Application of fulvic acid and chitin compound liquid in inducing disease resistance of crops
By spraying a compound solution of fulvic acid and chitin, the expression of defense genes in rice and tobacco is induced, which solves the problems of environmental pollution from chemical pesticides and poor water solubility of chitin in existing technologies, and achieves efficient and green control of rice blast and red spot disease.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-15
- Publication Date
- 2026-03-13
AI Technical Summary
Existing chemical pesticides have problems such as high cost and environmental pollution when controlling rice blast and tobacco red spot disease. Furthermore, the application potential of fulvic acid in inducing plant disease resistance has not been fully utilized, and the poor water solubility of chitin limits its widespread use.
A compound solution of fulvic acid and chitin was developed, with a formulation of 200 μg/mL fulvic acid + 7.5 μg/mL chitin, which was used to spray rice and tobacco to induce the expression of defense-related genes and enhance crop resistance.
It significantly reduces the affected area of rice blast and red spot disease. The control effect of the compound solution of fulvic acid and chitin is better than that of fulvic acid alone, providing a low-toxicity, safe and green control method.
Smart Images
Figure CN121653137A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of green prevention and control technology for crop diseases, specifically the application of a compound solution of fulvic acid and chitin in inducing disease resistance in crops. The compound solution of fulvic acid and chitin can induce the expression of defense-related genes in rice and tobacco, thereby enabling the application of the developed formulation in enhancing the disease resistance of rice and tobacco. Background Technology
[0002] Rice is a major food crop in my country and globally. Rice blast, caused by Magnaphalthe oryzae, is considered the most significant fungal disease threatening rice production. Rice blast causes huge yield losses every year, with severe outbreaks leading to yield reductions of 40%-50% or even total crop failure, seriously impacting food security. Tobacco is an important economic crop worldwide, and the tobacco industry is a significant source of revenue for many countries. The systematic and standardized management of the tobacco industry imposes strict requirements on the low pesticide residues and safety of field disease control agents. Red spot disease is a major fungal disease in tobacco production, seriously threatening the yield and quality of tobacco leaves, thus affecting the stability of the entire industrial chain from planting, purchasing, re-drying, processing to sales. Red spot disease produces lesions on leaves, causing leaf damage, thinning, reduced oil content, and loss of aroma substances. In severe cases, the lesions merge, leading to leaf death and abscission, reducing processing usability.
[0003] Chemical pesticides are commonly used to control diseases in crop production. For example, tricyclazole, isoprothiolane, and isoprothiolane are often used to control rice blast; while polyoxin, benzoyl permethrin, and cymoxanil are commonly applied to control tobacco red spot disease. The excessive use of chemical pesticides not only increases production costs but also has adverse effects on agricultural ecology and food safety.
[0004] With the increasing awareness of food and ecological safety among people, the research and development of new green pesticides that are low in toxicity and environmentally friendly has attracted much attention and has gradually become a trend in the field of plant protection. Fulvic acid is a type of humic acid with high activity, high water solubility, and low molecular weight. It contains abundant organic functional groups, including carboxyl, phenolic hydroxyl, amino, and methoxy groups. These groups constitute the chemical basis for the high bioactivity of fulvic acid. Among them, the carboxyl group, as the most abundant acidic functional group in fulvic acid, can release H⁺ through dissociation and form stable complexes with metal cations such as Ca²⁺, Fe³⁺, and Al³⁺ in the soil; the phenolic hydroxyl group, with its reducing properties, effectively scavenge free radicals, participates in redox reactions, thereby enhancing the crop's stress resistance, protecting enzyme system activity, and promoting photosynthetic efficiency; the amino group has affinity properties and can bind to plant metabolic intermediates, promoting amino acid synthesis and participating in the regulation of plant hormone pathways. Therefore, fulvic acid is often used as a multifunctional soil conditioner and plant growth regulator. Fulvic acid can be classified into mineral-derived fulvic acid and biochemical fulvic acid based on its source. Biochemical fulvic acid is a humic acid-like substance mainly prepared by microbial fermentation of industrial and agricultural organic waste (such as sugarcane molasses and bagasse). It is usually brown in color, has a stable composition, and mainly contains fulvic acid, amino acids, and enzyme-active components. Biochemical fulvic acid has a wide range of applications in agriculture and environmental protection. However, the role and application potential of fulvic acid in inducing plant disease resistance remain unclear.
[0005] Chitin, a natural high-molecular-weight polysaccharide, is the main active ingredient of chitin. Chitin can be sensed by recognition receptor proteins or kinases located on plant cell membranes, thereby activating the plant's basic defense response through a series of phosphorylation signal transductions. However, chitin's extremely low water solubility severely limits its widespread use in agricultural production. Therefore, selecting a solubilizer compatible with chitin activity to enhance plant resistance induction is a key technical challenge for effectively utilizing chitin to control crop diseases. Summary of the Invention
[0006] The purpose of this invention is to provide the application of a compound solution of fulvic acid and chitin in inducing disease resistance in crops. Spraying with this compound solution can induce the expression of defense-related genes in rice and tobacco, thereby improving the resistance of rice to rice blast and tobacco to red spot disease.
[0007] To achieve the above objectives, the technical solution adopted by the present invention is: a compound solution of fulvic acid and chitin, wherein the compound solution is formulated as follows: fulvic acid mass concentration of 200 μg / mL + chitin mass concentration of 7.5 μg / mL.
[0008] The second objective of this invention is to provide a method for preparing a compound solution of fulvic acid and chitin. The method involves dissolving biochemical fulvic acid in water to obtain a fulvic acid aqueous solution with a concentration of 20 mg / mL, adding 75 mg of chitin to 100 mL of the fulvic acid aqueous solution until completely dissolved, and diluting the solution 100 times to obtain a fulvic acid and chitin compound solution with a fulvic acid concentration of 200 μg / mL and a chitin concentration of 7.5 μg / mL.
[0009] The third objective of this invention is to provide the application of a compound solution of fulvic acid and chitin (200 μg / mL fulvic acid + 7.5 μg / mL chitin) in inducing resistance to rice blast. Three-week-old rice seedlings were treated with either 200 μg / mL fulvic acid or the compound solution of fulvic acid and chitin, with 0.4–0.5 mL sprayed per seedling. One day later, the seedlings were inoculated with a suspension of rice blast fungus spores. After culturing under high humidity and darkness for 24 hours, the seedlings were transferred to an artificial climate greenhouse for normal cultivation for 4 days, and the affected area was statistically analyzed. The results showed that pretreatment with the compound solution of fulvic acid and chitin significantly reduced the affected area of rice blast, and the control effect of the compound solution of fulvic acid and chitin on rice blast was significantly better than that of fulvic acid alone.
[0010] The fourth objective of this invention is the application of a compound solution of fulvic acid and chitosan (200 μg / mL fulvic acid + 7.5 μg / mL chitosan) in inducing resistance to Tobacco Star Disease. Five-week-old Tobacco Benedictine plants were treated with 200 μg / mL fulvic acid or the compound solution of fulvic acid and chitosan, with 1.8–2.0 mL sprayed per plant. One day later, they were inoculated with a spore suspension of the Tobacco Star Disease pathogen. After 24 hours of humidified and light-treated culture, they were transferred to an artificial climate greenhouse for normal culture for 3 days. Trypan blue staining (to visualize cell death tissue caused by leaf disease) and disease area statistics were then performed. The results showed that pretreatment with the fulvic acid and chitosan compound solution significantly reduced the diseased area of Tobacco Star Disease.
[0011] The beneficial technical effects of this invention are as follows: This invention has developed a compound solution of fulvic acid and chitin that can be used as a plant resistance inducer, and verified its application effect and usage method in controlling crop diseases. The preparation method of the compound solution of fulvic acid and chitin developed in this invention is simple, and it can provide a low-toxicity, safe and effective organic preparation and a more efficient compound preparation combination for the green control of diseases in agricultural production. Attached Figure Description
[0012] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0013] Figure 1 Results of the induction of defense-related gene expression in rice seedlings pretreated with fulvic acid or a mixture of fulvic acid and chitin (different lowercase letters in the figure indicate significant differences between samples, P<0.01, Student's t-test).
[0014] Figure 2 Pretreatment with fulvic acid or a mixture of fulvic acid and chitin enhances rice resistance to rice blast fungus. A. Rice seedlings were treated with a mixture of Mock (water), 200 μg / mL fulvic acid aqueous solution, or 200 μg / mL fulvic acid + 7.5 μg / mL chitin for one day, followed by inoculation with rice blast fungus spore suspension. Leaf images were taken 5 days after the onset of the disease. B. Statistical analysis of the percentage of diseased leaf area (different lowercase letters in the figure indicate significant differences between samples, P<0.01, Student's t-test).
[0015] Figure 3 Results of the induction of defense-related gene expression in tobacco plants pretreated with fulvic acid or a mixture of fulvic acid and chitin (different lowercase letters in the figure indicate significant differences between samples, P<0.01, Student's t-test).
[0016] Figure 4 Pretreatment with fulvic acid or a mixture of fulvic acid and chitin enhances tobacco's resistance to *Anoectochilus rubrum*. A. After treating *Tobacco Benzoenta* with a mixture of Mock (water), 200 μg / mL fulvic acid, or 200 μg / mL fulvic acid + 7.5 μg / mL chitin for one day, the tobacco was inoculated with a suspension of *Anoectochilus rubrum* spores. The leaves were photographed four days after the onset of disease (top image). After decolorization, the leaves were stained with trypan blue to show the areas of cell death caused by the disease (bottom image). B. Based on the trypan blue staining results, the percentage of diseased leaf area was calculated (different lowercase letters in the figure indicate significant differences between samples, P < 0.01, Student's-test). Detailed Implementation
[0017] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0018] Example 1
[0019] Preparation of fulvic acid and chitin compound solution
[0020] 2 g of biochemical fulvic acid was dissolved in 100 mL of water to obtain a fulvic acid stock solution with a concentration of 20 mg / mL and a pH of 4.6, indicating weak acidity. 75.0 mg of chitosan was added to 100 mL of the fulvic acid stock solution and dissolved completely to obtain a stock solution of a compound preparation containing 20 mg / mL chitosan and 0.75 mg / mL chitosan. Diluting the fulvic acid stock solution and the compound preparation stock solution 100 times yielded a fulvic acid and chitosan compound solution.
[0021] Example 2
[0022] Pretreatment with a mixture of fulvic acid and chitin induced the expression of defense-related genes in rice.
[0023] Three-week-old rice seedlings (japonica variety Zhonghua 11) were pretreated with fulvic acid (200 μg / mL) or a mixture of fulvic acid and chitin (200 μg / mL fulvic acid + 7.5 μg / mL chitin) at a rate of 0.5 mL per seedling. Water was sprayed simultaneously as a control (Mock). One day after treatment, total RNA was extracted from rice leaves, reverse-engineered into total cDNA, and the expression level of defense genes was detected.
[0024] RNA extraction procedure: The leaf tissue was homogenized into a powder using a tissue homogenizer. 1 mL of Trizolup solution was added to each tube, and the mixture was vigorously vortexed and allowed to stand at room temperature for 5 minutes. 0.2 mL of chloroform was added, and the mixture was vigorously vortexed for 30 seconds. After standing at room temperature for 3 minutes, the mixture was centrifuged at 12000 rpm for 15 minutes. The supernatant was transferred to a new centrifuge tube, and 0.5 mL of isopropanol was added. The mixture was inverted and allowed to stand at room temperature for 10 minutes. After centrifugation at 12000 rpm for 10 minutes, the supernatant was removed. 1 mL of 75% ethanol was added, and the mixture was vortexed vigorously and centrifuged at 12000 rpm for 5 minutes. The supernatant was discarded, and the precipitate was allowed to dry at room temperature for 5 minutes. 100 μL of RNA lysis buffer was added. After complete RNA dissolution, the RNA concentration and purity were determined using a micro spectrophotometer. The samples were stored at -80°C for long-term use. Total RNA was reverse transcribed into cDNA, and the reaction system is shown in Table 1.
[0025] Table 1 Reverse transcription reaction system
[0026] Components volume RNA samples 2 μg Random Primer (N9) 1 μL 2×ES Reaction Mix 10 μL EasyScript RT / RI Enzyme Mix 1 μL gDNA Remover 1 μL RNase-free water Up to 20 μL
[0027] Gently mix, incubate at 42 °C for 15 minutes, then heat at 85 °C for 5 seconds to terminate the reaction. Store at -20 °C for later use. Design specific primers (Table 2), and use real-time quantitative PCR (qRT-PCR) with OsUBQ as an internal reference gene to detect the relative transcriptional changes of OsPR1a and OsPAL6. The reaction system is shown in Table 3.
[0028] Table 2 Primer sequences for OsPR1a and OsPAL6 real-time quantitative PCR
[0029] Primer name Primers (5'-3') OsPR1a-F CGTCTTCATCACCTGCAACTACTC OsPR1a-R CATGCATAAACACGTAGCATAGCA OsPAL6-F CCCTGCCAATCTGCTGAACTA OsPAL6-R GCCGCTATGCAACGAAGAAT OsUBQ-F CGCAAGAAGAAGTGTGGTCA OsUBQ-R GGGAGATAACAACGGAAGCA
[0030] Table 3 Real-time quantitative PCR reaction system
[0031] Components volume cDNA template 2 μL Primer F (10 μM) 0.4 μL Primer R (10 μM) 0.4 μL 2×TransStart Top / Tip Green qPCR SuperMix 10 μL <![CDATA[Nuclease-free H2O]]> Up to 20 μL
[0032] The qRT-PCR reaction was as follows: 94 °C pre-denaturation for 30 seconds, 94 °C denaturation for 5 seconds, 55 °C annealing for 15 seconds, 72 °C extension for 10 seconds, for 40-45 cycles from denaturation to extension. The rice Ubiquitin (UBQ, LOC_Os03g13170) gene cDNA was used as an internal control, and 2... -ΔΔct The method is used for calculation and analysis.
[0033] like Figure 1 As shown, compared with the control treatment, fulvic acid treatment can significantly induce the upregulation of the expression of rice defense-related genes OsPR1a and OsPAL6; the compound preparation of fulvic acid and chitin has a stronger inducing effect on the expression of OsPR1a and OsPAL6. Among them, the induction of OsPR1a gene by fulvic acid alone is 2.7 times that of the control, while the compound preparation of fulvic acid and chitin is 21.6 times that of the control.
[0034] Example 3
[0035] Pretreatment with a compound solution of fulvic acid and chitin can effectively control the occurrence of rice blast.
[0036] Three-week-old rice seedlings were treated with fulvic acid (200 μg / mL) or a mixture of fulvic acid and chitin (200 μg / mL fulvic acid + 7.5 μg / mL chitin) by spraying at a rate of 0.5 mL per seedling. Water was sprayed simultaneously as a control (Mock). One day after treatment, the inoculation concentration was 2 × 10⁻⁶. 5A suspension of *Magnapordica oryzae* (Guy11 strain) spores per mL was prepared. After inoculation, the spores were cultured in a dark, humid, and sealed environment at 25°C for 24 hours. Then, the spores were transferred to a greenhouse with normal light and artificial climate for another 4 days before the affected area was counted.
[0037] like Figure 2 As shown, compared with the control treatment, the pretreatment with the compound solution of fulvic acid and chitin can significantly reduce the area affected by rice blast. The lesion area treated with fulvic acid alone was reduced by 40% compared with the control, while the lesion area treated with the compound solution of fulvic acid and chitin was reduced by 86% compared with the control, indicating that the compound solution of fulvic acid and chitin has a better effect on controlling the occurrence of rice blast.
[0038] Example 4
[0039] Pretreatment with a mixture of fulvic acid and chitin induces the expression of tobacco defense-related genes.
[0040] Five-week-old Nicotiana benthamiana plants were treated with fulvic acid (200 μg / mL) or a mixture of fulvic acid and chitin (200 μg / mL fulvic acid + 7.5 μg / mL chitin) at a rate of 2.0 mL per plant. Water was sprayed simultaneously as a control (Mock). One day after treatment, total RNA was extracted from treated tobacco leaves and reverse-engineered into total cDNA. The relative expression level of the defense-related gene NtPR1 was detected using NtEF-1a as an internal reference gene. The gene-specific primer sequences used are shown in Table 4.
[0041] Table 4 Primer sequences for NtPR1 and NtEF-1a real-time quantitative PCR
[0042] Primer name Primers (5'-3') NtPR1-F TGTTGAGATGTGGGTCGATGA NtPR1-R TTACGCCAAACCACCTGAGT NtEF-1a-F ATTGGAAACGGATATGCTCCA NtEF-1a-R TCCTTACCTGAACGCCTGTCA
[0043] like Figure 3 As shown, fulvic acid alone can induce a significant upregulation of NtPR1 expression, with an upregulation level of 2.8 times compared to the control. The compound solution of fulvic acid and chitin has a stronger inducing effect on NtPR1 gene expression, with an upregulation level of 19.4 times compared to the control, indicating that the compound solution of fulvic acid and chitin has a stronger resistance induction effect.
[0044] Example 5
[0045] Pretreatment with a compound solution of fulvic acid and chitin can effectively prevent the occurrence of tobacco red spot disease.
[0046] Five-week-old Nicotiana benthamiana plants were treated with fulvic acid (200 μg / mL) or a mixture of fulvic acid and chitin (200 μg / mL fulvic acid + 7.5 μg / mL chitin) at a rate of 2.0 mL per plant. Water was sprayed simultaneously as a control (Mock). One day after treatment, the inoculation concentration was 1.5 × 10⁻⁶. 5 A suspension of *Aureobasidium adenophorum* spores per mL was prepared. After inoculation, the samples were cultured in a light and high-humidity environment for 24 hours, then transferred to an artificial climate greenhouse for further culture for 3 days before trypan blue staining and disease area assessment.
[0047] like Figure 4 As shown, compared with the control treatment, spraying fulvic acid alone or pretreatment with a mixture of fulvic acid and chitin can significantly reduce the affected area of tobacco red spot disease.
[0048] Finally, it should be noted that the above embodiments are only used to illustrate and not limit the technical solutions of the present invention. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the present invention without departing from the spirit and scope of the present invention. Any modifications or partial substitutions should be covered within the scope of the claims of the present invention.
Claims
1. The application of a compound solution of fulvic acid and chitin in inducing resistance to rice blast, characterized in that, When rice plants were treated with the fulvic acid and chitin compound solution, the expression of rice defense-related genes OsPR1a and OsPAL6 was significantly upregulated in response to the fulvic acid and chitin compound solution.
2. The application of a compound solution of fulvic acid and chitin in inducing resistance to tobacco leaf spot, characterized in that, When tobacco plants were treated with the compound solution of fulvic acid and chitin, the expression of the tobacco defense-related gene NtPR1 was significantly upregulated in response to the induction of the compound solution.
3. A compound solution of fulvic acid and chitin, characterized in that, The compound solution is formulated as follows: fulvic acid with a mass concentration of 200 μg / mL + chitin with a mass concentration of 7.5 μg / mL.
4. A method for preparing a compound solution of fulvic acid and chitin, characterized in that, Weigh out biochemical fulvic acid and dissolve it in water to obtain a fulvic acid aqueous solution with a concentration of 20 mg / mL. Add 75 mg of chitin to 100 mL of fulvic acid aqueous solution and dissolve it completely. Dilute it 100 times to obtain a fulvic acid and chitin compound solution with a fulvic acid mass concentration of 200 μg / mL and a chitin mass concentration of 7.5 μg / mL.