Chemically competent cell capable of stably storing RecET enzyme as well as preparation method and application of chemically competent cell

Abstract

The invention belongs to the technical field of molecular biology, and discloses a chemically competent cell capable of stably storing RecET enzyme as well as a preparation method and application of the chemically competent cell. The technical problem to be solved by the invention is how to solve the problems of high time consumption and low conversion rate of competent cell preparation in DNA cloning. In order to solve the technical problem, the invention provides a composition containing glycerol and calcium chloride and a reagent containing the composition, and the invention also provides a method for stably storing competent cells, and the method comprises the step of mixing the composition or solution with competent cells. And the competent cell can be an escherichia coli GB05-dir strain into which a pSC101-BAD-ETGA-tet plasmid is also introduced.

Description

Technical Field

[0001] This application belongs to the field of bioengineering technology, specifically relating to a chemically competent cell capable of stably storing RecET enzyme, its preparation method and application, applicable to the cloning of long DNA fragments in synthetic biology, gene function research, metabolic pathway engineering and other scenarios. Background Technology

[0002] DNA cloning is a fundamental technique in molecular biology research; however, efficient cloning of large DNA fragments (typically >8kb) has always been a technical bottleneck in the field. Currently, mainstream cloning methods are divided into two categories: in vitro assembly and in vivo recombination. In vitro assembly methods, such as In-Fusion cloning, are widely used due to their ease of operation and high throughput, but they rely on in vitro homologous recombinases to mediate fragment ligation, which easily generates incomplete ligation intermediates, resulting in extremely low efficiency for large fragment cloning. In vivo recombination methods, such as yeast TAR cloning and E. coli RecET cloning, can efficiently clone large DNA fragments, but yeast TAR cloning is complex, and RecET cloning requires freshly prepared transformed competent cells (each experiment takes 2 days) and relies on electroporation equipment, making it difficult to meet the demands of high-throughput experiments.

[0003] In existing technologies, although the GB05-dir strain is a modified RecET recombinant strain, its RecET expression level in its genome is low, resulting in limited efficiency in large-fragment cloning and hindering its widespread application. Conventional chemocompetent cells (such as DH5α) lack RecA enzymes and contain exonucleases, making them unable to repair incomplete intermediates generated during In-Fusion assembly, further limiting the efficiency and convenience of large-fragment cloning. Therefore, developing a competent cell that combines "convenient in vitro assembly" with "high efficiency in in vivo recombination" and can be stored long-term is crucial to solving the problem of large-fragment DNA cloning. Summary of the Invention

[0004] The technical problem this application aims to solve is: how to address the issues of time-consuming preparation and low conversion rate in DNA cloning due to the lack of competent cells. To solve the above technical problem, this application provides the following technical solution: This application provides a composition for storing competent cells, the composition comprising glycerol and calcium chloride, wherein the glycerol content is from 50 mL to 200 mL and the calcium chloride content is from 0.01 mol to 0.20 mol.

[0005] Furthermore, in the composition, the content of glycerol is 100 mL and the content of calcium chloride is 0.1 mol.

[0006] In this application, the composition may consist of glycerol and calcium chloride. In this application, the composition may also include water.

[0007] This application also provides a reagent comprising the above-described composition. In the reagent, glycerol and calcium chloride are packaged separately.

[0008] This application also provides a solution for storing competent cells, the solution comprising the above-described composition and solvent.

[0009] In this application, the solvent may be water. Further, the water may be double-distilled water (ddH2O) or ultrapure water. In one specific embodiment of this application, the water is double-distilled water (ddH2O).

[0010] This application also provides the use of the above-described compositions or solutions in preserved cells and / or in the preparation of products containing preserved cells.

[0011] This application also provides a method for stably storing competent cells, the method comprising the step of mixing the competent cells with the above-described composition or solution.

[0012] In this application, before the above-mentioned composition or solution is mixed with the competent cells, a step of pretreatment of the competent cells is further included, wherein the pretreatment includes contacting the competent cells with a CaCl2-MgCl2 solution.

[0013] In some embodiments of this application, the concentrations of the solvents CaCl2 and MgCl2 in the CaCl2-MgCl2 solution are 0.02 mol / L and 0.08 mol / L, respectively, and the solvent of the CaCl2-MgCl2 solution is water.

[0014] In this application, the competent cells may be Escherichia coli.

[0015] In this application, the Escherichia coli may be the Escherichia coli GB05-dir strain.

[0016] In this application, the pSC101-BAD-ETgA-tet plasmid was also introduced into the Escherichia coli GB05-dir strain.

[0017] In this application, Escherichia coli GB05-dir is based on the DH10B strain with the fhuA, ybcC, and recET genes knocked out, and further integrates the PBAD-ETgA operon (containing the full-length recE, recT, redγ, and recA genes under the arabinose-induced PBAD promoter) at the ybcC site.

[0018] In this application, the pSC101-BAD-ETgA-tet plasmid is tetracycline resistant and carries the complete PBAD-ETgA operon and a temperature-sensitive pSC101 replication initiation site, which can replicate at 30°C but not at 37°C. Therefore, it can be eliminated from the host by temperature switching without selective pressure.

[0019] In this application, the purity grade of the glycerol, CaCl2, or MgCl2 may be analytical grade or / and superior grade. In one specific embodiment of this application, the purity grade of the glycerol, CaCl2, or MgCl2 is analytical grade.

[0020] The beneficial technical effects achieved by this application are as follows: Addressing the triple pain points of existing technologies—low efficiency in in vitro cloning of large fragments, cumbersome in vivo recombination procedures, and inability to long-term store competent cells—this invention provides a chemocompetent cell capable of stably storing the RecET enzyme, achieving: (1) No need to prepare competent cells fresh: RecET activity remains stable after storage at -80℃ for 1-3 months; (2) No electroconversion equipment required: 42℃ thermal shock conversion is used, which conforms to conventional laboratory operating practices; (3) High-efficiency cloning of large DNA fragments: The cloning efficiency of 2.5 kb and 4.5 kb fragments is significantly improved, and large fragments of 8 kb and 10 kb can be cloned efficiently, realizing the process from scratch; (4) No residual vector contamination: The recombinant plasmid is self-eliminated when cultured at 37℃, avoiding interference with downstream experiments (such as plasmid extraction and gene expression). Attached Figure Description

[0021] Figure 1 Western blot analysis of RecA protein expression in competent cells (using GAPDH as an internal control) showed that RecA protein was significantly expressed after induction. Figure 2 Q-PCR was used to detect the ligation efficiency of the left and right ends of different strains (DH5α, DH5α-ET, GB05-dir, GB05-dir-ET). The ligation ratio of GB05-dir-ET was significantly higher than that of other strains at 6h and 9h. Figure 3 The number of positive clones of different lengths (2.5 to 10 kb) in various strains was statistically analyzed, and GB05-dir-ET showed the highest efficiency in cloning of 8 kb and 10 kb fragments. Figure 4The comparison of the number of positive clones with 10 kb fragments after 1 day, 1 month, and 3 months of storage of GB05-dir-ET competent cells demonstrates storage stability. Detailed Implementation

[0022] I. Terms used in this application: Examples of resources describing many of the molecular biology-related terms used in this article can be found in the following literature: Alberts et al., Molecular Biology of The Cell, 5th ed., Garland Science Publishing, Inc.: New York, 2007; Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed., Springer-Verlag: New York, 1991; King et al., A Dictionary of Genetics, 6th ed., Oxford University Press: New York, 2002; and Lewin, GenesIX, Oxford University Press: New York, 2007.

[0023] Any references cited in this article, including, for example, all patents, published patent applications and non-patent publications, are incorporated in their entirety by reference.

[0024] For ease of understanding this application, several terms and abbreviations used herein are defined as follows: When used in a list of two or more items, the term "and / or" means that any of the listed items can be used alone or in combination with any one or more of the listed items. For example, the expression "A and / or B" is intended to mean either or both of A and B, i.e., A alone, B alone, or a combination of A and B. The expression "A, B and / or C" means A alone, B alone, C alone, a combination of A and B, a combination of A and C, a combination of B and C, or a combination of A, B and C.

[0025] The term "comprising" is not intended to be restrictive, but rather inclusive and implies the presence of other elements besides those listed, and can be interpreted as "including but not limited to". The term "comprising" also encompasses the terms "consisting of" and "substantially consisting of". In this document, the terms "including" and "comprise" are used interchangeably.

[0026] The term "transcribed DNA" refers to DNA that can be transcribed into RNA molecules.

[0027] The term "operationally ligated" can refer to a functional connection between a promoter and transcribed DNA, enabling the promoter to function and initiate transcription of the transcribed DNA. The term "operationally ligated" can also refer to a functional connection between other regulatory elements and a target gene to regulate the transcription and / or expression of the target gene.

[0028] The term "construct" refers to any recombinant DNA or recombinant RNA molecule. Recombinant DNA molecules can be plasmids, granules, viruses, bacteriophages, or linear or circular DNA. Constructs typically include one or more expression cassettes.

[0029] As used herein, an "expression cassette" refers to a cassette containing at least transcribed DNA operatively linked to one or more regulatory elements, typically at least a promoter and a 3' UTR (such as a terminator).

[0030] As used herein, the term "vector" refers to any construct that can be used for transformation purposes, i.e., to introduce heterologous DNA into a host cell. Examples include plasmids, granules, viruses, bacteriophages, or linear or circular DNA.

[0031] II. Implementation Examples The present application will now be described in further detail with reference to specific embodiments. The embodiments given are merely illustrative of the present application and are not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the present application in any way.

[0032] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0033] The *E. coli* GB05-dir and pSC101-BAD-ETgA-tet plasmids described in the following examples were kindly provided by Professor Hailong Wang of Shandong University and are disclosed in the literature “Hailong Wang, et al. exonuclease in vitro assembly combined with RecET recombination for highly efficient direct DNA cloning from complex genomes. Nucleic Acids Research, 2017 1. doi: 10.1093 / nar / gkx1249”. *E. coli* GB05-dir is based on the DH10B strain with the fhuA, ybcC, and recET genes knocked out, and further integrated P at the ybcC site. BAD -ETgA operon (containing the full-length genes recE, recT, redγ, and recA under the arabinose-induced PBAD promoter). pSC101-BAD-ETgA-tet is tetracycline resistant and carries the complete PBAD-ETgA operon and a temperature-sensitive pSC101 replication initiation site, which replicates at 30°C but not at 37°C. Therefore, it can be eliminated from the host by temperature switching in the absence of selective pressure. The public can obtain the relevant biological materials from the applicant. The obtained materials can only be used for the verification of the technical solution of this application and cannot be used for other purposes.

[0034] The pcambia1300 plasmid used in the following examples was preserved in our laboratory and is disclosed in the literature "Xueyong Li, QianQian, et al., Jiayang Li. Control of tillering in rice. Nature VOL 422 10 APRIL 2003.". The public can obtain the relevant biological materials from the applicant; however, the obtained materials can only be used for the verification of the technical solution of this application and cannot be used for other purposes.

[0035] Unless otherwise specified, the quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0036] Example 1: Preparation of chemically competent cells capable of stably storing RecET enzyme 1. Experimental materials Strains: Escherichia coli GB05-dir, DH5α; Plasmids: pSC101-BAD-ETgA-tet (tetracycline resistance), pcambia1300 (kanamycin resistance); Reagents: 10% L-arabinose (Sigma-Aldrich, A3256), 5×In-Fusion enzyme (Takara, 639649), restriction endonucleases EcoRI and HindIII (NEB), LB medium, tetracycline (10 μg / ml), kanamycin (50 μg / ml).

[0037] 2. Preparation of chemocompetent cells capable of stably storing RecET enzyme The experiment was divided into four groups: Group 1: DH5α; Group 2: DH5α-ET; Group 3: GB05-dir; Group 4: GB05-dir-ET.

[0038] The competent cells in groups 1 and 3 do not undergo the following step "(2) Recombinant plasmid transformation".

[0039] The following uses GB05-dir-ET competent cells as an example to illustrate the preparation process of chemically competent cells that can stably store RecET enzyme.

[0040] (1) Transformation of recombinant plasmid: Take 1 ng pSC101-BAD-ETgA-tet plasmid, add it to 100 μl GB05-dir competent cells (prepared by conventional methods in this field), incubate on ice for 30 min, heat shock at 42℃ for 90 s, incubate on ice for 2 min, add 1 ml LB medium, revive at 37℃ for 1 h, spread on LB plates containing 10 μg / ml tetracycline, and name the positive clones that grow as GB05-dir-ET, and culture at 30℃ for 2 days; (2) Scale-up and induction: Pick a single colony and inoculate it into 5 ml of LB liquid medium containing 5 μg / ml tetracycline, and incubate overnight at 30℃ and 220 rpm; take 1 ml of the overnight bacterial culture and transfer it to 100 ml of LB medium containing 5 μg / ml tetracycline, and incubate at 30℃ for 3 h (OD). 600 =0.35 to 0.4), add 2 ml of 10% L-arabinose, and incubate at 37°C for 40 min (OD 600 = 0.7 to 0.8); take bacterial culture samples for Western blot detection of RecA protein expression in competent cells, and use the remaining bacterial culture for step (4).

[0041] (3) Preparation and storage of competent cells: Incubate the bacterial culture on ice for 20 min, centrifuge at 2℃ and 3000 × g for 20 min, and discard the supernatant; resuspend in 300 ml of ice-cooled 0.1 mol / L CaCl2-MgCl2 solution, centrifuge at 2℃ and 3000 × g for 20 min, and discard the supernatant; resuspend in 2 ml of ice-cooled 0.1 mol / L CaCl2 solution containing 10% glycerol, aliquot 100 μl / tube, use one part for “3. Large fragment DNA In-Fusion cloning application”, and store the other part at -80℃.

[0042] The formulation of the 0.1 mol / L CaCl2-MgCl2 solution is as follows: 0.02 mol / L CaCl2 (analytical grade) and 0.08 mol / L MgCl2 (analytical grade), with double-distilled water as the solvent.

[0043] The formula for a 0.1 mol / L CaCl2 solution containing 10% glycerol is: 100 mL glycerol (analytical grade), 0.1 mol / L CaCl2 (analytical grade), and double-distilled water as the solvent.

[0044] The preparation of Escherichia coli DH5α-ET competent cells was carried out in accordance with Escherichia coli GB05-dir-ET.

[0045] Western blot analysis is a routine procedure and will not be described in detail here. The primary antibody used was RecA antibody (Huaan Biotechnology Co., Ltd., HA723165); the secondary antibody was horseradish peroxidase-labeled goat anti-rabbit IgG (H+L) antibody (Beyotime Biotechnology Co., Ltd., A0208).

[0046] Western blot results are as follows Figure 1 As shown, the results indicate that RecA protein was not detected in Escherichia coli DH5α, while DH5α-ET showed a significant RecA protein imprint after induction. Compared to GB05-dir, the RecA protein content of the induced Escherichia coli GB05-dir-ET was significantly increased.

[0047] 3. Applications of large DNA in-fusion cloning (1) Preparation of target fragment and vector: 2.5kb (SEQ ID NO:1), 4.5kb (SEQ ID NO:2), 8kb (SEQ ID NO:3), and 10kb (SEQ ID NO:4) target fragments (with 20bp sequences homologous to the pcambia1300 vector at both ends) were amplified by PCR. The pcambia1300 vector was digested with EcoRI and HindIII to obtain the digested vector. The target fragment and the digested vector were recovered by agarose gel electrophoresis. In SEQ ID NO:1, positions 1 to 20 and 2495 to 2514 are homologous arm sequences, positions 21 to 1474 are the nucleotide sequences of the promoter, and positions 1475 to 2494 are the nucleotide sequences of the gene encoding the gene.

[0048] In SEQ ID NO:2, positions 1 to 20 and 4613 to 4632 are homologous arm sequences, positions 21 to 1474 are the nucleotide sequences of the promoter, positions 1475 to 4141 are the coding sequences of the gene, and positions 41421 to 4398 are the nucleotide sequences of the terminator.

[0049] In SEQ ID NO:3, positions 1 to 20 and 8023 to 8042 are homologous arm sequences, positions 21 to 1474 are the nucleotide sequences of the promoter of the left expression cassette, positions 1475 to 4141 are the coding sequence of the coding gene, positions 4142 to 4398 are the nucleotide sequences of the terminator, and positions 4421 to 6420 are the nucleotide sequences of the promoter of the right expression cassette.

[0050] In SEQ ID NO:4, positions 1 to 20 and 10515 to 10534 are homologous arm sequences; positions 21 to 1474 are the nucleotide sequences of the left-hand expression cassette promoter; positions 1475 to 4141 are the coding sequence of the gene; and positions 4142 to 4398 are the nucleotide sequences of the terminator. Positions 4421 to 6420 are the promoter of the right-hand expression cassette; positions 6421 to 10032 are the coding sequence of the gene; and positions 10036 to 10286 are the nucleotide sequences of the terminator.

[0051] (2) In vitro In-Fusion assembly: 10 μl assembly system contains: target fragment (100 ng), enzyme digestion vector (50 ng), 5×In-Fusion enzyme (2 μl), incubated at 50℃ for 15 min; (3) Quantitative PCR analysis of ligation efficiency: 10 μl of the assembly product of 4.5kb and pcambia1300 was added to 100 μl of DH5α, DH5α-ET, GB05-dir and GB05-dir-ET competent cells (prepared in the above steps of "(3) preparation and storage of competent cells"), ice bath for 30 min, heat shock at 42℃ for 90 s, ice bath for 2 min; 1 ml of LB medium was added, and the cells were thawed at 37℃ for 1 h; then the supernatant was discarded by centrifugation, and the precipitated strain was added to LB liquid medium containing 50 ug / ml kanamycin and cultured on a shaker (220 rpm / 37℃) with the timer set to 0. Samples were taken at 1 h, 3 h, 6 h and 9 h after culture and quantitative PCR primers were used to detect the ligation efficiency of the left and right ends of the four competent cells at different time points.

[0052] The quantitative PCR was performed according to the instructions of the SsoFast EvaGreen Supermix kit (Bio-Rad, 172-5201AP). The primer sequences (5' to 3') for quantitative PCR are as follows: 4.5L-qF:CCCTAGGCCGCATAACTTCG; 4.5L-qR:TAACGCCAGGTTTTCCCAG; 4.5R-qF: AGGCTCAGACTAAGCGAAGG; 4.5R-qR:TGGCTTGTGGAAACACTTGG; q1300-F: CTCTTCGGGCTTTTCCGTCT; q1300-R: ATCGAGCTGTATGCGGAGTG.

[0053] Primers 4.5L-qF and 4.5L-qR were used to detect the left-end target fragment (the target fragment after the DNA molecule at the 3' end of SEQ ID NO:2 is ligated to the backbone vector), primers 4.5R-qF and 4.5R-qR were used to detect the right-end target fragment (the target fragment after the DNA molecule at the 5' end of SEQ ID NO:2 is ligated to the backbone vector), and primers q1300-F and q1300-R were used to detect the internal reference gene located on pcambia1300.

[0054] The formula for calculating relative expression level is: Relative expression level = 2 -△Ct , where △ Ct = Ct 目的基因 - Ct 内参基因 .

[0055] The results are as follows Figure 2 As shown, the results indicate that the ligation rate of GB05-dir-ET at 6h and 9h was significantly higher than that of other strains.

[0056] (4) Transformation and screening: Take 10 μl of the assembly product and add 100 μl of competent cells (prepared in the above steps of "(3) preparation and storage of competent cells"), incubate on ice for 30 min, heat shock at 42℃ for 90 s, and incubate on ice for 2 min; add 1 ml of LB medium and revive at 37℃ for 1 h; take 200 μl of bacterial solution and spread it on an LB plate containing 50 μg / ml kanamycin, and incubate at 37℃ for 16 hours to count positive clones.

[0057] The results are as follows Figure 3 As shown, the number of positive clones of Escherichia coli GB05-dir-ET was the highest among the integrations of 2.5kb, 4.5kb, 8kb and 10kb target fragments.

[0058] 4. Storage stability verification Competent cells stored at -80℃ for 1 day, 1 month, and 3 months were taken, and step "3. Application of Large DNA In-Fusion Cloning" was repeated to test the cloning efficiency. The results are as follows: Figure 4 As shown, the results indicate that there was no significant difference in the number of positive clones of the 10kb fragment at each time point (P>0.05).

[0059] The present application has been described in detail above. Those skilled in the art will recognize that the present application can be implemented in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments are given in this application, it should be understood that further modifications can be made to the present application. In summary, in accordance with the principles of this application, this application is intended to include any changes, uses, or improvements to the present application, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A composition for storing competent cells, the composition comprising glycerol and calcium chloride, wherein the glycerol content is from 50 mL to 200 mL and the calcium chloride content is from 0.01 mol to 0.20 mol.

2. The composition according to claim 1, characterized in that: In the composition, the content of glycerol is 100 mL and the content of calcium chloride is 0.1 mol.

3. A reagent, characterized in that: The reagent contains the composition according to claim 1 or 2.

4. A solution for storing competent cells, the solution comprising the composition of claim 1 or 2 and a solvent, wherein the solvent is water.

5. The use of the composition of claim 1 or 2 or the solution of claim 4 in the preservation of cells and / or in the preparation of products containing preserved cells.

6. A method for stably storing competent cells, characterized in that: The method includes the step of mixing competent cells with the composition of claim 1 or 2 or the solution of claim 4.

7. The method according to claim 6, characterized in that: It also includes a step of pretreating the competent cells, the pretreatment comprising contacting the competent cells with a CaCl2-MgCl2 solution.

8. The method according to claim 6 or 7, characterized in that: The competent cells are Escherichia coli.

9. The method according to claim 8, characterized in that: The Escherichia coli strain mentioned is Escherichia coli GB05-dir.

10. The method according to claim 9, characterized in that: The pSC101-BAD-ETgA-tet plasmid was also introduced into the Escherichia coli GB05-dir strain.

Images