High-moisture-retention micro-ecological skin care cream matrix as well as preparation method and application thereof
By preparing a microecological skincare cream matrix containing skin-friendly, refreshing oils and biomimetic natural moisturizing factor solutions, the problem of traditional creams in moisturizing, repairing, and balancing the microecology has been solved. This achieves multi-barrier repair and regulation of the skin, inhibits the proliferation of Propionibacterium acnes, and enhances the moisturizing effect.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-16
- Publication Date
- 2026-03-17
AI Technical Summary
Existing skin creams struggle to balance moisturizing and repairing functions with inhibiting the excessive proliferation of Propionibacterium acnes, and traditional moisturizers are easily affected by environmental humidity, failing to provide long-lasting hydration.
A microecological skincare cream base is prepared by using skin-friendly, refreshing oils and biomimetic natural moisturizing factor solutions, combined with prebiotics and postbiotics. It contains a specific ratio of oil components, emulsifiers, thickeners, prebiotics, postbiotics and biomimetic natural moisturizing factor solutions, which are mixed through a specific process to form an emulsified structure.
It achieves a friendly regulation of the skin's microecology, inhibits the proliferation of Propionibacterium acnes, enhances the skin's immune regulation ability, and has a moisturizing ability superior to traditional creams, providing long-lasting hydration unaffected by environmental humidity.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of daily cosmetics, specifically relating to a highly moisturizing microecological skin care cream base, its preparation method, and its application. Background Technology
[0002] As the largest organ in the human body, the skin is home to hundreds of billions of microorganisms. These microorganisms do not simply attach themselves to the skin, but interact with it in various ways, directly affecting the skin barrier function and overall health. Staphylococcus epidermidis, a core member of the skin's symbiotic flora, maintains skin homeostasis through mechanisms such as strengthening barrier function (e.g., promoting ceramide synthesis, upregulating the expression of barrier proteins such as filaggrin (FLG) and lobelin (LOR), regulating immune balance (activating innate immunity, guiding adaptive immunity, and regulating macrophage phagocytic activity), and inhibiting excessive inflammation. Propionibacterium acnes is a normal symbiotic bacterium in the pilosebaceous unit of human skin; however, under conditions of excessive sebum secretion and clogged hair follicles, its excessive proliferation can lead to acne (including comedones, inflammatory papules, pustules, nodules / cysts) and persistent inflammatory responses. Regulating the proliferation of beneficial bacteria in the skin and maintaining the balance of the skin flora is crucial for skin health.
[0003] Cream formulations are the most widely used and prevalent dosage form in cosmetics. Because cream-based skincare products need to provide long-lasting hydration and barrier repair, oil components constitute a significant portion of their core ingredients. However, the proliferation of Propionibacterium acnes, a lipophilic Gram-positive anaerobic bacterium, is closely related to the choice of oil components. Therefore, the selection of oils is crucial to balancing the moisturizing and repairing effects of cream-based skincare products with the risk of excessive Propionibacterium acnes proliferation.
[0004] Prebiotics are common raw materials for regulating microbial communities, selectively promoting the growth of beneficial bacteria in the skin. These include inulin, fructooligosaccharides, galactooligosaccharides, and α-glucan oligosaccharides. Epibiotics are products of probiotic fermentation, metabolism, transformation, or release, possessing similar barrier repair and immune regulation functions to probiotics. They can indirectly exert microecological skincare effects by mimicking some of the action pathways of skin probiotics, while avoiding the quality and safety issues caused by directly adding live bacteria. Epibiotics added to cosmetics are mainly various probiotic fermentation product filtrates or fermentation product lysates. Compared to the soluble metabolites of fermentation product filtrates, fermentation product lysates further contain cell wall components (teichoic acid, peptidoglycan, surface proteins, etc.) and intracellular components (amino acids, polypeptides, genetic material, etc.) of the fermenting bacteria, which can better mimic the skincare pathway of skin probiotics.
[0005] Natural Moisturizing Factor (NMF) is a water-soluble, low-molecular-weight mixture in the stratum corneum of the skin. It originates from the degradation of filaggrin in the granular layer of the epidermis (filaggrin → profilaggrin → amino acids and derivatives). Distributed around the keratin filaments of keratinocytes, it is encapsulated by a membrane structure formed by lipids in the stratum corneum (such as ceramides and cholesterol) to prevent loss. NMF-related skincare ingredients mainly consist of naturally occurring skin components such as amino acids, pyrrolidone carboxylic acid (PCA), and lactate. These components are highly compatible with the stratum corneum structure, allowing them to penetrate deep into the stratum corneum to form a network structure that locks in moisture, providing long-lasting hydration. Traditional moisturizers such as polyols and hyaluronic acid can only form a temporary hydration layer on the surface of the stratum corneum and are easily affected by environmental humidity. Components in NMF, such as lactic acid, can regulate the skin's pH value, inhibit the growth of harmful bacteria, and regulate the skin's microecology.
[0006] Chinese invention patent application CN202011317598.9 discloses an oil composition for balancing skin microecology and its moisturizing lotion, relating to the field of cosmetic technology. It mainly consists of meadowfoam seed oil, low-erucic acid rapeseed oil, and sunflower seed oil. The composition prepared from the above components moisturizes the skin, promotes keratinization, cell proliferation and lipid synthesis, has anti-inflammatory and anti-allergic effects, repairs broken capillaries, improves skin immunity, and helps accelerate wound healing. It also protects the skin from free radical damage, thereby enhancing the skin barrier function, which is very beneficial for maintaining skin microecological balance. The moisturizing lotion formula made from the above composition is mild and non-irritating to the skin, which is beneficial for maintaining skin physiology and skin microecological balance. This invention does not claim any impact on the proliferation of lipophilic Propionibacterium acnes, and low-erucic acid rapeseed oil contains a relatively high amount of oleic acid, which can be utilized by Propionibacterium acnes, posing a risk of excessive proliferation of Propionibacterium acnes. The selected moisturizers were one or a mixture of several of the following: trehalose, sodium PCA, sodium lactate, glyceryl polyether-26, polyethylene glycol-8, urea, and hexanediol. No screening or validation of the moisturizers was performed.
[0007] Another Chinese invention patent application, CN201910015398.9, discloses a composition for regulating skin microecological balance, its application, a moisturizing lotion containing the same, and a method for preparing the lotion. The composition mainly consists of *Gynostemma pentaphyllum* extract, probiotic metabolites, and antioxidant peptides from *Stellaria media*. The composition, prepared from the above components, not only has excellent anti-allergic, anti-inflammatory, and damaged cell repair effects, but also increases the number of beneficial bacteria on the skin, inhibits the growth of harmful bacteria, and removes free radicals from the skin surface, thereby helping to solve skin problems caused by skin microecological imbalance, resulting in smooth, bright, and youthful skin. The moisturizing lotion described in this invention also does not indicate any effect on the lipophilic anaerobic bacterium *Propionibacterium acnes*. Meanwhile, the regulating composition does not involve the screening and design of moisturizing agents. Its effect on improving skin microecology needs further improvement. Summary of the Invention
[0008] To address the shortcomings of existing technologies, this invention provides a highly moisturizing microecological skincare cream matrix, its preparation, and its application.
[0009] To achieve the above-mentioned technical objectives, the present invention provides the following technical solution: On one hand, the present invention provides a highly moisturizing microecological skin care cream base. The microecological skin care cream base includes water, oil components, emulsifiers, thickeners, prebiotics, post-biotics, a biomimetic natural moisturizing factor solution, and a pH adjuster.
[0010] Preferably, the oil components include at least one of squalane and wax ester jojoba seed oil or jojoba seed oil.
[0011] Preferably, the prebiotic is one or more of α-glucan oligosaccharides, inulin, and fructose.
[0012] Preferably, the biomimetic natural moisturizing factor solution contains free amino acids, pyrrolidone carboxylic acid and its sodium salt, lactic acid and its sodium salt, and urea.
[0013] Preferably, the oil component further includes one or more of isononyl isononanoate and dioctyl carbonate.
[0014] Preferably, the prebiotic is selected from α-glucan oligosaccharides.
[0015] Preferably, the metabiotic is a lysate of Bifida ferment lysate.
[0016] Preferably, by weight percentage, the biomimetic natural moisturizing factor solution contains 5%-40% free amino acids, 2-12% pyrrolidone carboxylic acid and its sodium salt, 2-12% lactic acid and its sodium salt, and 2-8% urea.
[0017] Preferably, the free amino acid includes one or more of serine, glycine, alanine, arginine, glutamic acid, threonine, arginine, lysine, and proline.
[0018] Preferably, the emulsifier is an oil-in-water emulsifier selected from one or more of stearyl alcohol polyether-2, stearyl alcohol polyether-21, polyglycerol-10 stearate, polysorbate-60, cetearyl glucoside, arachidonic acid glucoside, hydrogenated lecithin, and glyceryl stearate.
[0019] Preferably, the thickener is one or more of carbomer, xanthan gum, carrageenan, starch, carboxymethyl cellulose, etc. Preferably, the pH adjuster includes one or more of arginine, sodium hydroxide, potassium hydroxide, triethanolamine, citric acid, sodium citrate, etc.
[0020] Preferably, the product comprises the following components by weight: 50-85 parts water, 5-30 parts oil, 1-5 parts emulsifier, 0.1-3 parts thickener, 1-5 parts prebiotic, 1-5 parts postbiotic, 0.5-5 parts biomimetic natural moisturizing factor solution, and 0-3 parts pH adjuster.
[0021] Secondly, the present invention provides a microecological skin care cream base, comprising the following steps: (1) Mix the oil components and emulsifier evenly to obtain the oil phase; (2) Disperse the thickener in water to obtain an aqueous phase; (3) Add the oil phase to the aqueous phase and homogenize and emulsify to obtain the primary emulsion; (4) Add prebiotics, post-emodin and biomimetic natural moisturizing factor solution to the colostrum and mix, then add pH adjuster to obtain the final product.
[0022] Preferably, the temperatures of the oil phase in step (1) and the aqueous phase in step (2) are both set to 75-80℃; Preferably, in step (4), other raw materials are added when the temperature of the initial emulsion drops to 35-45°C; Preferably, in step (4), a pH adjuster is added to adjust the pH to 4.5-6.5.
[0023] Thirdly, this invention provides the application of a microecological skincare cream matrix in the preparation of cosmetics with moisturizing, anti-inflammatory, repairing, and skin immune regulation enhancement capabilities.
[0024] Compared with existing technologies, the present invention exhibits the following significant advantages: 1. The microecological skin care cream matrix prepared by this invention mainly uses skin-friendly and refreshing oils, which will not cause excessive proliferation of lipophilic Propionibacterium acnes on the skin surface. At the same time, it is combined with a biomimetic natural moisturizing factor solution with a composition similar to the skin's natural moisturizing factors to compensate for the decrease in the cream's moisturizing ability caused by the selection of refreshing oils.
[0025] 2. Compared with traditional moisturizers such as polyols and polysaccharides, the biomimetic natural moisturizing factor solution of this invention has better skin affinity, is highly compatible with the structure of the stratum corneum, can penetrate deep into the stratum corneum to form a network structure to lock in water, is not easily affected by environmental humidity, and has better moisturizing ability.
[0026] 3. This invention solves the problem of balancing the microecological friendliness and high moisturizing properties of traditional cream bases by combining specific skin-friendly refreshing oils and biomimetic natural moisturizing factor solutions.
[0027] 4. The microecological skincare cream base prepared in this invention incorporates prebiotics and postbiotics. The prebiotics are preferably α-glucan oligosaccharides with smaller molecular weights, while the postbiotics are selected from Bifida ferment lysate, which is rich in probiotic components. Combined with skin-friendly and refreshing oils, it can more comprehensively regulate the skin's microecology. Simultaneously, it can mimic the action mechanism pathways of the skin's microecology to repair and regulate multiple skin barriers, making it a new generation of "microecological-friendly" functional skincare products guided by the microecological skincare mechanism. Detailed Implementation
[0028] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly used in the field to which this invention pertains. For the purposes of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural forms, and vice versa.
[0029] The numerical ranges used in this article should be understood as including all numbers within that range. For example, the range 1 to 20 should be understood to include any number, combination of numbers, or subrange from the following group: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.
[0030] As used herein, the terms “comprises” or “comprising” mean “including, but not limited to”. This term is intended to be open-ended to specify the presence of any of the stated features, elements, integers, steps, or components, but does not exclude the presence or addition of one or more other features, elements, integers, steps, components, or groups thereof. Therefore, the term “comprising” includes the more restrictive terms “consisting of” and “substantially consisting of”. In one embodiment, the term “comprising” as used throughout the application, particularly in the claims, may be replaced by the term “consisting of”.
[0031] The term “and / or” as used herein should be understood to mean any one of the options or any combination of two or more of the options.
[0032] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. Unless otherwise specified, specific conditions in the embodiments are performed under conventional conditions or conditions recommended by the manufacturer. All reagents or instruments without specified manufacturers are commercially available conventional products. Numerous specific details are provided in the following detailed embodiments to better illustrate the invention. The specific embodiments described herein are for illustrative purposes only and are not intended to constitute any limitation on the invention. The sources of materials used in the following embodiments are shown in Tables 1 and 2.
[0033] Table 1. Sources of prebiotics and postbiotics
[0034] Table 2 Other Raw Material Sources
[0035] Example 1 This embodiment provides a microecological skincare cream base, the components of which are as follows by weight: 80.58 parts water, 10 parts oil, 2 parts emulsifier, 0.3 parts thickener, 3 parts prebiotic, 2 parts postbiotic, 2 parts biomimetic natural moisturizing factor solution and 0.12 parts pH adjuster; The oil components are jojoba seed oil and squalane in a 1:1 mass ratio; the emulsifier is polysorbate-60; the thickener is carbomer; the prebiotic is α-glucan oligosaccharide (YS-1); the post-biotic is Bifida ferment lysate (HS-2); and the biomimetic natural moisturizing factor solution A has the following formula: 8% free amino acids (2.5% serine, 1.5% alanine, 1% glycine, 1% glutamic acid, 1% threonine, 1% proline), 5% sodium pyrrolidone carboxylate, 5% sodium lactate, 2% urea, and 80% water.
[0036] The pH adjuster is arginine.
[0037] The preparation method of the microecological skin care cream base is as follows: (1) Mix jojoba seed oil, squalane and emulsifier polysorbate-60 evenly and heat to 80°C.
[0038] (2) Disperse the thickener carbomer in deionized water and heat it to 80°C.
[0039] (3) The oil phase is slowly added to the water phase and stirred to homogenize and emulsify.
[0040] (4) When the temperature drops to about 40℃, add the prebiotic α-glucan oligosaccharide (YS-1), the postbiotic Bifida ferment lysate (HS-2) and the biomimetic natural moisturizing factor solution A, and finally add the pH adjuster to adjust the pH to 5.5.
[0041] Example 2 This embodiment provides a microecological skincare cream base, the components of which are as follows by weight: 82.62 parts water, 8 parts oil, 2 parts emulsifier, 0.3 parts thickener, 3 parts prebiotic, 2 parts postbiotic, 2 parts biomimetic natural moisturizing factor solution and 0.08 parts pH adjuster; The oil components are jojoba seed oil and dioctyl carbonate in a 1:1 mass ratio; the emulsifier is polyglycerol-10 stearate; the thickener is carbomer; the prebiotic is an inulin / α-glucan oligosaccharide composition (YS-2); the post-biotic is Bifida ferment lysate (HS-2); and the biomimetic natural moisturizing factor solution B has the following formula: 15% free amino acids (5% serine, 3% alanine, 2% glycine, 2% glutamic acid, 2% threonine, 1% proline), 8% sodium pyrrolidone carboxylate, 8% sodium lactate, 5% urea, and 64% water.
[0042] The pH adjuster is sodium hydroxide.
[0043] The preparation method of the microecological skin care cream base is as follows: (1) Mix jojoba seed oil, dioctyl carbonate and emulsifier polyglycerol-10 stearate evenly and heat to 75°C.
[0044] (2) Disperse the thickener carbomer in deionized water and heat to 75°C.
[0045] (3) The oil phase is slowly added to the water phase and stirred or homogenized and emulsified.
[0046] (4) When the temperature drops to 40℃, add the prebiotic inulin / α-glucan oligosaccharide composition (YS-2), postbiotic Bifida ferment lysate (HS-2) and biomimetic natural moisturizing factor solution B, and finally add pH adjuster to adjust pH to 5.5.
[0047] Example 3 This embodiment provides a microecological skincare cream base, the components of which are as follows by weight: 78.58 parts water, 12 parts oil, 2 parts emulsifier, 0.3 parts thickener, 3 parts prebiotic, 2 parts postbiotic, 2 parts biomimetic natural moisturizing factor solution and 0.12 parts pH adjuster; The oil components are squalane and isononyl isononanoate in a 1:1 mass ratio; the emulsifier is cetearyl glucoside; the thickener is carbomer; the prebiotics are α-glucan oligosaccharide (YS1) and inulin / fructose composition (YS-3) in a 1:1 weight ratio; the post-biotic is Bifida ferment lysate (HS-2); and the biomimetic natural moisturizing factor A formula is: 8% free amino acids (2.5% serine, 1.5% alanine, 1% glycine, 1% glutamic acid, 1% threonine, 1% proline), 5% sodium pyrrolidone carboxylate, 5% sodium lactate, 2% urea, and 80% water.
[0048] The pH adjuster is arginine.
[0049] The preparation method of the microecological skin care cream base is as follows: (1) Squalane, isononyl isononanoate and emulsifier cetearyl glucoside are mixed evenly and heated to 80°C.
[0050] (2) Disperse the thickener carbomer in deionized water and heat to 80°C.
[0051] (3) The oil phase is slowly added to the water phase and stirred or homogenized and emulsified.
[0052] (4) When the temperature drops to 40℃, add the prebiotic α-glucan oligosaccharide mixture (YS-1) and 1.5 parts of inulin / fructose composition (YS-3), postbiotic Bifida ferment lysate (HS-2) and biomimetic natural moisturizing factor solution A. Finally, add pH adjuster to adjust the pH to 5.5.
[0053] Comparative Example 1 Compared to Example 1, which does not contain biomimetic natural moisturizing factor solution A, it is replaced with the same amount of deionized water.
[0054] Comparative Example 2 Compared to Example 1, which does not contain biomimetic natural moisturizing factor solution A, 1.8 parts of 1,3-butanediol and 0.2 parts of sodium hyaluronate were used instead.
[0055] Comparative Example 3 Compared to Example 1, the oil was replaced with 5 parts mineral oil + 5 parts olive fruit oil, and it did not contain biomimetic natural moisturizing factor solution A. It was replaced with the same number of parts of deionized water.
[0056] Comparative Example 4 Compared to Example 1, which does not contain prebiotics, it uses the same amount of deionized water instead.
[0057] Comparative Example 5 Compared to Example 1, which does not contain the post-bifida ferment lysate, the same amount of deionized water was used instead.
[0058] Comparative Example 6 Compared to Example 1, which does not contain prebiotics, post-biotic Bifida ferment lysate, or biomimetic natural moisturizing factor solution A, the same amount of deionized water was used instead.
[0059] Comparative Example 7 Compared to Example 1, the biogener was replaced with the same amount of Bifida ferment filtrate (HS-1).
[0060] Comparative Example 8 Compared to Example 1, the prebiotic α-glucan oligosaccharide (YS-1) was replaced with an equal amount of oat β-glucan (YS-5).
[0061] Effect Experiment Test Experimental Example 1: Evaluation of the Microbial Community Regulation Ability of the Invention Sample The plate count method was used to conduct proliferation experiments on *Propionibacterium acnes* and *Staphylococcus epidermidis* using comparative and example samples. *Propionibacterium acnes* was activated and cultured on enhanced *Clostridium* medium in an anaerobic incubator at 37°C for 48 hours. *Staphylococcus epidermidis* was activated and cultured on nutrient agar (solid) and nutrient broth (liquid) in an aerobic incubator at 36°C for 24 hours. The activated plates were eluted with sterile physiological saline to prepare a high-concentration bacterial suspension, which was then diluted 100-fold with liquid culture medium to obtain the test bacterial suspension. The final sample test bacterial suspension volume was 5 mL, placed in a 10 mL centrifuge tube, containing 10 mg / mL of the example sample or comparative sample concentration. Control and blank groups were also set up. The control group sample was replaced with sterile culture medium, and the blank group was prepared with sterile culture medium. Each sample was replicated in triplicate. *Propionibacterium acnes* samples were placed in an anaerobic incubator and cultured at certain intervals. The bacterial suspension was diluted a certain factor, and 100 μL was evenly spread on the surface of agar plates. After incubating the plates in an anaerobic incubator for 48 hours, colony counting was performed. Staphylococcus epidermidis samples were incubated in an aerobic incubator. After certain intervals, the bacterial suspension was diluted a certain factor, and 100 μL was evenly spread onto the surface of the agar plates. The plates were then incubated in an aerobic incubator for 24 hours before colony counting was performed.
[0062] Sample colony count (CFU / mL) = average colony count × dilution factor / coating volume (mL). Proliferation rate = (number of colonies in sample group - number of colonies in control group) / number of colonies in control group × 100%.
[0063] Table 3 Evaluation results of the microbial community regulation ability of the comparative and example samples
[0064] The results showed that Comparative Examples 4 and 6, without the addition of prebiotics, could not effectively promote the proliferation of Staphylococcus epidermidis (<2%). Comparative Example 8, with the addition of prebiotic oat β-glucan (YS-5), had a certain proliferative effect on Staphylococcus epidermidis, but the effect was not significant (<10%). Examples (1, 2, 3) and Comparative Examples (1, 2, 3, 5, 7) with the addition of one or more of the prebiotic α-glucan oligosaccharides, inulin, and fructose significantly promoted the growth of the skin probiotic Staphylococcus epidermidis (>30%). Among them, the prebiotic α-glucan oligosaccharide (YS-1) was more effective. However, Comparative Example 3, with the addition of occlusive mineral oil and triglyceride-rich olive fruit oil, caused excessive proliferation of the lipophilic anaerobic bacterium Propionibacterium acnes compared to other examples and comparative examples with the addition of skin-friendly and refreshing oils. A reasonable combination of oils and prebiotics can regulate the proliferation of Staphylococcus epidermidis and Propionibacterium acnes, maintaining the skin's microecological balance.
[0065] Experimental Example 2: Evaluation of the barrier repair, immune regulation, and anti-inflammatory capabilities of the samples of this invention. First, the cell-safe concentrations of the comparative and example samples were determined using the same methods as those used for determining the cell-safe concentrations of the post-biotic. The barrier repair, immune regulation, and anti-inflammatory capabilities of the comparative and example samples were evaluated within the cell-safe concentration range using the same methods as those used for evaluating the efficacy of the post-biotic.
[0066] Table 4. Evaluation results of barrier repair, immune regulation, and anti-inflammatory capabilities of comparative and example samples.
[0067] The results showed that, compared with Comparative Examples 5 and 6, the other examples and comparative examples with added postbiotics significantly increased the expression of lipogrin and filaggrin, enhanced macrophage phagocytic activity, and reduced cellular NO expression, demonstrating good barrier repair, immune regulation, and anti-inflammatory capabilities. Among them, the examples and comparative examples with added Bifida ferment lysate showed better results than Comparative Example 7 with added Bifida ferment lysate filtrate.
[0068] Experimental Example 3: Determination of the moisturizing ability of the sample of the present invention Twenty-five subjects aged 18-65 years (excluding pregnant or lactating women) were selected. Transdermal water loss (TEWL) tests were conducted before and after sample use using the MPA9 multifunctional skin analyzer (Tewameter TM300 (moisture loss test probe)). Before the test, subjects were required to clean the inner forearms of both hands and sit quietly in a compliant room for at least 20 minutes. The forearms were exposed and placed in the test position, remaining relaxed. Measurement areas were marked on the inner forearms of both subjects, with a test area of at least (3×3) cm². 2 Multiple areas can be marked simultaneously on the same arm, with at least 1 cm between each test area. The product application area and the blank control area should be randomly distributed across the marked areas on both arms to ensure statistically balanced positions of all product and blank areas. The test sample concentration is (2.0 ± 0.1) mg / cm³. 2 The sample is applied in a single coat using a latex finger cot, spreading it evenly over the test area. Each area is measured at least three times in parallel. Initial values (before sample use) are measured for each test area, followed by transdermal water loss (TEWL) in both the test and control areas after a set time of 4 hours. Tests on the same subject must be performed using the same instrument by the same operator, and the probe should be cleaned between measurements. The indoor conditions for the subject are 25°C room temperature and 35% relative humidity.
[0069] TEWL change rate = (TEWL after use - TEWL before use) / TEWL before use × 100%.
[0070] Table 5. Evaluation results of the moisturizing ability of the comparative and example samples.
[0071] Note: Negative numbers indicate that the skin's TEWL value can be reduced. The TEWL value represents the skin's ability to lose moisture. The greater the reduction, the stronger the moisturizing ability.
[0072] The results showed that Comparative Example 1, with its cream base composed of refreshing, skin-friendly oils, prebiotics, and post-biotics, did not cause excessive proliferation of Propionibacterium acnes compared to Comparative Example 3, which contained occlusive mineral oil (4hTEWL value change rate -9.59%), exhibiting better skin microecological friendliness. However, its moisturizing ability was relatively weaker (4hTEWL value change rate -3.25%). Comparative Example 2, based on Comparative Example 1, added a traditional moisturizer composed of 1,3-butanediol and sodium hyaluronate, which to some extent improved the decrease in moisturizing ability caused by choosing refreshing oils (4hTEWL value change rate changed from -3.25% to -6.89%).
[0073] Example 1, based on Comparative Example 2, further replaced the traditional moisturizer with an equal proportion of a biomimetic natural moisturizing factor solution, exhibiting superior moisturizing ability comparable to selectively occlusive oils (4h TEWL value change rate -9.63%). In summary, adding either a traditional moisturizer or a biomimetic natural moisturizing factor solution can improve the decreased moisturizing ability of the cream matrix caused by selectively light oils, with the biomimetic natural moisturizing factor solution performing better. This may be because the testing environment was relatively dry (humidity 35%), and the biomimetic natural moisturizing factor solution highly compatible with the stratum corneum structure, penetrating deep into the stratum corneum to form a network structure for water locking, providing long-lasting hydration. Traditional moisturizers, such as polyols and hyaluronic acid, can only form a temporary hydration layer on the surface of the stratum corneum and are easily affected by environmental humidity; therefore, the biomimetic natural moisturizing factor solution exhibits superior moisturizing ability. Considering the results of microbial regulation, it is evident that the combination of skin-friendly light oils and a biomimetic natural moisturizing factor solution can effectively solve the problem of balancing the microecological friendliness and high moisturizing properties of the cream matrix.
[0074] Experiment Example 4: Verification of the effect of oil components on Propionibacterium acnes The activation and culture conditions for Propionibacterium acnes were as follows: Clostridium difficile culture medium was used, and the bacteria were incubated at 37°C for 48 hours in an anaerobic incubator. The activated plates were eluted with sterile physiological saline to prepare a high-concentration bacterial suspension, which was then diluted 100-fold with liquid culture medium to obtain the test bacterial suspension. Due to the poor compatibility between the oil and the culture medium, an emulsion prepared from the test oil was co-cultured with the test bacterial suspension. Ten parts of the test oil and 88 parts of deionized water were emulsified with 2 parts of polysorbate-60 to prepare the test emulsion matrix. The final sample test bacterial suspension volume was 5 mL, placed in a 10 mL centrifuge tube, containing a test oil emulsion sample concentration of 10 mg / mL. A control group and a blank group were also set up. The control group sample was replaced with sterile culture medium, and the blank group was prepared with sterile culture medium. Each sample was replicated. After 48 hours of anaerobic incubation, the bacterial suspension was diluted a certain factor, and 100 μL was evenly spread on the surface of agar plates. After incubating the plates in an anaerobic incubator for 48 hours, colony counting was performed.
[0075] Sample colony count (CFU / mL) = average colony count × dilution factor / coating volume (mL).
[0076] Proliferation rate = (number of colonies in sample group - number of colonies in control group) / number of colonies in control group × 100%.
[0077] Table 6. Effects of different oils on the proliferation of Propionibacterium acnes
[0078] Note: Negative numbers indicate an inhibitory effect on the proliferation of Propionibacterium acnes.
[0079] The results showed that samples prepared with occlusive oils could induce the proliferation of *Propionibacterium acnes*. While some oxygen remained in the bacterial suspension test tubes, occlusive oils, compared to other light oils, created a more anaerobic environment, which promoted the proliferation of *Propionibacterium acnes*. Shea butter and olive oil, rich in triglycerides composed of oleic acid and stearic acid, can be utilized by *Propionibacterium acnes* as a carbon source, and the test results showed a significant proliferative effect on *Propionibacterium acnes*. Light oils such as squalane, jojoba seed oil, dioctyl carbonate, and isononyl isononanoate, which cannot be utilized by *Propionibacterium acnes*, did not promote proliferation and can be used as oil components in the base of microecological skincare creams. Squalane and jojoba seed oil, which have similar lipid structures to skin, are preferred.
[0080] Experimental Example 5: Verification of the Effects of Prebiotics on Staphylococcus epidermidis Prepare stock solutions for each prebiotic sample at 10 times the tested concentration (stock solution concentration is 10 times the test concentration), mix well, filter to sterilize, and store at 5℃ for later use. Staphylococcus epidermidis activation and culture conditions: NB medium (solid) and LB medium (liquid), aerobic culture at 36℃ for 24 hours. Elute the activated plates with sterile physiological saline to prepare a high-concentration bacterial suspension. Dilute the bacterial suspension 100 times with liquid medium. Divide the diluted bacterial suspension into groups, add 10% of the test sample to each group, mix well, and add to sterile 96-well plates for culture. Use 200 μL of Staphylococcus epidermidis per well, with 5 replicates per sample. Control wells and blank wells are also included. The control wells use sterile physiological saline instead of 10% of the sample, and the blank wells use sterile medium. Incubate in an incubator. After 12 hours, measure the OD value. The bacterial concentration is indirectly determined by the OD value; within a certain range, a higher OD value indicates a higher bacterial concentration. The proliferation rate is calculated as follows: Proliferation rate = (OD value of sample group - OD value of control group) / (OD value of control group - OD value of blank group) × 100%.
[0081] Table 7. Effects of different prebiotics on the proliferation of Staphylococcus epidermidis.
[0082] The results showed that all selected prebiotics had a proliferative effect on the skin probiotic Staphylococcus epidermidis. Among them, α-glucan oligosaccharide (YS-1) was preferred, possibly due to its small molecular weight, which makes it easily utilized by probiotics. YS-2 and YS-3 were secondary choices. YS-4, YS-5, and YS-6 had some proliferative effect, but their effect was weaker than the other three and they were not used in the examples.
[0083] Experiment Example 6: Evaluation Experiment of the Efficacy of Different Degenerative Agents 1.1 Method for determining safe cell concentration Logarithmic growth phase cells (human skin fibroblasts HFF1 / macrophages RAW264.7) were seeded in 96-well plates and cultured for 24 h. Cells were then divided into a normal control group (cells and culture medium) and a sample group (cells, culture medium, and test sample). The old culture medium was discarded, and the cells were washed once with PBS. Culture medium was added to the control group, and sample solution (test sample + culture medium) was added to the sample group. The plates were incubated at 37°C with 5% CO2 for 24 h. The old culture medium was discarded, and the cells were washed twice with PBS. 110 μL of culture medium containing 10% v / v CCK-8 solution was added to each well. A blank control group was also included, with only 110 μL of CCK-8 solution added to each well. After incubation at 37°C for 2 h, the absorbance (OD) at 450 nm was measured using a microplate reader, and cell viability was calculated. The highest concentration of the test sample with a cell viability greater than 95% was considered the safe cell concentration for that sample.
[0084] The human skin fibroblasts HFF1 were prepared using DMEM high-glucose basal medium (85% v / v) + fetal bovine serum (15% v / v), both purchased from Gibco, USA. The macrophages RAW264.7 were prepared using DMEM high-glucose basal medium (90% v / v) + fetal bovine serum (10% v / v), both purchased from Gibco, USA.
[0085] Cell viability = (OD value of sample group - OD value of blank group) / (OD value of normal control group - OD value of blank group) × 100%.
[0086] Table 8. Maximum safe concentration of metagenin in cells
[0087] 1.2 Barrier Repair Capacity Evaluation Test Basis: Among the many components of the skin barrier, filaggrin (FLG) and loricrin (LOR) are two crucial barrier proteins. The skin microbiome is a key regulator of skin barrier function, precisely regulating core barrier proteins such as filaggrin and loricrin through microbial metabolites, immune signaling pathways, and direct interactions. Real-time quantitative PCR was used to determine the effect of metabiotics on the expression of mRNAs related to skin barrier function, thereby reflecting the barrier repair capacity of metabiotics.
[0088] Test steps: Total RNA extraction and purification: HFF1 cells in logarithmic growth phase (Hefei Wanwu Biotechnology Co., Ltd.) were seeded into 24-well plates and cultured overnight. The supernatant was discarded. Culture medium was added to the normal control group, and culture medium containing the sample was added to the sample group. Cells were cultured under different conditions for 24-48 hours. The cell culture supernatant was discarded, and the cells were washed twice with PBS buffer and collected. The GeneJET RNA purification kit (Thermo Fisher Scientific) was used to lyse the cells, extract, purify, and collect total RNA according to the manufacturer's instructions.
[0089] The culture medium is: DMEM high glucose basal medium 85% v / v + fetal bovine serum 15% v / v.
[0090] Reverse transcription to synthesize cDNA: The RNA concentration of the sample was detected using a nucleic acid concentration detector. After determining the concentration, the reverse transcription experiment was carried out using a reverse transcription kit (Tiangen Biotech) with a uniform amount of 1 μg RNA.
[0091] Real-time quantitative PCR (qPCR): Primer sequences: Filamentin (FLG) FLG-FAGACACCCCGGATCCTCTC, FLG-R GTGACCATGTTCCTTAGCGGT; Lorinin (LOR) LOR-FGCTCTCATGATGCTACCCGA, LOR-R AGCAGAACTAGATGCAGCCG.
[0092] Reaction system: 20 μL system, 10 μL 2* fluorescent quantitative enzyme (Tiangen Biotech), 0.6 μL forward primer (10 μM), 0.6 μL reverse primer (10 μM), 3 μL cDNA, 5.8 μL RNase-free H2O. Reaction conditions: 95℃ pre-denaturation for 15 min; 95℃ denaturation for 10 s, 60℃ annealing for 32 s (40 cycles).
[0093] Using GAPDH as an internal reference gene, the relative expression levels of skin barrier function-related genes (FLG, LRO) in relevant samples were detected. The gene expression level of the control sample was set to 1. For other samples, an expression level greater than 1 was considered higher than the control group (gene upregulation), and an expression level less than 1 was considered lower than the control group (gene downregulation).
[0094] 1.3 Evaluation of Immune Regulation Capacity Test Basis: Skin macrophages are a core component of the skin's immune system, and their phagocytic activity directly relates to the skin's ability to defend against pathogens, clear damaged tissue, and maintain homeostasis. Postbiotics, as metabolites of probiotics, contain various active ingredients that can directly act on macrophages, enhancing their phagocytic efficiency. Neutral red is a live dye that can be phagocytosed by macrophages and accumulated in lysosomes. The dye content in lysosomes was determined spectrophotometrically to quantitatively assess phagocytic activity.
[0095] Test method: Log-phase RAW264.7 cells (purchased from the National Experimental Cell Resource Sharing Platform) were seeded into 96-well plates and cultured for 24 h. The supernatant was carefully discarded. Five replicates were created for each well: a blank control group (containing only culture medium), a normal control group (cells + culture medium), and a sample group (cells + sample solutions of different concentrations). After 24 h of culture, the supernatant was discarded, the cells were washed once with PBS, and then neutral red solution was added. The cells were incubated in the dark for 10 min. The neutral red solution was discarded, and the cells were washed three times with PBS. Prepared cell lysis buffer was added to each well, and the cells were incubated in the dark for 30 min. The OD values of each well were measured at 570 nm, and the relative phagocytic activity of different sample groups was calculated.
[0096] The culture medium was: 90% v / v DMEM high glucose medium + 10% v / v fetal bovine serum.
[0097] Relative phagocytic activity (%) = [(sample well OD value - blank well OD value) / (control well OD value - blank well OD value) - 1] × 100%.
[0098] 1.4 Evaluation of anti-inflammatory capacity Test Basis: Metabolic products of skin microorganisms can reduce the release of inflammatory factors by acting on pattern recognition receptors and immune cells in the skin. NO is an endogenous gaseous signaling molecule that reflects the level of intracellular inflammatory factors. The anti-inflammatory capacity of metabiotics was evaluated using a relative model method to determine the percentage reduction in NO.
[0099] Test method: Log-phase RAW264.7 cells (purchased from the National Experimental Cell Resource Sharing Platform) were seeded into 24-well plates and cultured for 24 h. The supernatant was carefully discarded. A normal control group, an LPS-induced model group (culture medium + 1 μg / mL LPS), and a sample group containing the test sample (culture medium + 1 μg / mL LPS + test sample) were set up. The corresponding solutions were added to each well, and the cells were cultured for 24 h. Following the instructions of the nitric oxide kit (Beyotime Biotechnology Co., Ltd.), 50 μL of culture supernatant was taken from each well, followed by 50 μL of reagent 1 and then 50 μL of reagent 2. OD540 was measured, and the NO concentration in each well was calculated based on the standard curve.
[0100] The culture medium was: 90% v / v DMEM high glucose medium + 10% v / v fetal bovine serum.
[0101] The formula for calculating the percentage reduction in NO is: Percentage reduction in NO = (NO concentration in model wells - NO concentration in sample wells) / NO concentration in model wells × 100%.
[0102] Table 9. Evaluation results of the efficacy of post-biotics
[0103] The results showed that both the lysate and filtrate of the two metabiotic Bifida ferment lysate could achieve corresponding skincare effects by mimicking the mechanism of microecological skincare. Compared to the filtrate, which mainly consists of soluble metabolites, the lysate further contains cell wall components (teichoic acid, peptidoglycan, surface proteins, etc.) and intracellular components (amino acids, peptides, genetic material, etc.) of the fermenting bacteria, which can better mimic the skincare pathway of probiotics and exhibit better barrier protein repair, immune regulation, and inflammation control capabilities.
[0104] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions made by those skilled in the art to the technical solution of the present invention do not depart from the essence and scope of the technical solution of the present invention.
Claims
1. A high moisturizing microecological skin care cream base, characterized in that, The micro-ecological skin care cream base comprises water, oil component, emulsifier, thickening agent, prebiotic, postbiotic, biomimetic natural moisturizing factor solution and pH regulator; The oil component comprises at least one of squalane and jojoba seed oil; The prebiotic is one or more of alpha-glucan oligosaccharide, inulin and fructose; The biomimetic natural moisturizing factor solution comprises free amino acid, pyrrolidone carboxylic acid and sodium salt thereof, lactic acid and sodium salt thereof, and urea.
2. The microecological care cream base according to claim 1, characterized in that, The oil component further comprises one or more of isononyl isononanoate and dicaprylyl carbonate; And / or, the prebiotic is selected from alpha-glucan oligosaccharide; And / or, the postbiotic is a fermentation product of schizochytrium sp. lysate.
3. The microecological care cream base according to claim 1, characterized in that, The biomimetic natural moisturizing factor solution comprises 5%-40% of free amino acid, 2-12% of pyrrolidone carboxylic acid and sodium salt thereof, 2-12% of lactic acid and sodium salt thereof, and 2-8% of urea by weight percentage.
4. The microecological care cream base according to claim 1, characterized in that, The free amino acid comprises one or more of serine, glycine, alanine, arginine, glutamic acid, threonine, arginine, lysine and proline.
5. The microecological care cream base according to claim 1, characterized in that, The emulsifier is an oil-in-water type emulsifier selected from one or more of steareth-2, steareth-21, polyglyceryl-10 stearate, polysorbate-60, cetyl stearyl glucoside, arachidyl glucoside, hydrogenated lecithin and glyceryl stearate.
6. The microecological care cream base according to claim 1, characterized in that, The thickening agent is one or more of carbomer, xanthan gum, carrageenan, starch and carboxymethyl cellulose. And / or, the pH regulator comprises one or more of arginine, sodium hydroxide, potassium hydroxide, triethanolamine, citric acid and sodium citrate.
7. The microecological care cream base according to any of claims 1 to 6, characterized in that The micro-ecological skin care cream base comprises water, oil component, emulsifier, thickening agent, prebiotic, postbiotic, biomimetic natural moisturizing factor solution and pH regulator; The oil component comprises at least one of squalane and jojoba seed oil; 8. A microecological skin care cream base according to any one of claims 1 to 7, characterized in that, The prebiotic is one or more of alpha-glucan oligosaccharide, inulin and fructose; The biomimetic natural moisturizing factor solution comprises free amino acid, pyrrolidone carboxylic acid and sodium salt thereof, lactic acid and sodium salt thereof, and urea. The oil component further comprises one or more of isononyl isononanoate and dicaprylyl carbonate; And / or, the prebiotic is selected from alpha-glucan oligosaccharide; And / or, the postbiotic is a fermentation product of schizochytrium sp. lysate.
9. The production method according to claim 8, characterized by, The biomimetic natural moisturizing factor solution comprises 5%-40% of free amino acid, 2-12% of pyrrolidone carboxylic acid and sodium salt thereof, 2-12% of lactic acid and sodium salt thereof, and 2-8% of urea by weight percentage. The free amino acid comprises one or more of serine, glycine, alanine, arginine, glutamic acid, threonine, arginine, lysine and proline. The emulsifier is an oil-in-water type emulsifier selected from one or more of steareth-2, steareth-21, polyglyceryl-10 stearate, polysorbate-60, cetyl stearyl glucoside, arachidyl glucoside, hydrogenated lecithin and glyceryl stearate. The thickening agent is one or more of carbomer, xanthan gum, carrageenan, starch and carboxymethyl cellulose. And / or, the pH regulator comprises one or more of arginine, sodium hydroxide, potassium hydroxide, triethanolamine, citric acid and sodium citrate. The micro-ecological skin care cream base comprises water, oil component, emulsifier, thickening agent, prebiotic, postbiotic, biomimetic natural moisturizing factor solution and pH regulator; The oil component comprises at least one of squalane and jojoba seed oil; The prebiotic is one or more of alpha-glucan oligosaccharide, inulin and fructose; The biomimetic natural moisturizing factor solution comprises free amino acid, pyrrolidone carboxylic acid and sodium salt thereof, lactic acid and sodium salt thereof, and urea. The oil component further comprises one or more of isononyl isononanoate and dicaprylyl carbonate; And / or, the prebiotic is selected from alpha-glucan oligosaccharide; And / or, the postbiotic is a fermentation product of schizochytrium sp. lysate. The biomimetic natural moisturizing factor solution comprises 5%-40% of free amino acid, 2-12% of pyrrolidone carboxylic acid and sodium salt thereof, 2-12% of lactic acid and sodium salt thereof, and 2-8% of urea by weight percentage. The free amino acid comprises one or more of serine, glycine, alanine, arginine, glutamic acid, threonine, arginine, lysine and proline. The emulsifier is an oil-in-water type emulsifier selected from one or more of steareth-2, steareth-21, polyglyceryl-10 stearate, polysorbate-60, cetyl stearyl glucoside, arachidyl glucoside, hydrogenated lecithin and glyceryl stearate. The thickening agent is one or more of carbomer, xanthan gum, carrageenan, starch and carboxymethyl cellulose. And / or, the pH regulator comprises one or more of arginine, sodium hydroxide, potassium hydroxide, triethanolamine, citric acid and sodium citrate. The micro-ecological skin care cream base comprises water, oil component, emulsifier, thickening agent, prebiotic, postbiotic, biomimetic natural moisturizing factor solution and pH regulator; The oil component comprises at least one of squalane and jojoba seed oil; The prebiotic is one or more of alpha-glucan oligosaccharide, inulin and fructose; The biomimetic natural moisturizing factor solution comprises free amino acid, pyrrolidone carboxylic acid and sodium salt thereof, lactic acid and sodium salt thereof, and urea. The oil component further comprises one or more of isononyl isononanoate and dicaprylyl carbonate; And / or, the prebiotic is selected from alpha-glucan oligosaccharide; And / or, the postbiotic is a fermentation product of schizochytrium sp. lysate. The biomimetic natural moisturizing factor solution comprises 5%-40% of free amino acid, 2-12% of pyrrolidone carboxylic acid and sodium salt thereof, 2-12% of lactic acid and sodium salt thereof, and 2-8% of urea by weight percentage. The free amino acid comprises one or more of serine, glycine, alanine, arginine, glutamic acid, threonine, arginine, lysine and proline. The emulsifier is an oil-in-water type emulsifier selected from one or more of steareth-2, steareth-21, polyglyceryl-10 stearate, polysorbate-60, cetyl stearyl glucoside, arachidyl glucoside, hydrogenated lecithin and glyceryl stearate. The thickening agent is one or more of carbomer, xanthan gum, carrageenan, starch and carboxymethyl cellulose. And / or, the pH regulator comprises one or more of arginine, sodium hydroxide, potassium hydroxide, triethanolamine, citric acid and sodium citrate. The micro-ecological skin care cream base comprises water, oil component, emulsifier, thickening agent, prebiotic, postbiotic, biomimetic natural moisturizing factor solution and pH regulator; The oil component comprises at least one of squalane and jojoba seed oil; The prebiotic is one or more of alpha-glucan oligosaccharide, inulin and fructose; The biomimetic natural moisturizing factor solution comprises free amino acid, pyrrolidone carboxylic acid and sodium salt thereof, lactic acid and sodium salt thereof, and urea. The oil component further comprises one or more of isononyl isononanoate and dicaprylyl carbonate; And / or, the prebiotic is selected from alpha-glucan oligosaccharide; And / or, the postbiotic is a fermentation product of schizochytrium sp. lysate. The biomimetic natural moisturizing factor solution comprises 5%-40% of free amino acid, 2-12% of pyrrolidone carboxylic acid and sodium salt thereof, 2-12% of lactic acid and sodium salt thereof, and 2-8% of urea by weight percentage. The free amino acid comprises one or more
Citation Information
Patent Citations
Composition capable of regulating microecological balance of skin, application thereof, body lotion containing same and preparation method thereof
CN109498543A
Grease composition for balancing skin micro-ecology and skin moistening emulsion thereof
CN114522120A