Recombinant bacillus subtilis for producing lactoyl-N-trisaccharide as well as construction method and application of recombinant bacillus subtilis

By integrating and expressing genes related to the lactoyl-N-trisaccharide synthesis pathway into Bacillus subtilis, recombinant Bacillus subtilis was constructed, solving the problems of low synthesis efficiency and mismatch between biomass and synthesis efficiency in lactoyl-N-trisaccharide production. This enabled efficient and low-cost fermentation production of lactoyl-N-trisaccharides, with yields reaching 13.7 g/L to 42 g/L.

CN121718481AActive Publication Date: 2026-03-24TIANJIN UNIV OF SCI & TECH
View PDF 7 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-26
Publication Date
2026-03-24

AI Technical Summary

Technical Problem

In the existing technology, the engineered strain of Escherichia coli used for the microbial fermentation method to produce lactoyl-N-trisaccharide is not suitable for the food and pharmaceutical fields. Furthermore, Bacillus subtilis has low lactoyl-N-trisaccharide synthesis efficiency, mismatch between biomass and synthesis efficiency, and unreasonable precursor carbon flow distribution, making it difficult to achieve efficient and low-cost large-scale production.

Method used

Genes expressing the lactoyl-N-trisaccharide synthesis pathway were integrated into Bacillus subtilis 168. By directionally integrating the lactose transport gene lacY, the lactoyl-N-trisaccharide synthesis-related gene NGlgtA, the transport protein CmSET, and the promoter Pc2up at specific genomic sites, and introducing the dCas9 transcriptional regulation system to downregulate the expression level of the bypass pathway gene pfkA, recombinant Bacillus subtilis was constructed.

Benefits of technology

It significantly improved the yield of lactyl-N-trisaccharide, reaching 13.7 g/L after 72 h of shake flask fermentation and 42 g/L after 72 h of fermentation in a 5 L fermenter. This solved the problems of low synthesis efficiency and mismatch between strain biomass and synthesis efficiency, laying the foundation for industrial production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121718481A_ABST
    Figure CN121718481A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of bioengineering, and discloses a recombinant bacillus subtilis for producing lactyl-N-trisaccharide, a construction method and application, the recombinant bacillus subtilis is prepared by taking bacillus subtilis as an original strain, selecting amyE, lytG, lytC, srfAB, lytH, sigF, glmS, aprE and srfAC on a genome as integration sites, and preparing a recombinant bacillus subtilis strain; and directionally integrating lactyl-N-trisaccharide synthesis and regulation related genes to the sites through a homologous recombination technology. Lactyl-N-trisaccharide synthesis and regulation related genes are directionally integrated at the specific genome site of bacillus subtilis, and metabolic flux is optimized by combining a transcriptional regulation system, so that the product yield and the strain biomass are synergistically improved, and the method is obviously superior to the prior art.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, and in particular to a recombinant Bacillus subtilis strain for producing lactoyl-N-trisaccharide, its construction method, and its application. Background Technology

[0002] While breast milk provides essential nutrition for newborns, human milk oligosaccharides (HMOs) play a crucial role in the development of the immune system, brain development, and gut microbiota. To date, over 200 HMO structures have been identified, some of which are widely used in infant formula production. Generally, HMOs can be classified into three types based on their core structure: fucosylated, sialylated, and neutral. Lactoyl-N-trisaccharide (LNT II, ​​GlcNAcβ1-3Galβ1-4Glc) is a neutral oligosaccharide with significant biological and chemical applications. Furthermore, LNT II can serve as the core unit for other neutral HMOs, such as lactoyl-N-tetrasaccharide (LNT, Galβ1-3 GlcNAcβ1-3lactose) and lactoyl-N-neotetrasaccharide (LNnT, Galβ1-4GlcNAcβ1-3lactose), allowing for the synthesis of even more types of HMOs by elongating the sugar chain. Therefore, the efficient production of LNT II is of great significance.

[0003] Currently, only *Escherichia coli* is an engineered strain used for the microbial fermentation process to produce lactoyl-N-trisaccharides. However, *E. coli* is a non-food-grade strain, and the endotoxins it secretes prevent the lactoyl-N-trisaccharides it produces from being used in the food and pharmaceutical industries. Compared to many other microorganisms in nature, *Bacillus subtilis* 168 has a clear genetic background, mature gene manipulation tools, no obvious codon bias, and a strong ability to secrete extracellular proteins. Its metabolic pathway includes the synthesis of uridine diphosphate acetylglucosamine, and both of these substances can serve as substrates in the synthesis of lactoyl-N-trisaccharides.

[0004] Therefore, how to utilize Bacillus subtilis to synthesize food-grade lactyl-N-trisaccharide through metabolic engineering and fermentation is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a recombinant Bacillus subtilis for the production of lactoyl-N-trisaccharide, its construction method, and its application.

[0006] The technical solution adopted by this invention to solve its technical problem is: A recombinant Bacillus subtilis strain for the production of lactoyl-N-trisaccharide, wherein the recombinant Bacillus subtilis strain integrates and expresses genes for the lactoyl-N-trisaccharide synthesis pathway, using Bacillus subtilis as the starting strain, and in the genome...amyE , lytG , lytC , srfAB , lytH , sigF , glmS , aprE , srfAC The sites respectively integrate lactose permease derived from E. coli lacY Two copies of the gene, β-1,3-N-acetylglucosamine transferase derived from Neisseria gonorrhoeae. NGlgtA Three copies of the gene, derived from Chania multitudinisentens transport proteins CmSET , glmS Pre-integration promoter is Pc2up , lacY The promoter of a gene is Pc2up , NGlgtA The promoter of a gene is Pgrac And using the sgRNA-mediated Bacillus subtilis transcriptional regulation system dcas9 Downregulation of bypass pathway genes pfkA The level of expression; Among them, the lacY The nucleotide sequence of the gene is shown in SEQ ID NO.1. NGlgtA The nucleotide sequence of the gene is shown in SEQ ID NO.2, and the promoter is described. Pc2up The nucleotide sequence of the transport protein is shown in SEQ ID NO.3. CmSET The nucleotide sequence is shown in SEQ ID NO.4. Pgrac The nucleotide sequence is shown in SEQ ID NO.5.

[0007] Furthermore, the Bacillus subtilis is Bacillus subtilis 168; Alternatively, the yield of lactoyl-N-trisaccharide obtained by fermentation of the recombinant Bacillus subtilis is: 13.7 g / L after 72 h in a shake flask and 42 g / L in a 5 L fermenter.

[0008] The application of recombinant Bacillus subtilis in the fermentation production of lactoyl-N-trisaccharide, as described above.

[0009] The method for constructing recombinant Bacillus subtilis as described above includes the following steps: (1) Using Bacillus subtilis 168 as the starting strain, the lactose transport gene was integrated into its genome at a specific site. lacY and genes related to lactyl-N-trisaccharide synthesis NGlgtA To construct a recombinant strain with efficient lactose transport and lactyl-N-trisaccharide synthesis capabilities; (2) The strain obtained in step (1)glmS Upstream integration of promoter elements Pc2up To enhance the metabolic flux of the UDP-GlcNAc synthesis pathway; (3) Introducing lactoyl-N-trisaccharide transporters into the strain obtained in step (2). CmSET Proteins, to promote the extracellular secretion of target products; (4) Introduced through genome integration dCas9 Expression framework and corresponding sgRNA-pfkA Expression framework, constructing transcriptional regulatory system, targeting competing metabolic pathways pfkA Gene downregulation yields recombinant strains; (5) The recombinant strains obtained in step (4) are screened and identified to obtain recombinant Bacillus subtilis.

[0010] A method for producing lactoyl-N-trisaccharide by fermentation using recombinant Bacillus subtilis as described above, wherein the method uses the recombinant Bacillus subtilis strain as the production strain and utilizes a fermentation medium to produce lactoyl-N-trisaccharide.

[0011] Further, the fermentation medium consists of: glucose 70-80 g / L, lactose 11-20 g / L, yeast extract 19-22 g / L, tryptone 16-18 g / L, (NH4)2SO4 4-6 g / L, K2HPO4 7-8.5 g / L, KH2PO4 1-2.5 g / L, MgSO4·7H2O 0.1-0.2 g / L, CaCl2 0.05-0.15 g / L, and a trace element solution: MnSO4 3-3.4 mg / L, FeSO4·7H2O 11-14 mg / L, ZnSO4 6-8.0 mg / L, with water as the solvent; the initial medium pH is adjusted to 7.3-7.7.

[0012] Furthermore, the seed culture of recombinant Bacillus subtilis was inoculated into the fermentation medium, and lactyl-N-trisaccharide was produced by fermentation using a fed-batch culture method.

[0013] Furthermore, the method for preparing the seed culture medium is as follows: Recombinant Bacillus subtilis stored at -80℃ was streaked on LB agar plates and cultured overnight at 37℃. Single colonies were picked and added to LB liquid medium and cultured at 37℃ and 200 rpm for 8-10 h to obtain bacterial culture. The bacterial culture was then transferred to LB liquid medium at an inoculum of 4% and fermented at 37℃ and 220 rpm for 8-10 h to obtain seed culture.

[0014] Furthermore, the seed culture solution was inoculated into the fermentation medium at an inoculation rate of 5-10%, and lactyl-N-trisaccharide was produced by fermentation in a feed-batch fermenter. The fermentation temperature was 37℃, the aeration rate was 1.5-2.0 vvm, and the stirring speed was 600-700 rpm. After 7.5 h of culture, 15 g / L of xylose was added to the medium. During the culture, the pH was maintained at 7.3-7.7. After 12 h of fermentation, glucose was added until the end of fermentation, and the glucose concentration was maintained at 5-10 g / L. When the lactose concentration was lower than 5 g / L, lactose feed solution was added to the fermenter to raise the lactose concentration back to 15-20 g / L. The fermentation time was 72 hours.

[0015] The advantages and positive effects of this invention are as follows: 1. This invention achieves a synergistic improvement in product yield and strain biomass by directionally integrating lactyl-N-trisaccharide synthesis and regulation-related genes at specific genomic sites in Bacillus subtilis and optimizing metabolic flux by combining transcriptional regulation systems, which is significantly superior to existing technologies.

[0016] 2. This invention selects Bacillus subtilis. amyE , lytG , lytC , srfAB , lytH , sigF , glmS , srfAC , aprE The site is an integration site, which will be derived from E. coli. lacY Genes, derived from Neisseria gonorrhoeae NGlgtA Genes, origin Chania multitudinisentens transport proteins CmSET , glmS Pre-integration of the gene promoter Pc2up and the use of an sgRNA-mediated Bacillus subtilis transcriptional regulation system dcas9 Downregulation of bypass pathway genes pfkA The expression level of [the substance] accelerated the conversion of the precursor, significantly increased the yield of lactoyl-N-trisaccharide, and also increased biomass.

[0017] 3. This invention achieves site-specific integration of two copies of E. coli-derived... lacY Genes (lactose transporter gene) and three copies of Neisseria gonorrhoeae originate from NGlgtA The gene (lactyl-N-trisaccharide synthesis gene) enhances the transmembrane transport efficiency of lactose and the conversion efficiency of precursor to lactyl-N-trisaccharide, significantly improving the product synthesis capacity. During 72 h of shake-flask fermentation, strain BA01, which integrates the above gene, achieved a lactyl-N-trisaccharide yield of 6.2 g / L, laying the foundation for further optimization.

[0018] 4. The present invention is inglmS Upstream integration of the promoter Pc2up effectively relieved the feedback inhibition of the GlmS ribozyme, enhanced the UDP-GlcNAC synthesis pathway, and increased the yield of shake-flask fermentation by 42% compared with the BA01 strain, reaching 8.8 g / L. At the same time, it improved the strain's utilization efficiency of precursors.

[0019] 5. Heterologous expression in this invention CmSET This effectively promoted the extracellular secretion of lactoyl-N-trisaccharide, avoiding the feedback inhibition of strain growth caused by the intracellular accumulation of the product, while also increasing the strain's biomass. Combining all the above optimization strategies, the yield of lactoyl-N-trisaccharide increased by 20.5% to 10.6 g / L after 72 h of shake-flask fermentation.

[0020] 6. This invention utilizes sgRNA-mediated... dCas9 Transcriptional regulatory system specifically downregulates bypass genes pfkA The expression of this variable reduced the diversion of carbon sources to irrelevant metabolic pathways such as glycolysis, allowing more precursors to be directed to lactyl-N-trisaccharide synthesis. After 72 h of shake-flask fermentation, this regulatory strategy further increased the yield by 18% compared to the unregulated strain, reaching 12.5 g / L, demonstrating the significant effect of metabolic flux optimization.

[0021] 7. The lactoyl-N-trisaccharide produced by the method of the present invention has a yield of 13.7 g / L after 72 h of shaking in a flask and 42 g / L after 72 h of fermentation in a 5 L fermenter.

[0022] 8. This invention improves the production intensity of fermentation synthesis of lactyl-N-trisaccharides, has significant application advantages, and has potential and wide-ranging application value in industry.

[0023] 9. The technical problem to be solved by this invention is to integrate and express genes for the lactyl-N-trisaccharide synthesis pathway in Bacillus subtilis, thereby solving problems such as low synthesis efficiency, mismatch between strain biomass and synthesis efficiency, unreasonable precursor carbon flux allocation, difficulty in multi-gene synergistic regulation, and poor adaptability for industrial scale-up in the production of lactyl-N-trisaccharide, so as to achieve efficient and low-cost large-scale production.

[0024] 10. This invention uses Bacillus subtilis as the starting strain and selects strains from the genome... amyE , lytG , lytC , srfAB , lytH , sigF , glmS , aprE , srfAC As the integration site, homologous recombination technology was used to directionally integrate genes related to lactyl-N-trisaccharide synthesis and regulation into the aforementioned site, specifically including: two copies of genes derived from *E. coli*.lacY The gene, three copies, originates from Neisseria gonorrhoeae. NGlgtA Genes, origin Chania multitudinisentens transport proteins CmSET Encoding genes, and glmS Pre-integration promoter Pc2up, simultaneously introducing gene from dCas9 The transcriptional regulatory system, composed of genes and specific sgRNAs, downregulates bypass genes. pfkA The recombinant Bacillus subtilis significantly improved the yield of lactoyl-N-trisaccharide: after 72 h of shake-flask fermentation, the yield reached 13.7 g / L, and after 72 h of scale-up culture in a 5 L fermenter, the yield further increased to 42 g / L, far exceeding the level of existing technologies. The recombinant strain constructed in this invention provides core strain support for the efficient microbial fermentation preparation of lactoyl-N-trisaccharide, lays the foundation for industrial production, and has important application value. Attached Figure Description

[0025] Figure 1 The recombinant plasmid pJOE8999-amyE-Pc2up:: in this invention lacY A schematic diagram of its construction; Figure 2 The recombinant plasmid pJOE8999-lytC-Pgrac:: in this invention NGlgtA A schematic diagram of its construction; Figure 3 The recombinant plasmid pJOE8999-glmS- in this invention Pc2up A schematic diagram of its construction; Figure 4 The recombinant plasmid PJOE8999-sigF-PfusA:: in this invention CmSET A schematic diagram of its construction; Figure 5 This is a schematic diagram illustrating the construction of the recombinant plasmid Pwdcas9 in this invention; Figure 6 The recombinant plasmid PwsgRNA- in this invention pfkA A schematic diagram of its construction; Figure 7 This is a comparative diagram showing the effects of strains with different gene optimization strategies on the yield of lactyl-N-trisaccharide shake-flask fermentation in this invention. Figure 8 This is a graph showing the yield and biomass curves of the batch-fed fermentation process of recombinant Bacillus subtilis in a 5 L fermenter in this invention. Detailed Implementation

[0026] The present invention will be further described below with reference to the embodiments. The following embodiments are descriptive and not limiting, and should not be used to limit the scope of protection of the present invention.

[0027] The various experimental operations involved in the specific embodiments are all conventional techniques in the field. For parts not specifically annotated in this document, those skilled in the art can refer to various commonly used reference books, scientific and technological documents or related instructions and manuals prior to the filing date of this invention to carry out the operations.

[0028] A recombinant Bacillus subtilis strain for the production of lactoyl-N-trisaccharide, wherein the recombinant Bacillus subtilis strain integrates and expresses genes for the lactoyl-N-trisaccharide synthesis pathway, using Bacillus subtilis as the starting strain, and in the genome... amyE , lytG , lytC , srfAB , lytH , sigF , glmS , aprE , srfAC The sites respectively integrate lactose permease derived from E. coli lacY Two copies of the gene, β-1,3-N-acetylglucosamine transferase derived from Neisseria gonorrhoeae. NGlgtA Three copies of the gene, derived from Chania multitudinisentens transport proteins CmSET , glmS Pre-integration promoter is Pc2up , lacY The promoter of a gene is Pc2up , NGlgtA The promoter of a gene is Pgrac And using the sgRNA-mediated Bacillus subtilis transcriptional regulation system dcas9 Downregulation of bypass pathway genes pfkA The level of expression; Among them, the lacY The nucleotide sequence of the gene is shown in SEQ ID NO.1. NGlgtA The nucleotide sequence of the gene is shown in SEQ ID NO.2, and the promoter is described. Pc2up The nucleotide sequence of the transport protein is shown in SEQ ID NO.3. CmSET The nucleotide sequence is shown in SEQ ID NO.4. Pgrac The nucleotide sequence is shown in SEQ ID NO.5.

[0029] Furthermore, the Bacillus subtilis is Bacillus subtilis 168; Alternatively, the yield of lactoyl-N-trisaccharide obtained by fermentation of the recombinant Bacillus subtilis is: 13.7 g / L after 72 h in a shake flask and 42 g / L in a 5 L fermenter.

[0030] The application of recombinant Bacillus subtilis in the fermentation production of lactoyl-N-trisaccharide, as described above.

[0031] The method for constructing recombinant Bacillus subtilis as described above includes the following steps: (1) Using Bacillus subtilis 168 as the starting strain, the lactose transport gene was integrated into its genome at a specific site. lacY and genes related to lactyl-N-trisaccharide synthesis NGlgtA To construct a recombinant strain with efficient lactose transport and lactyl-N-trisaccharide synthesis capabilities; (2) The strain obtained in step (1) glmS Upstream integration of promoter elements Pc2up To enhance the metabolic flux of the UDP-GlcNAc synthesis pathway; (3) Introducing lactoyl-N-trisaccharide transporters into the strain obtained in step (2). CmSET Proteins, to promote the extracellular secretion of target products; (4) Introduced through genome integration dCas9 Expression framework and corresponding sgRNA-pfkA Expression framework, constructing transcriptional regulatory system, targeting competing metabolic pathways pfkA Gene downregulation yields recombinant strains; (5) The recombinant strains obtained in step (4) are screened and identified to obtain recombinant Bacillus subtilis.

[0032] A method for producing lactoyl-N-trisaccharide by fermentation using recombinant Bacillus subtilis as described above, wherein the method uses the recombinant Bacillus subtilis strain as the production strain and utilizes a fermentation medium to produce lactoyl-N-trisaccharide.

[0033] Further, the fermentation medium consists of: glucose 70-80 g / L, lactose 11-20 g / L, yeast extract 19-22 g / L, tryptone 16-18 g / L, (NH4)2SO4 4-6 g / L, K2HPO4 7-8.5 g / L, KH2PO4 1-2.5 g / L, MgSO4·7H2O 0.1-0.2 g / L, CaCl2 0.05-0.15 g / L, and a trace element solution: MnSO4 3-3.4 mg / L, FeSO4·7H2O 11-14 mg / L, ZnSO4 6-8.0 mg / L, with water as the solvent; the initial medium pH is adjusted to 7.3-7.7.

[0034] Furthermore, the seed culture of recombinant Bacillus subtilis was inoculated into the fermentation medium, and lactyl-N-trisaccharide was produced by fermentation using a fed-batch culture method.

[0035] Furthermore, the method for preparing the seed culture medium is as follows: Recombinant Bacillus subtilis stored at -80℃ was streaked on LB agar plates and cultured overnight at 37℃. Single colonies were picked and added to LB liquid medium and cultured at 37℃ and 200 rpm for 8-10 h to obtain bacterial culture. The bacterial culture was then transferred to LB liquid medium at an inoculum of 4% and fermented at 37℃ and 220 rpm for 8-10 h to obtain seed culture.

[0036] Furthermore, the seed culture solution was inoculated into the fermentation medium at an inoculation rate of 5-10%, and lactyl-N-trisaccharide was produced by fermentation in a feed-batch fermenter. The fermentation temperature was 37℃, the aeration rate was 1.5-2.0 vvm, and the stirring speed was 600-700 rpm. After 7.5 h of culture, 15 g / L of xylose was added to the medium. During the culture, the pH was maintained at 7.3-7.7. After 12 h of fermentation, glucose was added until the end of fermentation, and the glucose concentration was maintained at 5-10 g / L. When the lactose concentration was lower than 5 g / L, lactose feed solution was added to the fermenter to raise the lactose concentration back to 15-20 g / L. The fermentation time was 72 hours.

[0037] This invention provides a recombinant Bacillus subtilis strain that integrates a gene expressing the lactose-N-trisaccharide synthesis pathway, wherein the recombinant Bacillus subtilis strain has a genome... amyE (BSU_03040) lytG (BSU_31120) integrates bacteria derived from E. coli. lacY Genes, in lytC (BSU_35620) srfAB (BSU_03490) lytH The (BSU_32340) site integrates genes from Neisseria gonorrhoeae. NGlgtA Genes, in sigF The (BSU_23450) site integrates from... Chania multitudinisentens transport proteins CmSET Genes, in glmS (BSU_01780) Pre-integration promoter ​ ,exist ​ (BSU_10300) ​ The (BSU_03510) site integrates... ​ and sgRNA, and used an sgRNA-mediated Bacillus subtilis transcriptional regulation system. ​ Downregulation of bypass pathway genes ​ The expression level of (BSU_29190).

[0038] In one embodiment of the present invention, the recombinant Bacillus subtilis uses Bacillus subtilis 168 as a host, and the recombinant Bacillus subtilis has the following characteristics: △ ​ :: ​ , △ ​ : ​ , △ ​ :: ​ , △s ​ :: ​ , △ ​ :: ​ , △ ​ :: ​ , △ ​ :: ​ , △s ​ ::sgRNA ​ , △ ​ :: ​ .

[0039] The present invention also provides a method for producing lactoyl-N-trisaccharide using the recombinant Bacillus subtilis strain, wherein the recombinant Bacillus subtilis strain is used as the production strain and a fermentation medium is used to produce lactoyl-N-trisaccharide.

[0040] In one embodiment of the present invention, the fermentation medium (g / L) comprises: glucose 70-80, lactose 11-20, yeast extract 19-22, tryptone 16-18, (NH4)2SO4 4-6, K2HPO4 7-8.5, KH2PO4 1-2.5, MgSO4·7H2O 0.1-0.2, and CaCl2 0.05-0.15. The trace element solution (mg / L) comprises: MnSO4 3-3.4, FeSO4·7H2O 11-14, and ZnSO4 6-8.0. The initial pH of the medium is adjusted to 7.3-7.7.

[0041] In one embodiment of the present invention, seed culture solution is inoculated into fermentation medium, and lactyl-N-trisaccharide is produced by fermentation using a fed-batch culture method.

[0042] In one embodiment of the present invention, the seed culture solution is inoculated into the fermentation medium at an inoculation rate of 5-10%, and lactyl-N-trisaccharide is produced by batch culture in a fermenter. The fermentation temperature is 37°C, the aeration rate is 1.5 vvm, the stirring speed is 600 rpm, and the pH is maintained at 7.7. After 12 h of fermentation, glucose is added from the start until the end of fermentation, and the glucose concentration is maintained at 5-10 g / L.

[0043] Specifically, the relevant preparation and testing methods are as follows: Nucleotide sequence information involved in the examples: (1) The sequence information of SEQ ID NO.1 indicates that it originates from Escherichia coli. ​ Gene coding sequence; (2) The sequence information of SEQ ID NO.2 indicates that it originates from Neisseria gonorrhoeae. ​ Gene coding sequence; (3) Sequence information of SEQ ID NO.3: promoter Pc2up gene coding sequence; (4) The sequence information of SEQ ID NO.4 is as follows: ​ transport proteins from ​ Encoded sequence; (5) The sequence information of SEQ ID NO.5 is the coding sequence of the promoter Pgrac gene; Determination of lactoyl-N-trisaccharide content: The concentration of lactoyl-N-trisaccharide was determined by high performance liquid chromatography (HPLC).

[0044] The fermentation broth sample processing steps are as follows: Take 2 mL of fermentation broth, centrifuge at 12,000 rpm for 5 minutes, collect the supernatant, boil the supernatant for 5 minutes, and then centrifuge again at 12,000 rpm for 5 minutes. Subsequently, dilute the obtained supernatant by a ratio of 5 to 20 times, filter it using a 0.22 μm filter membrane, and determine the extracellular lactyl-N-trisaccharide concentration using high performance liquid chromatography (HPLC). The specific chromatographic conditions are as follows: HPLC-RID-VWD mode is used, with a PrevailCarbohydrate EC column of 5.0 μm (250 × 4.6 mm); mobile phase A is 68% acetonitrile, and mobile phase B is 32% water; the detection wavelength is set to VWD 195 nm; the flow rate is 1 mL / min; the injection volume is 10 µL; the run time is 15 min; the column temperature is maintained at 30℃, and the temperature of the refractive index detector (RID) is controlled at 30-35℃.

[0045] Example 1: Construction of recombinant plasmids and recombinant bacteria BA01 / BA02 / BA03 / BA04 1.1 Integrated expression of E. coli-derived genes ​ Neisseria gonorrhoeae source gene ​ , ​ Pre-insertion promoter Pc2up ​ Source ​ transport proteins In the genome ​ , ​ Site integration from E. coli ​ Genes, in ​ , ​ , ​ The site integrates from Neisseria gonorrhoeae.​ Genes, in ​ Sites integrate from ​ ​ transport proteins ​ ,exist ​ The pre-integration promoter Pc2up, in ​ , ​ The sites were integrated respectively ​ and sgRNA- ​ The gene promoter is Pc2up. ​ The promoter is Pgrac.

[0046] To integrate ​ Gene to Genome ​ Taking the site as an example, the integration method is as follows: ① First, in the pJOE8999 plasmid... ​ The I restriction site connects to the target amyE The N20 fragment of the gene (TACGCTGCGGACAAGCTAGTGACA) was used to obtain the plasmid pJ-N20- amyE The method is as follows: The target sequence of the sgRNA of the target gene was designed according to the CHOPCHOP website (http: / / chopchop.cbu.uib.no / ), namely amyE-N20-F / amyE-N20-R. The N20 fragment was obtained through an N20 reaction system. pJOE8999 was then... Bsa Digested with enzyme I, followed by agarose gel electrophoresis and gel recovery. The resulting vector was ligated to the N20 fragment containing the restriction enzyme site using T4 DNA ligase and then transformed into... E.coli JM109 competent cells were spread on LB agar plates containing kanamycin resistance (30 ug / ml) to obtain pJ-N20- amyE Plasmid. Then connect. amyE Upstream and downstream homologous arms of a gene, B.subtilis Using the 168 genome as a template, primers amyE-UP-F / amyE-UP-R and amyE-DOWN-F / amyE-DOWN-R were used to amplify the genome. amyE The upstream and downstream homologous arms of the gene are about 500 bp apart, with pHT01-Pc2up- lacY (in pHT01 plasmid) Bam HI and Xba Pc2up- was inserted between the I restriction sites. lacY Using lacY-F / lacY-R as a template, Pc2up- was amplified. lacY The genes (SEQ ID NO.1 and SEQ ID NO.3) will be correctly sequenced pJ-N20- amyE plasmids SaIEnzyme I digests the cells, separating the upstream and downstream homologous arms and Pc2up- lacY The gene and vector were subjected to agarose gel electrophoresis and gel recovery, and pJOE8999-amyE-Pc2up:: was obtained through seamless cloning technology. lacY ( Figure 1 ).

[0047] The primer information involved is as follows (primer sequences 5'-3' orientation):

[0048] The recombinant plasmid pJOE8999-amyE-Pc2up:: lacY The plasmid was chemically transformed into Bacillus subtilis 168. Notably, during the chemical transformation, 2% mannose was added simultaneously with the plasmid, and the culture temperature was 30℃ in subsequent experiments. The bacterial culture was then plated on plates containing 2% mannose and kanamycin (30 µg / ml). Transformants were verified by colony PCR. The verified transformants underwent plasmid elimination: the colonies were transferred twice into tubes containing LB agar plates, and cultured at 42℃ and 200 rpm for 12 h. The bacterial culture was then streaked on LB agar plates. Suitable single colonies were then picked and cultured on LB agar and LB+Kan (30 µg / ml) plates. No growth was observed on the LB+Kan plate, while normal growth was observed on the LB plate, indicating successful plasmid elimination. The plasmid-eliminated colonies were again verified by colony PCR; those that were correctly verified had eliminated the plasmid and integrated the gene from *E. coli*. lacY The recombinant strain B01.

[0049] Similarly, through integration NGlgtA Genes to Bacillus subtilis genome lytC Taking the site as an example, firstly, in the sgRNA region of the pJOE8999 plasmid, a target... lytC The N20 fragment of the gene (TACGAATCTTGGAACGAGAGACCG) was used to obtain the plasmid pJ-N20- lytC The method is as follows: The target sequence of the sgRNA of the target gene was designed according to the CHOPCHOP website (http: / / chopchop.cbu.uib.no / ), namely lytC-N20-F / lytC-N20-R. The N20 fragment was obtained through an N20 reaction system. pJOE8999 was then... Bsa Digested with enzyme I, followed by agarose gel electrophoresis and gel recovery. The resulting vector was ligated to the N20 fragment containing the restriction enzyme site using T4 DNA ligase and then transformed into... E. coliJM109 competent cells were spread on LB agar plates containing kanamycin resistance (30 µg / ml). Then, ligation was performed. lytC Upstream and downstream homologous arms of a gene, B.subtilis Using the 168 genome as a template, primers lytC-UP-F / lytC-UP-R and lytC-DOWN-F / lytC-DOWN-R were used to amplify the genome. lytC The upstream and downstream homologous arms of the gene are about 500 bp, with PHT01- NGlgtA (in pHT01 plasmid) Bam HI and Xba Pgrac- was inserted between the I restriction sites. NGlgtA The Pgrac sequence is SEQ ID NO.5. NGlgtA Using SEQ ID NO.2 as a template, primers NGlgtA-F / NGlgtA-R were used to amplify Pgrac- NGlgtA The gene (Pgrac sequence is SEQ ID NO.5) NGlgtA (For SEQ ID NO.2), the correctly sequenced pJ-N20- lytC plasmids SaI Enzyme I digestion separates upstream and downstream homologous arms and Pgrac. - NGlgtA The gene and vector were subjected to agarose gel electrophoresis and gel recovery, and pJOE8999-lytC-Pgrac- was obtained through seamless cloning technology. NGlgtA ( Figure 2 And using the above integration method to... NGlgtA Gene integration into strain B01 lytC The site was identified, and strain B02 was obtained.

[0050] The primer information involved is as follows (primer sequences 5'-3' orientation):

[0051] Similarly, in strain B02 lytG Sites continue to integrate from E. coli lacY Genes were obtained from strain B03, and in strain B03... srfAB Site integration originates from Neisseria gonorrhoeae NGlgtA Genes were obtained from strain B04, and in strain B04... lytH Site integration originates from Neisseria gonorrhoeae NGlgtA The gene will eventually yield two copies. lacY Three copies NGlgtA The BA01 strain of the gene.

[0052] The same recombinant plasmid pJOE8999- was constructed. glmS-Pc2up( Figure 3 ) Transfer into BA01 (two copies) lacY Three copies NGlgtA ) strain, Bacillus subtilis glmS The pre-integration promoter Pc2up was used to obtain strain BA02. The primer information is as follows (primer sequences 5'-3' orientation):

[0053] Recombinant plasmid PJOE8999- was constructed using the above construction principles. sigF -PfusA:: CmSET ( Figure 4 ) will originate from Chania multitudinisentens transport proteins CmSET Integrated in strain BA02 sigF The site was determined, resulting in the recombinant strain BA03. The primer information involved is as follows (primer sequences 5'-3' direction):

[0054] 1.2 Using sgRNA-mediated dCas9 Transcriptional regulatory system, specifically downregulating bypass pathway genes pfkA level of expression Taking the pWdcas9 plasmid as an example, this plasmid expresses the dCas9 protein. Using primers ori-F and Kan-R, the backbone plasmid containing the pUCori origin of replication and the Kan resistance cassette was amplified from pJOE8999. B.subtilis Amplified from 168 genomes The two homologous arms of the gene. Using pJMP1 as a vector, restriction endonuclease... aprE Double digestion with enzyme I yielded the dCas9 expression cassette and erythromycin resistance cassette. These four fragments were then assembled using seamless cloning technology to obtain pWdCas9 (…). Sma The primer information involved is as follows (primer sequences in the 5'-3' direction):

[0055] Taking the pWsgRNA plasmid as an example, this plasmid expresses 'gRNA'. Using primers ori-2F and Kan-2R, the backbone containing the pUCori origin of replication and the Kan resistance cassette was amplified from pJOE8999. Figure 5 Amplified from 168 genomes B.subtilisTwo homologous arms of the gene. The tetracycline resistance cassette was amplified from pWH1520 using primers TCR-F and TCR-R. The 'gRNA expression cassette was amplified from pJOE8999 using primers 'gRNA-F and 'gRNA-R. These five fragments were assembled using seamless cloning technology to obtain pW-sgRNA.

[0056] pWsgpfkA ( srfAC Taking a plasmid as an example, this plasmid expresses targeted... Figure 6 The sgRNA of the gene (BSU_29190, NCBI website: https: / / www.ncbi.nlm.nih.gov / gene / ?term=BSU_29190). The pWsgRNA was processed using restriction endonucleases. pfkA Enzyme I digestion was performed using an N20 reaction system with sgpfkA-F / sgpfkA-R primers to obtain the N20 fragment via PCR. The target gene was then targeted. Bsa The N20 fragment (TACGTTTCCATGTGTAGGTGTACC) was ligated to pWsgRNA using T4 DNA ligase to obtain plasmid pWsgpfkA ( pfkA The primer information involved is as follows (primer sequences in the 5'-3' direction):

[0057] The above plasmids pWdCas9 and pWsgpfkA were respectively processed through... Figure 6The linearized plasmid was obtained by single digestion with enzyme I. First, the linearized pWdCas9 plasmid was introduced into Bacillus subtilis BA03 via chemical transformation. After resistance selection and PCR identification, a recombinant strain with the dCas9 expression framework successfully integrated into the BA03 genome was obtained. Subsequently, the above recombinant strain was used as the recipient bacterium, and the linearized pWsgpfkA plasmid was introduced into it again via chemical transformation. After screening and identification, strain BA04 was obtained. The specific method is as follows: The BA03 strain was streaked in three zones on an LB agar plate and incubated at 37℃ for 12 h; a single colony was picked into a test tube containing 4 mL of LB liquid medium and incubated at 37℃ and 200 rpm for 12 h; 200 μL of the above bacterial solution was added to a test tube containing 5 mL of SP I medium (Xie Yaya. Optimization of Bacillus subtilis gene editing system and study on GlcNAc synthesis [D]. Tianjin University of Science and Technology, 2023) and incubated at 37℃ and 200 rpm to the logarithmic phase; 200 μL of the above bacterial solution was added to a test tube containing 2 mL of SP II medium (Xie Yaya. Optimization of Bacillus subtilis gene editing system and study on GlcNAc synthesis [D]. Tianjin University of Science and Technology, 2023) and incubated at 37℃ and 100 rpm for 1.5 h; 20 μL of 10 mM... EGTA was incubated at 37°C and 100 rpm in a constant temperature shaking incubator for 10 min; then 1 µg of [unspecified ingredient] was added. Apa The pWdCas9 or pWsgpfkA plasmids, digested with enzyme I, were incubated at 37°C with a shaking incubator at 100 rpm for 1 h; the shaking speed was then adjusted to 220 rpm, and the incubation continued for another 1.5 h. For the transformation system of the pWdCas9 linearized plasmid, 200 μl of bacterial culture was plated on an LB agar plate containing erythromycin (7.5 µg / ml); for the transformation system of the pWsgpfkA linearized plasmid, 200 μl of bacterial culture was plated on an LB agar plate containing tetracycline (7.5 µg / ml). Single colonies growing on the corresponding antibiotic plates were verified by PCR. Strains that were correctly verified were identified as strain BA04, which had successfully integrated into the BA03 genome.

[0058] Example 2: Fermentation by recombinant bacteria BA01 / BA02 / BA03 / BA04 2.1 Fermentation Method Shake-flask fermentation: The strain stored at -80℃ was streaked on LB agar plates and incubated overnight at 37℃. Single colonies were picked and added to test tubes containing 4 mL of LB liquid and incubated at 37℃ and 200 rpm for 8-10 h on a shaker. The above bacterial culture was then transferred at a 4% inoculum to a 250 mL Erlenmeyer flask containing 48 mL of LB liquid and fermented at 37℃ and 220 rpm for 8-10 h to obtain the seed culture. The seed culture was then transferred at a 4% inoculum to a 250 mL Erlenmeyer flask containing 48 mL of fermentation medium. The fermentation conditions were: 37℃, 220 rpm, and fermentation time for 48 h. After 7.5 h of incubation, 15 g / L xylose was added to the medium.

[0059] Fermentation in a 5 L fermenter: Inoculate 150 mL of seed culture into a 5 L fermenter at an inoculum rate of 5-10%. During cultivation, maintain the pH at 7.3-7.7 by automatically adding 25% ammonia, keep the temperature at 37℃, set the aeration rate to 1.5-2.0 vvm, and the stirring speed to 600-700 rpm. After 7.5 h of cultivation, add 15 g / L xylose to the culture medium. Prepare a feed solution of 800 g / L glucose and 300 g / L lactose. During cultivation, maintain the glucose concentration at 5-10 g / L, adjusting the glucose feed rate every 3-4 hours based on the residual glucose concentration in the fermenter. When the lactose concentration drops below 5 g / L, add lactose feed solution to the fermenter to raise the lactose concentration back to approximately 15-20 g / L, and continue fermentation for 72 hours.

[0060] The fermentation medium consists of: glucose 70-80 g / L, lactose 11-20 g / L, yeast extract 19-22 g / L, tryptone 16-18 g / L, (NH4)2SO4 4-6 g / L, K2HPO4 7-8.5 g / L, KH2PO4 1-2.5 g / L, MgSO4·7H2O 0.1-0.2 g / L, CaCl2 0.05-0.15 g / L, and a trace element solution of MnSO4 3-3.4 mg / L, FeSO4·7H2O 11-14 mg / L, and ZnSO4 6-8.0 mg / L, with water as the solvent; the initial pH of the medium is adjusted to 7.3-7.7.

[0061] 2.2 Fermentation Results Single clones of the recombinant Bacillus subtilis strain constructed above were inoculated into 4 mL of seed culture medium to prepare seed liquid, and then shake-flask fermentation was carried out.

[0062] Shake flask fermentation results are as follows Apa As shown, wild type Figure 7168 does not produce lactoyl-N-trisaccharide; strain BA01 integrates two copies. B.subtilis and three copies lacY At 72 h, the yield of lactoyl-N-trisaccharide was 6.2 g / L. The BA02 strain... NGlgtA Upstream integration of the promoter Pc2up effectively relieved the gene's upstream integration. glmS Feedback inhibition by ribozymes resulted in a 42% increase in lactyl-N-trisaccharide production compared to strain BA01, reaching a yield of 8.8 g / L. Heterologous expression glmS transport proteins from Chania multitudinisentens This effectively promoted the extracellular secretion of lactyl-N-trisaccharide, avoiding the feedback inhibition of strain growth caused by intracellular product accumulation, while simultaneously increasing strain biomass. The BA03 strain showed a 20.5% increase in yield compared to the BA02 strain, reaching 10.6 g / L. This was achieved using an sgRNA-mediated Bacillus subtilis transcriptional regulation system. CmSET Downregulation of bypass pathway genes dCas9 This expression reduces the diversion of carbon sources to irrelevant metabolic pathways such as glycolysis, allowing more precursors to be directed towards lactyl-N-trisaccharide synthesis. The lactyl-N-trisaccharide yield of strain BA04 was 18% higher than that of strain BA03, reaching a final yield of 12.5 g / L.

[0063] pfkA The yield and biomass curves for the fed-batch fermentation of recombinant Bacillus subtilis BA04 in a 5 L fermenter are shown. After 72 h of fermentation in the 5 L fermenter, the yield of lactoyl-N-trisaccharide reached 42 g / L. In the early stage of fermentation (0–12 h), the recombinant Bacillus subtilis BA04 was in a rapid growth phase, with high OD... 600 The OD value rose rapidly, while the residual sugar concentration in the culture system decreased significantly, indicating that strain BA04 could efficiently utilize the carbon source and quickly enter the logarithmic growth phase. With the implementation of a fed-batch feeding strategy, cell growth gradually stabilized, and OD... 600 The concentration remained consistently high at approximately 110–125, indicating that the strain maintained good physiological activity and metabolic stability even under high-density culture conditions. Simultaneously, lactyl-N-trisaccharide continuously accumulated during fermentation, with its yield significantly increasing after 24 h of fermentation and reaching 42 g / L at 72 h. In the later stages of fermentation, although cell growth plateaued, the target product continued to be synthesized stably, demonstrating that strain BA04 possesses strong product synthesis and sustained expression capabilities.

[0064] Recombinant Bacillus subtilis BA04 is the final engineered strain obtained by sequentially introducing multiple metabolic engineering modifications based on the same chassis strain. First, a lactose transport gene was integrated into the genome with multiple copies. Figure 8 and lactyl-N-trisaccharide synthesis gene lacYThis enhances the transmembrane transport capacity of exogenous lactose and its conversion efficiency to the target product, laying the foundation for the basic metabolic capacity of lactyl-N-trisaccharide synthesis. Based on this, through... NGlgtA Upstream integration of the promoter Pc2up enhances the flux supply of the UDP-GlcNAc synthesis pathway, alleviating the limitation of lactyl-N-trisaccharide synthesis due to insufficient glycosyl donors, thus matching precursor supply with synthetic reaction capacity. Subsequently, heterologous expression... glmS Transport proteins promote the extracellular secretion of lactoyl-N-trisaccharides, reducing the inhibitory effect of intracellular product accumulation on bacterial growth and metabolic activity, thus facilitating the continuous accumulation of products under high-density culture conditions. Furthermore, this can be achieved by introducing [the protein] through genome integration. CmSET Expression framework and corresponding dCas9 An expression framework was constructed to establish a transcriptional regulatory system that downregulated the key gene pfkA in competing metabolic pathways, reducing the diversion of carbon sources to non-target metabolic pathways and directing more metabolic precursors to the synthesis of lactyl-N-trisaccharide. This regulatory approach effectively improved metabolic flux utilization efficiency under fed-batch fermentation conditions. Furthermore, the fed-batch fermentation strategy maintained appropriate substrate concentration levels, avoiding growth stress caused by substrate inhibition and transient high metabolic loads, thus providing a stable carbon and energy source for the continuous synthesis of lactyl-N-trisaccharide. This fermentation strategy, combined with the engineering characteristics of the BA04 strain in enhanced transport, enhanced precursor supply, metabolic flux redistribution, and optimized product secretion, forms a good synergy, which is an important reason why it achieves high-level accumulation of lactyl-N-trisaccharide under 5 L fermenter conditions.

[0065] Compared with existing technologies, this invention has significant advantages in the production performance of lactoyl-N-trisaccharide and the engineered strain construction strategy. In existing technologies, the microbial synthesis of lactoyl-N-trisaccharide typically relies on plasmid expression systems, which suffer from insufficient genetic stability, expression decay in the later stages of fermentation, and poor adaptability to scale-up production. The yield is mostly limited to shake flask or small- to medium-scale fermentation levels, making it difficult to achieve sustained and stable accumulation under high-volume scale-up conditions. In contrast, this invention introduces key functional modules into the Bacillus subtilis chassis strain via genome integration, constructing a stable engineered strain BA04, achieving efficient synthesis of lactoyl-N-trisaccharide without relying on high-copy plasmids. Under batch feeding conditions in a 5 L fermenter, BA04 can achieve a lactoyl-N-trisaccharide yield of 42 g / L within 72 h, demonstrating good adaptability to scale-up production and metabolic stability. Furthermore, this invention does not merely enhance a single metabolic node to increase yield, but rather employs a multi-level engineering strategy encompassing enhanced transport, improved precursor supply, fine-tuned metabolic flux regulation, and optimized product secretion. This systematically improves carbon source utilization efficiency and metabolic flux distribution, thereby achieving sustained high-level accumulation of lactyl-N-trisaccharides under fermenter conditions. These characteristics make this invention superior to existing technologies in terms of yield, fermentation stability, and industrial scale-up potential.

[0066] The relevant sequences in this invention are as follows: SEQ ID NO.1 sgRNA-pfkA SEQ ID NO.2 lacY SEQ ID NO.3 Pc2up TGAGAATTCCTAACAACTAAATCACGACTATATACCTATACTATTTATTATCATCAATTTGTCGAAAAGGGTAGACAAACTATCGTTTAACATGTTATACTATAATAG 108 SEQ ID NO.4 NGlgtA CmSET SEQ ID NO.5Pgrac AGCTATTGTAACATAATCGGTACGGGGGTGAAAAAGCTAACGGAAAAGGGAGCGGAAAAGAATGATGTAAGCGTGAAAAATTTTTTATCTTATCACTTGAAATTGGAAGGGAGATTCTTTATTATAAGAATTGTGGAATTGTGAGCGGATAACAATTCCCAATT Although embodiments of the invention have been disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, variations, and modifications are possible without departing from the spirit and scope of the invention and the appended claims. Therefore, the scope of the invention is not limited to the contents disclosed in the embodiments.

Claims

1. A recombinant Bacillus subtilis strain for the production of lactoyl-N-trisaccharide, characterized in that: The recombinant Bacillus subtilis integrates and expresses genes related to the lactoyl-N-trisaccharide synthesis pathway. Using Bacillus subtilis as the starting strain, the genome... amyE , lytG , lytC , srfAB , lytH , sigF , glmS , aprE , srfAC The sites respectively integrate lactose permease derived from E. coli lacY Two copies of the gene, β-1,3-N-acetylglucosamine transferase derived from Neisseria gonorrhoeae. NGlgtA Three copies of the gene, derived from Chania multitudinisentens transport proteins CmSET , glmS Pre-integration promoter is Pc2up , lacY The promoter of a gene is Pc2up , NGlgtA The promoter of a gene is Pgrac And using the sgRNA-mediated Bacillus subtilis transcriptional regulation system dcas9 Downregulation of bypass pathway genes pfkA The level of expression; Among them, the lacY The nucleotide sequence of the gene is shown in SEQ ID NO.

1. NGlgtA The nucleotide sequence of the gene is shown in SEQ ID NO.2, and the promoter is described. Pc2up The nucleotide sequence of the transport protein is shown in SEQ ID NO.

3. CmSET The nucleotide sequence is shown in SEQ ID NO.

4. Pgrac The nucleotide sequence is shown in SEQ ID NO.

5.

2. The recombinant Bacillus subtilis according to claim 1, characterized in that: The Bacillus subtilis is Bacillus subtilis 168; Alternatively, the yield of lactoyl-N-trisaccharide obtained by fermentation of the recombinant Bacillus subtilis is: 13.7 g / L after 72 h in a shake flask and 42 g / L in a 5 L fermenter.

3. The application of the recombinant Bacillus subtilis as described in claim 1 or 2 in the fermentation production of lactoyl-N-trisaccharide.

4. The method for constructing recombinant Bacillus subtilis as described in claim 1 or 2, characterized in that: Includes the following steps: (1) Using Bacillus subtilis 168 as the starting strain, the lactose transport gene was integrated into its genome at a specific site. lacY and genes related to lactyl-N-trisaccharide synthesis NGlgtA To construct a recombinant strain with efficient lactose transport and lactyl-N-trisaccharide synthesis capabilities; (2) The strain obtained in step (1) glmS Upstream integration of promoter elements Pc2up To enhance the metabolic flux of the UDP-GlcNAc synthesis pathway; (3) Introducing lactoyl-N-trisaccharide transporters into the strain obtained in step (2). CmSET Proteins, to promote the extracellular secretion of target products; (4) Introduced through genome integration dCas9 Expression framework and corresponding sgRNA-pfkA Expression framework, constructing transcriptional regulatory system, targeting competing metabolic pathways pfkA Gene downregulation yields recombinant strains; (5) The recombinant strains obtained in step (4) are screened and identified to obtain recombinant Bacillus subtilis.

5. A method for producing lactoyl-N-trisaccharide by fermentation using recombinant Bacillus subtilis as described in claim 1 or 2, characterized in that: The method uses the recombinant Bacillus subtilis strain as the production strain and utilizes a fermentation medium to produce lactoyl-N-trisaccharide.

6. The method according to claim 5, characterized in that: The fermentation medium consisted of: glucose 70-80 g / L, lactose 11-20 g / L, yeast extract 19-22 g / L, tryptone 16-18 g / L, (NH4)2SO4 4-6 g / L, K2HPO4 7-8.5 g / L, KH2PO4 1-2.5 g / L, MgSO4·7H2O 0.1-0.2 g / L, CaCl2 0.05-0.15 g / L, and a trace element solution of: MnSO4 3-3.4 mg / L, FeSO4·7H2O 11-14 mg / L, ZnSO4 6-8.0 mg / L, with water as the solvent; the initial pH of the medium was adjusted to 7.3-7.

7.

7. The method according to claim 6, characterized in that: The seed culture of recombinant Bacillus subtilis was inoculated into the fermentation medium, and lactyl-N-trisaccharide was produced by fermentation using a fed-batch culture method.

8. The method according to claim 7, characterized in that: The method for preparing the seed culture medium is as follows: Recombinant Bacillus subtilis stored at -80℃ was streaked on LB agar plates and cultured overnight at 37℃. Single colonies were picked and added to LB liquid medium and cultured at 37℃ and 200 rpm for 8-10 h to obtain bacterial culture. The bacterial culture was then transferred to LB liquid medium at an inoculum of 4% and fermented at 37℃ and 220 rpm for 8-10 h to obtain seed culture.

9. The method according to any one of claims 5 to 8, characterized in that: The seed culture was inoculated into the fermentation medium at an inoculation rate of 5-10%. Lactyl-N-trisaccharide was produced by fermentation in a fed-batch fermenter at a temperature of 37°C, an aeration rate of 1.5-2.0 vvm, and a stirring speed of 600-700 rpm. After 7.5 h of culture, xylose was added to the medium at a concentration of 15 g / L. The pH was maintained at 7.3-7.7 during the culture period. After 12 h of fermentation, glucose was added continuously until the end of fermentation, and the glucose concentration was maintained at 5-10 g / L. When the lactose concentration was lower than 5 g / L, lactose feed solution was added to the fermenter to raise the lactose concentration back to 15-20 g / L. The fermentation time was 72 hours.

Citation Information

Patent Citations

  • Recombinant bacillus subtilis producing micromolecular hyaluronic acid

    CN104293726A

  • Genetically engineered bacteria capable of increasing yield of lactoyl-N-trisaccharide II and production method for genetically engineered bacteria

    CN111979168A

  • Recombinant escherichia coli for synthesizing lactoyl-N-trisaccharide as well as construction method and application of recombinant escherichia coli

    CN112280727A

  • Construction and application of recombinant probiotics for synthesizing lactoyl-N-trisaccharide

    CN117143790A

  • Recombinant bacillus subtilis for synthesizing lactoyl-N-tetrasaccharide as well as construction method and application of recombinant bacillus subtilis

    CN118956706A