU-positive cells (CD), while EdU incorporation experiments also showed that USP32 overexpression increased the number of EdU-positive cells (CD). Figure 3 EH). Trans-well experiments showed that USP32 overexpression enhanced the invasive ability of MDA-MB-231 and BT549 cells (EH). Figure 3IL). Flow cytometry analysis showed that USP32 overexpression significantly inhibited cell death in MDA-MB-231 and BT549 cells. Figure 3 MP).

[0054] 4. USP32 regulates YAP stability through its enzymatic activity. USP32 may stabilize YAP protein through two mechanisms. One is that USP32 inhibits YAP polyubiquitination by catalytically removing the polyubiquitin chain; the other is that USP32 interacts with YAP solely as an adaptor protein, preventing YAP from binding to other E3 ubiquitin ligases, a process independent of USP32's enzymatic activity. Previous studies have shown that the cysteine ​​residue at position 743 of USP32 is crucial for its catalytic function. We constructed the C743A mutant of USP32 (… Figure 4 A). Immunoblotting data showed that wild-type USP32 stabilized YAP, while the mutant did not. Figure 4 B). Quantitative PCR data showed that wild-type USP32 upregulated the expression of YAP target genes, while the mutant did not. Figure 4 C). Luciferase activity assays showed that wild-type USP32 enhanced YAP / TEAD luciferase activity, while the mutant did not. Figure 4 D). The CCK-8 assay demonstrated that wild-type USP32 promotes cell proliferation, while the mutant does not. Figure 4 E). EdU incorporation experiments showed that wild-type USP32 increased the number of EdU-positive cells, while the mutant did not. Figure 4 FG). Trans-well assays showed that wild-type USP32 enhanced the migration ability of TNBC cells, while the mutant did not. Figure 4 HI). Flow cytometry analysis showed that wild-type USP32 inhibited apoptosis, while the mutant did not. Figure 4 JK).

[0055] 5. USP32 promotes TNBC progression via YAP protein. We further conducted a series of rescue experiments to demonstrate the logical link between USP32 and the regulation of TNBC progression through the Hippo signaling pathway. Western blot data showed that knocking down USP32 reduced YAP protein levels, while further overexpression of YAP restored its protein levels. Figure 5 AB). Quantitative PCR results showed that reducing USP32 levels downregulated the expression of YAP target genes, but overexpression of YAP in MDA-MB-231 and BT549 cells could offset this effect. Figure 5CD). Luciferase reporter gene assays showed that silencing USP32 reduced YAP / TEAD luciferase activity, but overexpression of YAP in MDA-MB-231 and BT549 cells could counteract this effect. Figure 5 EF). CCK-8 experiments demonstrated that silencing USP32 inhibits cell proliferation, but overexpression of YAP in MDA-MB-231 and BT549 cells reverses this effect. Figure 5 GH). EdU incorporation experiments demonstrated that reducing USP32 levels decreased the proportion of EdU-positive cells, while overexpression of YAP in MDA-MB-231 and BT549 cells could counteract this effect. Figure 5 IL). In Trans-well assays, reducing USP32 levels weakened cell invasion, but overexpression of YAP in MDA-MB-231 and BT549 cells reversed this effect. Figure 5 MP). In flow cytometry analysis, knockdown of USP32 increased the number of apoptotic cells, while overexpression of YAP in MDA-MB-231 and BT549 cells restored this effect. Figure 5 QT). In xenograft tumor models, reducing USP32 inhibits tumor growth, but overexpression of YAP in TNBC cells can counteract this effect. Figure 5 UW).

[0056] 6. USP32 can bind to YAP and regulate YAP stability. Immunofluorescence staining data show that USP32 can be localized in the cytoplasm and nucleus. Figure 6 A). Immunoprecipitation experiments showed that USP32 can bind to YAP in MDA-MB-231 and BT549 cells (A). Figure 6 BC). Furthermore, USP32 can stabilize the YAP protein, and this stabilizing effect can be rescued by the proteasome inhibitor MG132 (BC). Figure 6 D). Protein stability experiments showed that USP32 can prolong the half-life of YAP, and this effect depends on its enzyme activity ( Figure 6 EH). The YAP protein consists of a TBD domain, a WW domain, and a TA-binding domain, while USP32 consists of a DUSP domain and a USP domain. We further constructed these missing domains and found that YAP interacts with USP32 through its WW domain. On the other hand, the C-terminal domain of USP32 is essential for its binding to YAP. Figure 6 IL).

[0057] 7. USP32 enhances the stability of YAP by preventing K48-linked polyubiquitination. We further investigated how USP32 affects YAP ubiquitination. Ubiquitination experiments showed that knocking down USP32 does not affect K63-linked ubiquitination of YAP, but it does affect K48-linked polyubiquitination of YAP. Figure 7 AB). We further confirmed this conclusion by overexpressing USP32, and the results showed that USP32 overexpression reduced the total polyubiquitination and K48-linked polyubiquitination levels of YAP (AB). Figure 7 CD). Furthermore, wild-type USP32 can inhibit total polyubiquitination and K48-linked polyubiquitination of YAP, while the C743A mutant cannot. Figure 7 EF). We further examined the lysine sites of YAP involved in polyubiquitination, and the results showed that the K90 and K97 sites of YAP are important linkage sites for its polyubiquitination (EF). Figure 7 G).

[0058] 8. Positive feedback regulation between USP32 and the Hippo / YAP axis in TNBC. Multiple studies have examined the genomic binding sites of YAP in breast cancer, confirming its crucial role in breast cancer progression. We further analyzed publicly available ChIP-seq data and found that both YAP and TEAD may bind to the promoter region of USP32 (…). Figure 8 A). Our ChIP-PCR data confirm that YAP binds to the promoter region of USP32, and knocking down YAP reduces this binding affinity. Figure 8 BD). We further showed that silencing YAP suppressed the protein and mRNA levels of USP32 in MDA-MB-231 and BT549 cells (BD). Figure 8 EH). We further inhibited YAP function using verteporfen, and the results showed a decrease in both USP32 mRNA and protein levels (EH). Figure 8 IL). Furthermore, this effect can be reversed by activating YAP using XMU-MP-1 (IL). Figure 8 Immunofluorescence staining data showed that inhibiting YAP reduced the fluorescence signal of USP32 in MDA-MB-231 and BT549 cells (MP). Figure 8 QT).

[0059] In summary, this invention, through GSEA screening, identified USP32 among deubiquitinating enzymes (DUBs) as a key factor regulating YAP stability and Hippo signaling pathway activity, thereby influencing TNBC progression. Experiments showed that knocking down USP32 significantly inhibited Hippo / YAP pathway activity and slowed TNBC development. Molecular mechanism studies revealed that USP32 can interact with YAP, potentially enhancing YAP stability by inhibiting K48-linked polyubiquitination. Notably, YAP can also directly bind to the USP32 promoter region and drive its transcriptional activation. In conclusion, our study reveals the crucial role of the positive feedback loop formed between USP32 and YAP in regulating TNBC progression, suggesting that targeting USP32 may be an effective strategy for treating TNBC by blocking its interaction with the Hippo signaling pathway.

[0060] The above description is merely a preferred embodiment of the present invention and is not intended to limit the patent scope of the present invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Use of USP32 gene in preparation of a diagnostic kit for triple negative breast cancer (TNBC).

2. Use according to claim 1, characterized in that, The diagnostic kit is used to detect the expression level of USP32 gene in tissue sample of suspected triple negative breast cancer patient by Western blot or quantitative PCR technology, wherein the expression level of USP32 gene is positively correlated with the incidence of triple negative breast cancer.

3. Use of USP32 gene in preparation of a prognostic evaluation kit for triple negative breast cancer (TNBC).

4. Use according to claim 3, characterized in that, The prognostic evaluation kit is used to detect the expression level of USP32 gene in tissue sample of triple negative breast cancer patient by Western blot or quantitative PCR technology, wherein the expression level of USP32 gene is negatively correlated with the survival period of the patient.

5. Use according to claim 1 or 3, characterized in that, The kit contains specific primers for amplifying USP32 gene, and the primer sequences are shown in SEQ ID NO: 1 and SEQ ID NO:

2.

6. Use of an inhibitor of USP32 gene expression level in preparation of a drug for treating triple negative breast cancer.

7. Use of an inhibitor of USP32 gene expression level in preparation of a drug for inhibiting proliferation, invasion or metastasis of triple negative breast cancer cells.

8. Use according to claim 6 or 7, characterized in that, The inhibitor includes siRNA, shRNA, sgRNA or antisense oligonucleotide that specifically targets USP32 gene.

9. Use according to claim 8, characterized in that, The sequence of the siRNA is shown in SEQ ID NO: 3 and SEQ ID NO:

4.

10. A triple negative breast cancer cell line stably knocked down or knocked out for the USP32 gene, characterized in that, The cell line is constructed by the inhibitor of claim 8 or 9, and is used for mechanism research or drug screening of triple negative breast cancer.