CRISPR (clustered regularly interspaced short palindromic repeats) light-operated one-tube detection kit based on G4-crRNA / AZD < + + > and detection method
By designing a G4-crRNA/AZD++ chimeric structure in a CRISPR system, shutting down the Cas12a system, and combining it with photocontrolled activation, we achieved highly sensitive and specific nucleic acid detection. This solved the efficiency and sensitivity issues of isothermal amplification and CRISPR detection in a single tube, making it suitable for rapid detection of various biological samples.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-31
- Publication Date
- 2026-03-13
AI Technical Summary
When existing isothermal nucleic acid amplification and CRISPR detection are performed in a single tube, the amplification efficiency and detection sensitivity decrease, and there is a risk of aerosol contamination, which current strategies have not effectively addressed.
The CRISPR light-controlled one-tube detection kit using G4-crRNA/AZD++ is used. By designing a G4 sequence at the 3' or 5' end of the crRNA and chimerizing it with AZD++, the Cas12a system is turned off to prevent it from cutting the amplification template and primers. After pre-amplification, Cas12a is activated by ultraviolet light to cut the fluorescent reporter probe and generate a fluorescent signal.
It improves the sensitivity and specificity of nucleic acid testing, avoids aerosol contamination, simplifies the operation process, shortens the testing time, and is suitable for rapid detection of various biological samples.
Smart Images

Figure CN121653231A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biological nucleic acid detection, specifically relating to a method based on G4-crRNA / AZD. ++ The CRISPR / Cas12a light-controlled one-tube detection kit and detection method. Background Technology
[0002] Rapid, sensitive, and specific nucleic acid detection has broad application prospects in clinical diagnosis, biomedical research, and drug development. Currently, nucleic acid detection methods mainly rely on polymerase chain reaction (PCR). PCR has good sensitivity and specificity, but it requires a temperature cycling process and has a long detection time. To address this, researchers have developed isothermal nucleic acid amplification technology. This isothermal reaction process only requires a simple temperature-controlled template, and isothermal nucleic acid amplification is generally faster than PCR. However, it is still difficult to compare with PCR in terms of detection sensitivity and specificity.
[0003] To address this issue, isothermal amplification reactions are typically combined with CRISPR detection to improve the sensitivity and specificity of nucleic acids. The CRISPR / Cas system is an acquired immune system found in bacteria and archaea, capable of cleaving invading foreign genetic material to defend against viral infections. Because it can precisely identify and specifically cleave target nucleic acids (cis-activity), and activated CRISPR systems, such as Cas12 and Cas13, also possess the ability to non-specifically cleave surrounding single-stranded DNA or RNA (trans-activity), it can produce signal amplification, which is highly advantageous for improving the detection sensitivity of isothermal nucleic acid amplification. Thanks to these superior properties, a series of CRISPR-based diagnostic platforms, such as DETECTR, HOLMES, and SHERLOCK, have been used to detect specific DNA and RNA, and to utilize fluorescent probes as alternative driving processes to generate detectable output signals. However, early CRISPR diagnostic technologies separated nucleic acid amplification and CRISPR detection steps, resulting in complex procedures and the risk of aerosol contamination from opening the lid, leading to false positive results. Therefore, performing isothermal amplification and CRISPR detection in one tube achieves a one-step process from sample input to result output. This simplifies the operation process and improves detection specificity, which is of great significance for high-performance nucleic acid analysis.
[0004] However, when isothermal amplification and CRISPR detection are performed in a single tube, the CRISPR system targets and cleaves the isothermal amplification products, which serve as templates for the next round of isothermal amplification, leading to reduced amplification efficiency. Furthermore, the activated CRISPR system can non-specifically cleave nucleic acid amplification primers, further reducing yield efficiency and ultimately decreasing detection sensitivity. Some researchers have attempted to address this by physically separating reaction reagents, using phase separation solutions, or employing suboptimal proto-spacer neighbor motifs (PAMs). Despite these advancements, these strategies still inconvenience or sacrifice the efficiency of the CRISPR reaction. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the background art above, and to provide a highly sensitive and versatile G4-crRNA / AZD-based solution. ++ The CRISPR light-controlled one-tube detection kit and detection method.
[0006] To solve the above-mentioned technical problems, the technical solution proposed by this invention is as follows: A G4-crRNA / AZD-based ++ The CRISPR light-controlled one-tube detection kit contains the following components: G4-crRNA / AZD ++ Cas12a protease, RPA (recombinase polymerase) isothermal amplification reagent, buffer solution and fluorescent reporter probe.
[0007] The above-mentioned detection kit, preferably, contains G4-crRNA / AZD ++ Composed of G4-crRNA and AZD ++ The G4-crRNA was obtained after mixing and incubation; the nucleotide sequence of the G4-crRNA is specifically complementary to the target nucleotide sequence of the analyte, and the 3' or 5' end has the nucleotide sequence GGGUUAGGGUUAGGGUUAGGG (G4 sequence).
[0008] More preferably, when the target substance to be tested is human herpesvirus EBV, the G4-crRNA / AZD ++ The nucleotide sequence of G4-crRNA is shown in SEQ ID NO. 1; when the target substance is human cytomegalovirus (HCMV), the G4-crRNA / AZD... ++ The nucleotide sequence of G4-crRNA is shown in SEQ ID NO. 2; when the target substance is influenza A virus (IAV), the G4-crRNA / AZD... ++ The nucleotide sequence of G4-crRNA is shown in SEQ ID NO. 3.
[0009] Preferably, the Cas12a protease includes at least one of LbCas12a, AsCas12a, FnCas12a, and ErCas12a; the RPA isothermal amplification reagent includes RPA amplification primers for the target analyte, RPA amplification raw materials, RPA amplification buffer solution, and RPA amplification enzyme; the amplification primers are designed according to the nucleotide sequence of the target analyte, and the primer length is generally required to be 30-35 nt, the primer GC content is 40%-60%, and the length of the amplification product is less than 500 bp, for example: When the target substance to be tested is human herpesvirus EBV, the nucleotide sequences of the amplification primers for the target substance to be tested are shown in SEQ ID NO. 4 and SEQ ID NO. 5; When the target analyte is cytomegalovirus (HCMV), the nucleotide sequences of the amplification primers for the target analyte are shown in SEQ ID NO. 6 and SEQ ID NO. 7. When the target substance to be tested is influenza A virus (IAV), the nucleotide sequences of the amplification primers for the target substance are shown in SEQ ID NO. 8 and SEQ ID NO. 9.
[0010] Preferably, the buffer solution comprises the following components: 10~50 mM Tris-HCl, 5~50 mM NaCl, 10~50 mM MgCl2, 1.0~5.0 mM DTT and 5%~20% PEG-200.
[0011] Preferably, the fluorescent reporter probe is a single-stranded reporter probe labeled with a fluorescein and a quenching group. The fluorescein includes any one of FAM, ROX, Cy5, and Cy3 labels, and the quenching group includes any one of BHQ1, BHQ2, and BHQ3 labels. The length of the single-stranded reporter probe is 5-30 nt. More preferably, the nucleotide sequence of the fluorescent reporter probe is: FAM-CCCCCC-BHQ1.
[0012] The detection kit provided in this invention is suitable for one-tube nucleic acid detection technology using light-controlled CRISPR / Cas12 system activity. This invention adds a G4 sequence to the 3' or 5' end of the crRNA. This sequence structure can intercalate with a divalent azobenzene derivative (AZD++), creating significant steric hindrance and thus shutting down the Cas12a system. Therefore, during the RPA isothermal amplification reaction, the CRISPR / Cas12a system is in a switched-off state, effectively preventing it from specifically cleaving the amplification template and non-specifically cleaving the amplification primers. After pre-amplification, the CRISPR / Cas12a reaction can be activated by 365 nm ultraviolet light. Subsequently, the Cas12 nuclease rapidly cleaves the ssDNA-FQ fluorescent reporter gene, generating a bright fluorescent signal. Because the nucleic acid amplification reaction is not interfered with by the CRISPR system, this method effectively improves the sensitivity of nucleic acid detection while avoiding aerosol contamination.
[0013] Based on a general inventive concept, the present invention also provides a method based on G4-crRNA / AZD. ++ The CRISPR-based one-tube optical detection method includes the following steps: (1) Add the G4-crRNA / AZD from the detection kit. ++ The Cas12a protease, RPA isothermal amplification reagent, buffer solution, fluorescent reporter probe and the sample to be tested were mixed to prepare a reaction system; (2) The reaction system described in step (1) is first pre-amplified, and then the entire system is irradiated with ultraviolet light to activate the CRISPR system and perform real-time fluorescence monitoring; at the same time, a blank control group without the test sample is set up to react under the same conditions; if the fluorescence signal in the test sample is observed to change relative to the blank control group, it is determined that the test sample contains the target analyte; otherwise, it is determined that the test sample does not contain the target analyte.
[0014] In the above detection method, preferably, in step (1), the G4-crRNA / AZD ++ Composed of G4-crRNA and AZD ++ Mix and incubate at 90-97 ℃, then gradually cool to room temperature or 4 ℃ to obtain the product; in G4-crRNA / AZD ++ In the context, the AZD ++ The concentration is 100~300 µM; the sample to be tested is a pathogenic microorganism, nucleic acid, tissue or blood.
[0015] Preferably, in step (1), the process of preparing the reaction system is as follows: the sample to be tested is first annealed, then placed at -80~4 ℃, and then reacted with the G4-crRNA / AZD ++The Cas12a protease, RPA isothermal amplification reagent, buffer solution, and fluorescent reporter probe were mixed.
[0016] Preferably, in step (1), the concentration of the sample to be tested in the reaction system is designed as needed, and the RPA isothermal amplification reagent includes: RPA dry powder, RPA buffer solution, and 1 μL each of RPA forward and reverse primers. The G4-crRNA / AZD ++ The concentration of the Cas12a protease is 0.5-2 µM, the concentration of the fluorescent reporter probe is 0.2-2 µM, and the remainder is DEPC water.
[0017] Preferably, in step (2), the pre-amplification time is 10~30 min, the ultraviolet irradiation time is 30~90 s, the mixing reaction temperature is 25~60 ℃, and the reaction time is 0.5~3 h.
[0018] In S3, the standard for determining whether the sample contains the target analyte is that the sample produces a fluorescence signal that gradually increases over time. If the fluorescence signal is generated, the sample contains the target analyte. The faster the fluorescence signal is generated, the higher the concentration of the target analyte in the sample. If there is no obvious fluorescence signal, the sample does not contain the target analyte.
[0019] This invention uses G4-crRNA / AZD ++ This method enhances the reactivity of the CRISPR / Cas12a system, thereby improving the specificity and sensitivity of detection. During the isothermal amplification reaction, the CRISPR / Cas12a system is in a switched-off state, effectively preventing it from specifically cleaving the amplification template and non-specifically cleaving the amplification primers. After pre-amplification, the CRISPR / Cas12a reaction can be activated by 365 nm ultraviolet light. Subsequently, the Cas12a nuclease rapidly cleaves the ssDNA-FQ reporter probe, generating a bright fluorescent signal. Because the nucleic acid amplification reaction is not interfered with by the CRISPR system, this method effectively improves the sensitivity of nucleic acid detection while avoiding aerosol contamination.
[0020] The detection method of this invention combines nucleic acid amplification signal amplification technology with light-controlled activation of the CRISPR system, reducing the loss from cis- and trans-cleavage of Cas protease. This enables rapid detection of targets in various samples, providing a foundation for establishing a detection method that is low-cost, simple, versatile, highly sensitive, and specific.
[0021] Compared with the prior art, the beneficial effects of the present invention are as follows: 1. The invention provides a G4-crRNA / AZD-based system. ++The CRISPR / Cas12a light-controlled one-tube detection kit uses fluorescently labeled single-stranded nucleotides as fluorescent reporter probes, utilizing G4-crRNA / AZD... ++ The different spatial conformations before and after UV irradiation enable the photo-controlled activity of the CRISPR system. After RPA isothermal amplification, the CRISPR system is activated by light irradiation. The Cas protease is activated after recognizing a specific activator, thereby stimulating its trans-cleavage ability to non-specifically cleave more fluorescent reporter probes, generating a fluorescent signal output. Since the nucleic acid amplification is not interfered with by the CRISPR system, this process can significantly improve the detection sensitivity of the target, and has high specificity, effectively shortening the detection time and strong versatility.
[0022] 2. The detection method of the present invention can be applied to the detection of various biological samples for non-diagnostic purposes. The samples to be tested include laboratory samples such as pathogenic microorganisms, cells, tissues or blood in various samples, such as EBV, HCMV and IAV in bronchoalveolar lavage fluid. It can be applied to non-diagnostic scenarios such as living environment, vegetable market, public area, laboratory, etc. It is simple and convenient to operate, highly sensitive and efficient in detection, and can effectively reduce potential risks. Attached Figure Description
[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0024] Figure 1 This invention is based on G4-crRNA / AZD ++ Schematic diagram of the CRISPR / Cas12a light-controlled tube detection method.
[0025] Figure 2 These are different concentrations of AZD in the examples. ++ Effect on the reaction rate of the CRISPR / Cas12a system.
[0026] Figure 3 This refers to the effect of different UV irradiation times on G4-crRNA / AZD in Example 1. ++ The fluorescence signal recovery of the light-controlled CRISPR system.
[0027] Figure 4 This is a fluorescence signal diagram of the photocontrolled CRISPR / Cas12a system detecting synthetic target sequences at different concentration gradients in the embodiment.
[0028] Figure 5 This is a fluorescence signal diagram of EBV plasmids at different concentration gradients detected by the CRISPR / Cas12a system photocontrolled one-tube method in the embodiment.
[0029] Figure 6 This is a graph showing the detection results of bronchoalveolar lavage fluid samples suspected of containing human herpesvirus EBV, obtained using the qPCR method in this embodiment.
[0030] Figure 7 This is a graph showing the detection results of a bronchoalveolar lavage fluid sample suspected to contain human herpesvirus EBV, obtained using the method of the present invention in this embodiment.
[0031] Figure 8 This is a fluorescence signal diagram of HCMV plasmids at different concentration gradients detected by the CRISPR / Cas12a system photocontrolled one-tube method in the embodiment.
[0032] Figure 9 This is a graph showing the detection results of bronchoalveolar lavage fluid samples suspected to be influenza A virus (IAV) tested using the qPCR method in this embodiment.
[0033] Figure 10 This is a graph showing the detection results of bronchoalveolar lavage fluid samples suspected to be influenza A virus (IAV) tested using the method of the present invention in this embodiment. Detailed Implementation
[0034] To facilitate understanding of the present invention, the present invention will be described more fully and in detail below with reference to the accompanying drawings and preferred embodiments, but the scope of protection of the present invention is not limited to the following specific embodiments.
[0035] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the scope of the invention.
[0036] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.
[0037] Example: A G4-crRNA / AZD-based ++ The CRISPR light-controlled one-tube detection kit contains: 100 nM G4-crRNA / AZD ++ The reagents included: 50 nM LbCas12a (Cas12a protease), RPA isothermal amplification reagent, 200 nM fluorescent reporter probe, and buffer solution. G4-crRNA / AZD ++Composed of G4-crRNA and AZD ++ After mixing and incubation, the resulting G4-crRNA is designed according to the sequence of the target analyte, including a fixed region, a spacer region, and a 3' GGGUUAGGGUUAGGGUAGGG sequence. For example, when the target analyte is human herpesvirus EBV, the preferred nucleotide sequence of the G4-crRNA is as shown in SEQ ID NO. 1; when the target analyte is human cytomegalovirus HCMV, the preferred nucleotide sequence of the G4-crRNA is as shown in SEQ ID NO. 2; and when the target analyte is influenza A virus IAV, the preferred nucleotide sequence of the G4-crRNA is as shown in SEQ ID NO. 3. AZD ++ Its Chinese name is АНаР ... .
[0038] RPA isothermal amplification reagents include RPA amplification primers for the sample to be tested, RPA dry powder (recombinase and polymerase), and RPA buffer solution; wherein: When the target substance to be tested is human herpesvirus EBV, the nucleotide sequences of the amplification primers for the target substance to be tested are shown in SEQ ID NO. 4 and SEQ ID NO. 5; When the target analyte is cytomegalovirus (HCMV), the nucleotide sequences of the amplification primers for the target analyte are shown in SEQ ID NO. 6 and SEQ ID NO. 7. When the target substance to be tested is influenza A virus (IAV), the nucleotide sequences of the amplification primers for the target substance are shown in SEQ ID NO. 8 and SEQ ID NO. 9.
[0039] The buffer solution consists of 10 mM Tris-HCl, 10 mM NaCl, 15 mM MgCl2, 1 mM DTT, and 5% PEG-200.
[0040] Fluorescent reporter probe: FAM-CCCCCC-BHQ1.
[0041] In this embodiment, based on G4-crRNA / AZD ++ The CRISPR light-controlled single-tube detection method, the principle of which is as follows: Figure 1 As shown, it includes the following steps: (1) Mix 10 µM G4-crRNA with different concentrations of AZD ++The mixture was incubated at 95 °C and then gradually cooled to 25 °C. It was then stored at –40 °C. (2) G4-crRNA / AZD ++ The Cas12a protease, RPA isothermal amplification reagent, buffer solution, fluorescent reporter probe, and synthetic target were mixed to prepare a reaction system; the reaction system consisted of 20 μL of 100 nM G4-crRNA / AZD. ++ 50 nM Cas12a, 200 nM fluorescent reporter probe, synthetic targets of different concentrations (sequences shown in SEQ ID NO. 10 and SEQ ID NO. 11) and 1× buffer solution were added to DEPC water to bring the volume to 20 μL; (3) The reaction system prepared in step (2) is pre-amplified for 20 min and irradiated with 365 nm ultraviolet light for 60 s so that the target analyte in the sample can activate the Cas12a protease, thereby activating its trans-cleavage activity to cleave the fluorescent reporter probe and generate a fluorescent signal; at the same time, a blank control group without the sample is set up to react under the same conditions and real-time fluorescence monitoring is performed; if the fluorescence signal in the sample is observed to change relative to the blank control group, it is determined that the sample contains the target analyte; otherwise, it is determined that the sample does not contain the target analyte.
[0042] Figure 2 This indicates that AZD ++ The concentrations were set to 0, 100, 150, 180, and 200 µM. Real-time changes in fluorescence signals were detected in systems containing the fluorescent reporter probe and the target analyte. Fluorescence curves were plotted to determine the concentration with the best final blocking effect. When AZD... ++ The CRISPR / Cas12a system achieves the best blocking effect at a concentration of 200 µM.
[0043] Figure 3 The results show that the UV irradiation time for restoring the activity of the CRISPR system was set to 0, 30, 60, 90, and 120 s. The fluorescence signal generated by the CRISPR / Cas12a system cutting the fluorescent reporter probe was tested. As can be seen from the figure, the optimal UV irradiation time is 60 s, and the fluorescence signal generation rate is the fastest.
[0044] To determine whether this invention is based on G4-crRNA / AZD ++ The sensitivity of the CRISPR / Cas12a one-tube detection method was assessed by diluting known concentrations of the synthetic target to 500 pM, 200 pM, 100 pM, 10 pM, 1 pM, and 0.1 pM, with a negative control (without the synthetic target) and under the optimal conditions described above. Figure 4As shown, the fluorescence signal generated by different target concentrations can detect synthetic targets at a concentration of 0.1 pM compared to the negative control.
[0045] To evaluate G4-crRNA / AZD-based... ++ The detection performance of the CRISPR / Cas12a one-tube detection method was demonstrated by RPA amplification using a human herpesvirus EBV circular plasmid as a template. The vector for the circular plasmid was PUC57, and its sequence is shown in SEQ ID No. 12. The RPA primer sequences, G4-crRNA, and fluorescent reporter probe sequences used in this embodiment are shown in Table 1.
[0046] Table 1. Sequences used in this embodiment
[0047] The total volume of the RPA system and CRISPR / Cas system after mixing can be 20 µL, including: RPA powder, 2 µL of synthetic targets at different concentrations, 1 µL FP, 1 µL RP, 5 µL buffer A, 1 µL buffer B, 2 µL LbCas12a, and 2 µL G4-crRNA / AZD. ++ 2 µL buffer solution, 2 µL fluorescent reporter probe, and 2 µL DEPC water. The final concentrations of each CRISPR reaction component in a single tube system are as follows: 1× buffer solution, 50 nM LbCas12a, 100 nM G4-crRNA / AZD ++ 200 nM fluorescent reporter probe. The RPA powder, buffer A and B mentioned above are from commercial RPA kits (RPA enzyme lyophilized pellets purchased from Jiangsu Qitian Gene Biotechnology Co., Ltd.; in actual operation, other RPA warm amplification products on the market can be substituted to achieve the same effect).
[0048] The EBV plasmid template to be tested was serially diluted to a final concentration of 10 in a single-tube system. 4 10 3 10 2 10, 1, 0.1 copies / µL, the RPA-CRISPR / Cas12a reaction system was placed at 37 °C for 20 min, followed by irradiation with 365 nm UV light for 60 s, and real-time fluorescence signal monitoring was performed. Figure 5 As shown, based on G4-crRNA / AZD ++ In the optically controlled RPA-CRISPR / Cas12a system, it is possible to detect 1 copy / µL of target analyte.
[0049] The test kit of this embodiment was used to detect clinical EBV samples. The clinical EBV sample testing was performed according to the above-described detection method, except that the sample to be tested was replaced with bronchoalveolar lavage fluid samples suspected of containing human herpesvirus EBV. Simultaneously, these clinical samples were tested using the gold standard qPCR method to evaluate the clinical detection performance of this method. Figure 6 The results showed that, using the qPCR method, 16 positive samples and 23 negative samples were detected among the 39 suspected EBV samples. Figure 7 This indicates that, based on G4-crRNA / AZD ++ The photo-controlled RPA-CRISPR / Cas12a one-tube method detected a total of 16 positive samples and 23 negative samples, with no false positives.
[0050] The HCMV plasmid template to be tested was constructed using the method described above and then serially diluted to a final concentration of 10 in a single-tube system. 4 10 3 10 2 10, 1, 0.1 copies / µL, the RPA-CRISPR / Cas12a reaction system was placed at 37 ℃ for 20 min, followed by irradiation with 365 nm ultraviolet light for 60 s, and the real-time fluorescence signal was monitored. Figure 8 As shown, based on G4-crRNA / AZD ++ In the optically controlled RPA-CRISPR / Cas12a system, it is possible to detect 1 copy / µL of target analyte.
[0051] The above method was used to detect bronchoalveolar lavage fluid samples suspected of having influenza A virus (IAV), and these clinical samples were also tested using the gold standard qPCR method to evaluate the clinical detection performance of this method. Figure 8 The results showed that, using the qPCR method, 28 positive samples and 15 negative samples were detected among the 43 suspected IAV samples. Figure 9 This indicates that, based on G4-crRNA / AZD ++ The photo-controlled RPA-CRISPR / Cas12a one-tube method detected a total of 29 positive samples and 14 negative samples, with no false positives.
[0052] The nucleotide sequences used in the examples are shown below: SEQ ID No. 1: G4-crRNA-EBV: 5'-UAAUUUCUACUAAGUGUAGAUUGUGGACUCCUGGCGCUCUGGGGUUAGGGUUAGGGUUAGGG-3'.
[0053] SEQ ID No. 2: G4-crRNA-HCMV:5'-UAAUUUCUACUAAGUGUAGAUCUGGUCAGCCUUGCUUCUAGGGUUAGGGUUAGGGUUAGGGG-3'。
[0054] SEQ ID No. 3: G4-crRNA-IAV:5'-UAAUUUCUACUAAGUGUAGAUCAGGGAAACACCGAUCUUGGGUUAGGGUUAGGGUUAGGG-3'。
[0055] SEQ ID No. 4: RPA-EBV-FP:5'-CACTGCCCCTGGTATAAAGTGGTCCTGCAG-3'。
[0056] SEQ ID No. 5: RPA-EBV-RP:5'-TCAGGCGACGGTGATGAAGGTGGCCCCGGGC-3'。
[0057] SEQ ID No. 6: RPA-HCMV-FP:5′-CACAGGCGTGACACGTTTATTGAGTAGGAT-3′。
[0058] SEQ ID No. 7: RPA-HCMV-RP:5'-GGAACCCACCGCCTCTGGAGGCAAGAGCAC-3'。
[0059] SEQ ID No. 8: RPA-IAV-FP:5'-CCCGTCAGGCCCCCTCAAAGCCGAGATCGC-3'。
[0060] SEQ ID No. 9: RPA-IAV-RP:5'-CCTAAAATCCCCTTAGTCAGAGGTGACAGGAT-3'。
[0061] SEQ ID No. 10: TS:5'- AGCTGCTCGGAAGAGTGTCGTAAAGC-3'。
[0062] SEQ ID No. 11: NTS:5’- GCTTTACGACACTCTTCCGAGCAGCT-3’。
[0063] SEQ ID No. 12: CGTTTACGTAAGCCAGACAGCAGCCAATTGTCAGTTCTAGGGAGGGGGACCACTGCCCCTGGTATAAAGTGGTCCTGCAGCTATTTCTGGTCGCATCAGAGCGCCAGGAGTCCACACAAATGTAAGAGGGGGTCTTCTACCTCTCCCTAGCCCTCCGCCCCCTCCAAGGACTCGGGCCCAGTTTCTAACTTTTCCCCTTCCCTCCCTCGTCTTGCCCTGCGCCCGGGGCCACCTTCATCACCGTCGCTGACTCCGCCATCCAAGCCTAGGGGAGACCGAAGTGAAGGCCCTGGACCAACCCGG。
Claims
1. A method based on G4-crRNA / AZD ++ The CRISPR light-controlled one-tube detection kit is characterized by, Its components include: G4-crRNA / AZD ++ Cas12a protease, RPA isothermal amplification reagent, buffer solution, and fluorescent reporter probe.
2. The G4-crRNA / AZD based method according to claim 1 ++ The CRISPR light-controlled one-tube detection kit is characterized by, The G4-crRNA / AZD ++ Composed of G4-crRNA and AZD ++ The G4-crRNA was obtained after mixing and incubation; the nucleotide sequence of the G4-crRNA is specifically complementary to the target nucleotide sequence of the analyte, and the 3' or 5' end has the nucleotide sequence GGGUUAGGGUUAGGUUAGGG.
3. The G4-crRNA / AZD based method according to claim 2 ++ The CRISPR light-controlled one-tube detection kit is characterized by, When the target substance to be tested is human herpesvirus EBV, the G4-crRNA / AZD ++ The nucleotide sequence of G4-crRNA is shown in SEQ ID NO. 1; when the target substance is human cytomegalovirus (HCMV), the G4-crRNA / AZD... ++ The nucleotide sequence of G4-crRNA is shown in SEQ ID NO. 2; when the target substance is influenza A virus (IAV), the G4-crRNA / AZD... ++ The nucleotide sequence of G4-crRNA is shown in SEQ ID NO.
3.
4. The G4-crRNA / AZD based method according to claim 1 ++ The CRISPR light-controlled one-tube detection kit is characterized by, The Cas12a protease includes at least one of LbCas12a, AsCas12a, FnCas12a, and ErCas12a; the RPA isothermal amplification reagent includes RPA amplification primers for the target analyte, RPA dry powder, and RPA buffer solution. When the target substance to be tested is human herpesvirus EBV, the nucleotide sequences of the amplification primers for the target substance are shown in SEQ ID NO. 4 and SEQ ID NO. 5; When the target substance to be tested is cytomegalovirus (HCMV), the nucleotide sequences of the amplification primers for the target substance are shown in SEQ ID NO. 6 and SEQ ID NO.
7. When the target substance to be tested is influenza A virus (IAV), the nucleotide sequences of the amplification primers for the target substance are shown in SEQ ID NO. 8 and SEQ ID NO.
9.
5. The G4-crRNA / AZD based method according to claim 1 ++ The CRISPR light-controlled one-tube detection kit is characterized by, The buffer solution comprises the following components: 10-50 mM Tris-HCl, 5-50 mM NaCl, 10-50 mM MgCl2, 1.0-5.0 mM DTT, and 5%-20% PEG-200.
6. The G4-crRNA / AZD based method according to claim 1 ++ The CRISPR light-controlled one-tube detection kit is characterized by, The fluorescent reporter probe is a single-chain reporter probe labeled with a fluorescein and a quenching group. The fluorescein includes any one of FAM, ROX, Cy5 and Cy3 labels, and the quenching group includes any one of BHQ1, BHQ2 and BHQ3 labels. The length of the single-chain reporter probe is 5~30 nt.
7. A method based on G4-crRNA / AZD ++ The CRISPR-based optically controlled single-tube detection method is characterized by, Includes the following steps: (1) The G4-crRNA / AZD in the detection kit according to any one of claims 1-6 ++ The Cas12a protease, RPA isothermal amplification reagent, buffer solution, fluorescent reporter probe and the sample to be tested were mixed to prepare a reaction system; (2) The reaction system described in step (1) is first pre-amplified, and then the entire system is irradiated with ultraviolet light to activate the CRISPR system and perform real-time fluorescence monitoring; at the same time, a blank control group without the test sample is set up to react under the same conditions; if the fluorescence signal in the test sample is observed to change relative to the blank control group, it is determined that the test sample contains the target analyte; otherwise, it is determined that the test sample does not contain the target analyte.
8. The G4-crRNA / AZD based method according to claim 7 ++ The CRISPR-based optically controlled single-tube detection method is characterized by, In step (1), the G4-crRNA / AZD ++ Composed of G4-crRNA and AZD ++ The mixture is incubated at 90-97 °C, then gradually cooled to room temperature or 4 °C to obtain the final product; in the reaction system, the AZD... ++ The concentration is 100~300 µM; the sample to be tested is a pathogenic microorganism, nucleic acid, tissue or blood.
9. The G4-crRNA / AZD based method according to claim 7 ++ The CRISPR-based optically controlled single-tube detection method is characterized by, In step (1), in the reaction system, the G4-crRNA / AZD ++ The concentration of the Cas12a protease is 0.5-2 µM, the concentration of the fluorescent reporter probe is 0.2-2 µM, the concentration of the sample to be tested is set as needed, and the rest is DEPC water; The RPA isothermal amplification reagent includes: RPA dry powder, RPA buffer solution, and 1 μL each of RPA forward and reverse primers.
10. The G4-crRNA / AZD based invention according to any one of claims 7 to 9 ++ The CRISPR-based optically controlled single-tube detection method is characterized by, In step (2), the pre-amplification time is 10-30 min, the ultraviolet irradiation time is 30-90 s, the reaction temperature is 25-60 ℃, and the reaction time is 0.5-3 h.