Two-stage biofilm reaction device and method for rapidly enriching Coammox and coupling Anammox

Abstract

The invention discloses a two-stage biofilm reaction device and method for rapidly enriching Coammox and coupling Anammox. The method comprises the following steps: S1, providing two closed biofilm reactors as a front-end reactor and a rear-end reactor; s2, introducing wastewater which does not contain organic carbon and takes ammonia nitrogen as a sole nitrogen source into the front-end reactor in a continuous flow manner; s3, controlling water inlet flow and ammonia nitrogen load, so that a first micro-aerobic environment is formed and maintained in the front-end reactor by means of dissolved oxygen carried by inlet water under the condition of not depending on additional aeration, and part of ammonia nitrogen is converted into nitrite nitrogen; s4, introducing effluent of the front-end reactor into a rear-end reactor; and S5, after the rear-end reactor receives the effluent, forming a second micro-aerobic or anoxic environment with the dissolved oxygen concentration lower than that of the front-end reactor, and in the second micro-aerobic or anoxic environment, synchronously enriching Comammox and coupling Anammox to perform a denitrification reaction. The device has the advantages of being simple in structure, extremely low in energy consumption, high in enrichment speed and controllable in flora.

Description

Technical Field

[0001] This invention relates to the fields of wastewater treatment and microbial resource utilization, specifically to a two-stage biofilm reactor and method for rapidly enriching Commammox and coupling Anammox. Background Technology

[0002] Comammox can independently and completely oxidize ammonia nitrogen to nitrate, but its growth rate is extremely slow, resulting in very low abundance in traditional wastewater treatment systems and difficulty in enrichment, thus limiting its widespread application. Meanwhile, anaerobic ammonia oxidation (Anammox) technology, although mature, has slow start-up and strict requirements on the substrate (ammonia nitrogen and nitrite nitrogen ratio). Coupling Comammox and Anammox can form a highly efficient and low-consumption autotrophic denitrification system. However, existing technologies face the following challenges: 1) In a single reactor, the growth of Comammox is easily inhibited by competition from common ammonia-oxidizing bacteria (AOB) and nitrite-oxidizing bacteria (NOB); 2) It is difficult to reconcile the contradiction between the microaerobic conditions required by Comammox and the strictly anaerobic conditions of Anammox; 3) The enrichment cycle is long, making it difficult to meet the timeliness requirements of engineering applications. Currently, there is a lack of a simple device and process that can rapidly and specifically enrich Comammox and achieve efficient coupling with Anammox. Summary of the Invention

[0003] The purpose of this invention is to provide a two-stage biofilm reaction device and method for rapidly enriching and coupling Commammox with Anammox, which can rapidly enrich ammonia-oxidizing bacteria throughout the entire process and achieve stable coupling between them and anaerobic ammonia-oxidizing bacteria.

[0004] In one aspect of the invention, a method for rapidly enriching Commammox and coupling it with Anammox is proposed. According to an embodiment of the invention, the method includes the following steps:

[0005] S1. Provide two closed biofilm reactors connected in series, serving as the front-end reactor and the back-end reactor, respectively;

[0006] S2. Wastewater containing no organic carbon and with ammonia nitrogen as the sole nitrogen source is continuously fed into the front-end reactor.

[0007] S3. Control the influent flow rate and ammonia nitrogen load so that the front-end reactor can form and maintain a first micro-aerobic environment in the reactor by relying on the dissolved oxygen carried by the influent without relying on external aeration, thereby converting part of the ammonia nitrogen into nitrite nitrogen.

[0008] S4. The effluent from the front-end reactor is introduced into the back-end reactor, wherein the effluent contains ammonia nitrogen and nitrite nitrogen;

[0009] S5. After receiving the effluent, the back-end reactor forms a second micro-oxygen or anoxic environment with a dissolved oxygen concentration lower than that of the front-end reactor. Under this environment, Commammox is simultaneously enriched and coupled with Anammox for denitrification reaction.

[0010] This method utilizes two series-connected closed biofilm reactors. By controlling the influent, which is ammonia nitrogen wastewater without organic carbon as the sole substrate, a natural dissolved oxygen gradient is formed in the system using the dissolved oxygen in the influent itself, without relying on any external aeration. The front-end reactor is maintained at a low micro-oxygen level (approximately 0.5 ± 0.1 mg / L), and its main function is to achieve short-cut nitrification, converting some ammonia nitrogen into nitrite nitrogen, providing an ideal substrate mixture (ammonia nitrogen and nitrite nitrogen) for the back-end reaction. After entering the back-end reactor, this mixture further depletes oxygen, creating an even lower micro-oxygen or anoxic environment. Under this specific environment, the back-end reactor can not only perform efficient anaerobic ammonia oxidation denitrification, but more importantly, it creates a selective ecological niche for Commammox that is free from strong competition from AOB and NOB, thereby achieving its rapid enrichment and synergistic symbiosis with Anammox.

[0011] In addition, the method for rapidly enriching Commammox and coupling Anammox according to the above embodiments of the present invention may also have the following additional technical features:

[0012] In some embodiments of the present invention, in step S3, the dissolved oxygen concentration of the first micro-oxygen environment is 0.4-0.6 mg / L.

[0013] In some embodiments of the present invention, in step S1, activated sludge containing ammonia-oxidizing bacteria is inoculated into the front-end reactor, anaerobic ammonia-oxidizing sludge is inoculated into the rear-end reactor, and biofilm formation treatment is performed before continuous flow operation.

[0014] In another aspect of the invention, a reaction apparatus for implementing the method is provided. According to an embodiment of the invention, it includes a front-end biofilm reactor, an intermediate water tank, and a rear-end biofilm reactor connected in series, and a peristaltic pump for pumping water from the intermediate water tank into the rear-end biofilm reactor. The front-end and rear-end biofilm reactors are structurally identical closed reactors. No external aeration or gas injection devices are installed in the two-stage biofilm reactor; dissolved oxygen is regulated solely through influent control and its own hydraulic flow. The intermediate water tank buffers and stabilizes the effluent quality from the front-end biofilm reactor, preventing fluctuations in water quality and quantity from interfering with the rear-end reaction.

[0015] In addition, the reaction apparatus according to the above embodiments of the present invention may also have the following additional technical features:

[0016] In some embodiments of the present invention, the main body material of the front-end biofilm reactor and the back-end biofilm reactor is plexiglass, and the interior of the front-end biofilm reactor and the back-end biofilm reactor is filled with polyurethane sponge, which serves as a biofilm carrier to retain slow-growing microorganisms.

[0017] In some embodiments of the present invention, the volume percentage of the polyurethane foam is 50%-60%.

[0018] In some embodiments of the present invention, both the front-end biofilm reactor and the rear-end biofilm reactor are provided with a water bath temperature control jacket to maintain a stable internal temperature of the reactor and ensure the metabolic activity of microorganisms. The water bath temperature control jacket is used to maintain the internal temperature of the reactor at 28-32°C.

[0019] In some embodiments of the present invention, an online monitoring device is also included in the front-end biofilm reactor and the back-end biofilm reactor. The online monitoring device includes a dissolved oxygen meter and a pH meter, and is connected to a paperless recorder. It can collect and store key parameters of the reaction system in real time, which facilitates precise control of system operation.

[0020] In some embodiments of the present invention, the reaction device adopts a bottom-inlet and top-outlet water method during continuous operation, which effectively alleviates biomass loss. The operation of the device is divided into a biofilm formation stage and a continuous water inlet stage. In the biofilm formation stage, water inlet is stopped after the water reaches the effective volume of the reactor, and stirring begins, which continues for one HRT cycle. After the biofilm adheres to the packing material, the biofilm formation ends. In the continuous water inlet stage, stirring is stopped after the biofilm formation is completed, and the device continues to operate with continuous water inlet.

[0021] Compared with the prior art, the beneficial effects of the present invention are:

[0022] 1) Fast enrichment speed and high specificity: Through a two-level split design and dissolved oxygen gradient regulation, an optimal growth environment is created for Commammox. Experiments show that it can increase the abundance of functional genes by nearly 20 times within 60 days, while effectively inhibiting AOB and NOB.

[0023] 2) Stable system and efficient coupling: The front-end reactor provides a stable ratio of ammonia nitrogen and nitrite nitrogen substrates, while the back-end reactor achieves efficient coupling and stable operation of Commammox and Anammox under suitable low dissolved oxygen conditions.

[0024] 3) Low energy consumption and simple control: The entire process does not require any gas injection or stirring device. Dissolved oxygen regulation relies entirely on simple control of influent flow rate and load, which reduces operating energy consumption and operational complexity.

[0025] 4) The device is simple and easy to promote: the reactor has a standardized structure, no complex internal components, and is easy to process, scale up and apply. Attached Figure Description

[0026] Figure 1 This is a schematic diagram of a two-stage biofilm reactor for rapidly enriching Commammox and coupling Anammox, as described in Embodiment 1 of the present invention.

[0027] Figure 2 This is a comparison diagram of the copy numbers of the Coammox amoA, AOB amoA, NOB nxrB, and Anammox 16S rRNA genes in the coupling system of Embodiment 2 of the present invention at the beginning and end.

[0028] Figure 3 This is a diagram of the activated sludge product added to the front-end reactor in Example 2 of the present invention;

[0029] Figure 4 This is a diagram of the anaerobic ammonia oxidation enriched sludge product added to the downstream reactor in Example 2 of the present invention;

[0030] In the diagram: 1. Front-end reactor, 2. Rear-end reactor, 3. Intermediate water tank, 4. Rear-end inlet peristaltic pump, 5. Front-end inlet peristaltic pump, 6. Paperless recorder, 7. Dissolved oxygen meter, 8. pH meter, 9. Inlet tank, 10. Front-end feed pump pipe, 11. Temperature-controlled jacket, 12. Temperature-controlled jacket inlet, 13. Temperature-controlled jacket outlet, 14. Polyurethane sponge packing, 15. Front-end outlet pump pipe, 16. Rear-end outlet pump pipe, 17. Rear-end feed pump pipe, 18. Outlet tank, 19. Magnetic rotor, 20. Magnetic stirrer, 21. Front-end reactor inlet, 22. Front-end reactor outlet, 23. Rear-end reactor inlet, 24. Rear-end reactor outlet, 25. Cylindrical plexiglass container. Detailed Implementation

[0031] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0032] Example 1

[0033] like Figure 1As shown, a two-stage biofilm reactor for rapid enrichment of Commammox and coupling with Anammox comprises an inlet tank 9, a front-end reactor 1, an intermediate tank 3, a rear-end reactor 2, and an outlet tank 18 connected in sequence. Both the front-end reactor 1 and the rear-end reactor 2 are cylindrical plexiglass containers 25, with an inner diameter of approximately 14 cm, a height of approximately 25 cm, and an effective volume of approximately 3 L. They are equipped with an external water bath temperature control jacket 11, approximately 3 cm thick, with a temperature control accuracy of ±2℃ to maintain stable temperature within the reactor. The temperature control jacket 11 has a temperature control jacket inlet 12 and a temperature control jacket outlet 13, respectively. The reactor interiors are filled with polyurethane sponge packing 14, occupying 50%-60% of the effective volume, to provide a carrier for microbial attachment. Crucially, neither reactor is connected to any form of aeration device or inert gas supply equipment, thus implementing the core design of "no external aeration." Meanwhile, a magnetic rotor 19 and a bottom magnetic stirrer 20 are installed inside the reactor, and a paperless recorder 6 is equipped on the top, which is connected to an online dissolved oxygen meter 7 and a pH meter 8 to realize real-time monitoring and recording of reaction conditions.

[0034] A front-end inlet peristaltic pump 5 is installed between the inlet tank 9 and the front-end reactor 1, and a rear-end inlet peristaltic pump 4 is installed between the intermediate water tank 3 and the rear-end reactor 2. The inlet tank 9 and the front-end reactor 1 are connected by a front-end feed pump pipe 10, one end of which extends into the inlet tank 9, and the other end is connected to the inlet 21 of the front-end reactor. The outlet 22 of the front-end reactor is connected to the intermediate water tank 3 through a front-end outlet pump pipe 15. The intermediate water tank 3 is connected to the inlet 23 of the rear-end reactor through a rear-end feed pump pipe 17. The outlet 24 of the rear-end reactor is connected to the outlet tank 18 through a rear-end outlet pump pipe 16.

[0035] The culture medium is transported from the inlet tank 9 to the front-end reactor 1 by the front-end inlet peristaltic pump 5, then hydraulically propelled into the intermediate water tank 3, and subsequently transported to the rear-end reactor 2 by the rear-end inlet peristaltic pump 4, finally entering the outlet tank 18. The intermediate water tank 3 is used to buffer and stabilize the effluent quality of the front-end biofilm reactor, preventing fluctuations in water quality and quantity from interfering with the downstream reaction.

[0036] Example 2

[0037] A method for rapidly enriching Commammox and coupling Anammox using the apparatus provided in Embodiment 1 includes the following steps:

[0038] S1. Provide two closed biofilm reactors connected in series, which serve as the front-end reactor 1 and the back-end reactor 2, respectively.

[0039] Add the following to front-end reactor 1: Figure 3 The activated sludge shown is added to the downstream reactor 2 as follows: Figure 4The anaerobic ammonia oxidation enrichment of sludge shown was performed at a dosage of 12%-18% of the effective reactor volume. The prepared culture medium was pumped from the inlet tank 9 into both the front-end reactor 1 and the rear-end reactor 2 to an effective volume (3L) using a peristaltic pump. The influent was then stopped, and the magnetic stirrer 20 was started at a rate of 90-110 r / min for approximately one hydraulic retention time (approximately 24 hours) to promote microbial attachment and the formation of a stable biofilm. Stirring was then stopped. This process facilitates biofilm formation on the reactor packing material. Once biofilm formation is successful, stirring is stopped, and continuous influent begins.

[0040] S2. Wastewater containing no organic carbon and with ammonia nitrogen as the sole nitrogen source is continuously fed into the front-end reactor 1.

[0041] After successful biofilm formation, continuous flow operation is implemented. At this time, the artificially synthesized wastewater (i.e., the culture medium in the example) only enters the front-end reactor 1, using a bottom-inlet and top-outlet method. The ammonia nitrogen concentration in the culture medium is controlled at 10–30 mg / L, and it does not contain organic carbon sources. The composition of the culture medium is as follows: 50 mg / L NH4Cl, 50 mg / L KH2PO4, 50 mg / L KCl, 140 mg / L MgSO4×7H2O, 100 mg / L NaCl, 140 mg / L CaCO3×2H2O, 550 mg / L NaHCO3, 1 ml / L trace element I, and 1 ml / L trace element II.

[0042] Trace element I: 34.4 mg / L MnCl4×4H2O, 50 mg / L H3BO3, 70 mg / L ZnCl2, 72.6 mg / L Na2MoO4×2H2O, 20 mg / L CuCl2×4H2O, 24 mg / L NiCl2×6H2O, 80 mg / L CoCl2×6H2O, 1 g / L FeSO4×7H2O.

[0043] Trace element II: 0.5 g / L NaOH, 3 mg / L Na2SeO3×5H2O, 4 mg / L Na2WO4×2H2O.

[0044] S3. Control the influent flow rate and ammonia nitrogen load so that the front-end reactor 1 can form and maintain the first micro-aerobic environment in the reactor by relying on the dissolved oxygen carried by the influent without relying on external aeration, thereby converting part of the ammonia nitrogen into nitrite nitrogen.

[0045] In the front-end reactor 1, the DO was controlled at 0.1-0.5 mg / L, the pH was maintained at 7.2-7.8, and the hydraulic retention time was 24h.

[0046] S4. The effluent from the front-end reactor 1 is introduced into the back-end reactor 2. The effluent contains ammonia nitrogen and nitrite nitrogen.

[0047] S5. After receiving the effluent, the back-end reactor 2 forms a second micro-oxygen or anoxic environment with a dissolved oxygen concentration lower than that of the front-end reactor 1. Under this environment, Commammox is simultaneously enriched and coupled with Anammox for denitrification reaction.

[0048] The dissolved oxygen concentration in the downstream reactor 2 is ≤0.1 mg / L, the pH is maintained at 7.2-7.8, and the hydraulic retention time is consistent between the upstream and downstream reactors (24h). This operation mode can maintain a low dissolved oxygen environment, reduce sludge loss, and achieve synergistic enrichment and efficient denitrification of Commammox and Anammox bacteria.

[0049] Quantitative analysis of the microbial community dynamics in the above-mentioned device:

[0050] S1. On day 0 (start) and day 60 (end) of reactor operation, take 14 of the internal polyurethane sponge packing into a 250mL beaker, add 100mL of pure water to the mark, sonicate several times to detach the biofilm, transfer the mixture to a 50mL centrifuge tube, centrifuge at 8000 rpm for 5 minutes, pour off the supernatant, add pure water again and centrifuge, repeat the above steps 3 times, and retain the sludge sample.

[0051] S2. Select the Commammox amoA, AOB amoA, NOB nxrB, and Anammox 16S rRNA genes as target genes. Use specific primers: comamoA AF / comamoA SR (upstream primer: comamoA AF: AGGNGAYTGGGAYTTCTGG, downstream primer: comamoA SR: CCGVACATACATRAAGCCCAT), amoA 1F / amoA 2R (upstream primer: amoA 1F: GGGGTTTCTACTGGTGGT, downstream primer: amoA 2R: CCCCTCKGSAAAGCCTTCTTC), 169F / 638R (upstream primer: 169F: TACATGTGGTGGAACA, downstream primer: CGGTTCTGGTCRATCA), Amx368f / The Amx820r primer (upstream primer: Amx368f: TTCGCAATGCCCGAAAGG, downstream primer: Amx820r: AAAACCCCTCTACTTAGTGCCC) was commissioned to Sangon Biotech (Shanghai) Co., Ltd. for quantitative analysis of four target genes using real-time PCR. The reaction conditions were: 95℃ pre-denaturation for 4 min, 95℃ denaturation for 10 s, 67℃ annealing for 20 s, and 72℃ extension for 30 s, for a total of 10 cycles, with the temperature decreasing by 1℃ per cycle. Then, 95℃ denaturation for 10 s, 57℃ annealing for 20 s, and 72℃ extension for 30 s were repeated, for a total of 35 cycles. The copy numbers of the four target genes were finally obtained.

[0052] like Figure 2 As shown, after a total enrichment culture of 60 days, the number of Commammox amoA gene copies per milligram of sludge increased from 949.65 copies initially to 18361.10 copies on day 60, indicating effective enrichment of ammonia-oxidizing bacteria throughout the process. Furthermore, the AOB amoA gene copy number decreased from 258.22 copies to 15.19 copies. Both conventional NOB and Commammox genomes contain the nxrB gene; therefore, the ratio of Commammox amoA to NOB nxrB was used as a benchmark for comparing the actual Commammox and NOB levels in the reactor. In this invention, this ratio jumped from 0.02 at the beginning to 0.82 at the end, achieving rapid enrichment of Commammox and inhibition of AOB and NOB within just 60 days, thus realizing coupling with Anammox.

[0053] In summary, this invention achieves synchronous coupling of Commammox and Anammox through a two-stage biofilm reactor and an operation mode with low dissolved oxygen and no organic carbon source, significantly improving the Commammox enrichment level and the system's denitrification efficiency. It is also simple to operate, has extremely low energy consumption, and is stable in operation, making it suitable for the efficient denitrification treatment of nitrogen-containing wastewater with low carbon source.

[0054] The above description is merely an example and illustration of the present invention. Those skilled in the art can make various modifications or additions to the specific embodiments described, or use similar methods to replace them, as long as they do not deviate from the structure of the present invention or exceed the scope defined in the claims, all of which should fall within the protection scope of the present invention.

Claims

1. A method for rapidly enriching Commammox and coupling Anammox, characterized in that, Includes the following steps: S1. Provide two closed biofilm reactors connected in series, serving as the front-end reactor and the back-end reactor, respectively; S2. Wastewater containing no organic carbon and with ammonia nitrogen as the sole nitrogen source is continuously fed into the front-end reactor. S3. Control the influent flow rate and ammonia nitrogen load so that the front-end reactor can form and maintain a first micro-aerobic environment in the reactor by relying on the dissolved oxygen carried by the influent without relying on external aeration, thereby converting part of the ammonia nitrogen into nitrite nitrogen. S4. The effluent from the front-end reactor is introduced into the back-end reactor, wherein the effluent contains ammonia nitrogen and nitrite nitrogen; S5. After receiving the effluent, the back-end reactor forms a second micro-oxygen or anoxic environment with a dissolved oxygen concentration lower than that of the front-end reactor. Under this environment, Commammox is simultaneously enriched and coupled with Anammox for denitrification reaction.

2. The method for rapidly enriching Commammox and coupling Anammox according to claim 1, characterized in that: In step S3, the dissolved oxygen concentration in the first micro-oxygen environment is 0.4-0.6 mg / L.

3. The method for rapidly enriching Commammox and coupling Anammox according to claim 1, characterized in that: In step S1, activated sludge containing ammonia-oxidizing bacteria is inoculated into the front-end reactor, anaerobic ammonia-oxidizing sludge is inoculated into the rear-end reactor, and biofilm formation treatment is performed before continuous flow operation.

4. A reaction apparatus for implementing the method according to any one of claims 1-3, characterized in that: The device includes a front-end biofilm reactor, an intermediate water tank, and a rear-end biofilm reactor connected in series, as well as a peristaltic pump for pumping water from the intermediate water tank into the rear-end biofilm reactor. The front-end and rear-end biofilm reactors are closed reactors with the same structure. No external aeration devices or gas dosing devices are installed in the two-stage biofilm reactor. The intermediate water tank is used to buffer and stabilize the effluent quality from the front-end biofilm reactor.

5. The reaction apparatus according to claim 4, characterized in that: The main body of the front-end biofilm reactor and the back-end biofilm reactor are made of plexiglass, and the interior of the front-end biofilm reactor and the back-end biofilm reactor are filled with polyurethane foam.

6. The reaction apparatus according to claim 5, characterized in that: The volume percentage of the polyurethane foam is 50%-60%.

7. The reaction apparatus according to claim 4, characterized in that: Both the front-end and rear-end biofilm reactors are equipped with a water bath temperature control jacket, which is used to maintain the internal temperature of the reactor at 28-32℃.

8. The reaction apparatus according to claim 4, characterized in that: It also includes online monitoring devices installed in the front-end biofilm reactor and the back-end biofilm reactor. The online monitoring devices include a dissolved oxygen meter and a pH meter, and the online monitoring devices are connected to a paperless recorder.

9. The reaction apparatus according to claim 4, characterized in that: The reaction device operates continuously with water entering from the bottom and exiting from the top.

Images