Single-stranded circular DNA Marker as well as preparation method and application thereof

Abstract

The invention discloses a single-stranded circular DNA Marker as well as a preparation method and application thereof, and relates to the technical field of biology. The DNA Marker prepared by the invention has the characteristics of uniform and sharp bands and obvious brightness among the bands during use, can be widely applied to molecular weight indication in a CssDNA electrophoresis process, can be stored at room temperature for a long time, and is convenient to use. The preparation method of the CssDNA Marker is high in stability, repeated production between batches can be guaranteed, and therefore large-scale production is achieved.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to a single-stranded circular DNA marker, its preparation method, and its application. Background Technology

[0002] The concept of "plasmid" was first proposed in 1952 by American biologist Joshua Lederberg. Lederberg defined a plasmid as any extrachromosomal genetic determinant, that is, a type of genetic material that can exist independently of the cell's main chromosome and can self-replicate. This type of genetic material usually refers to covalently closed, circular double-stranded DNA molecules that can be passed on to offspring cells during cell division and express the genetic information they carry. In 1973, Stanley et al. first synthesized functional bacterial plasmids by in vitro linking restriction endonuclease fragments of different plasmids. Double-stranded plasmids mainly consist of two parts: a transcription unit and a bacterial backbone. The transcription unit consists of regulatory elements, such as promoters, target genes, terminators, and multiple cloning sites (MCS), while the bacterial backbone consists of elements such as antibiotic resistance genes, origins of replication (Ori), and unmethylated CpG motifs. The synthesis of double-stranded plasmids requires the preservation of bacterial-related redundant sequences; however, these redundant sequences can cause specific recognition and targeted clearance by mammals, resulting in high immunogenicity. Overall, traditional double-stranded plasmids have the following four shortcomings in synthetic biology applications: strong immunogenicity; high cytotoxicity; random integration of multiple genes; and few regulatory elements.

[0003] The limitations of commonly used circular double-stranded DNA plasmids can be addressed by converting them into circular single-stranded DNA (CssDNA) plasmids and removing redundant sequences. Compared to linear DNA, circular DNA is less susceptible to degradation by exonucleases, disperses singly in solution, and is less prone to polymerization. Compared to circular double-stranded DNA plasmids, CssDNA is less likely to elicit an immune response, exhibiting lower immunogenicity and enabling safer drug delivery and gene editing. The unique structure of CssDNA provides good stability and programmability, offering advantages in constructing molecular machines and nanoscale DNA structures. Therefore, CssDNA holds significant research value in medical synthetic biology.

[0004] With the rapid development of nucleic acid therapy, the development of novel nucleic acid vectors has become a research focus. CssDNA is a circular structure formed by connecting single-stranded DNA end to end, possessing strong stability and flexibility, no free ends, and resistance to degradation by common nucleases. As an emerging molecular tool in medical synthetic biology, CssDNA has a relatively stable circular structure, strong resistance to exonucleases, can be synthesized using helper plasmid systems, and lacks a bacterial backbone sequence. Compared to traditional double-stranded plasmids, CssDNA is less prone to silencing and clearance, exhibiting lower cytotoxicity. As an emerging gene vector, CssDNA has been used to deliver IL-12 expression using a novel folic acid-modified lipid nanoparticle (FA-LNPs) system, achieving long-term expression in mice and potentially being used to treat 4T1 triple-negative breast cancer. CssDNA can serve as a highly efficient homology-directed repair (HDR) donor template, demonstrating excellent performance across various cell types and genomic loci. Furthermore, CssDNA supports the integration of ultra-large transgenes, exhibiting broad applicability, high specificity, and low cytotoxicity. Circular single-stranded DNA (CssDNA) can serve as a gene expression vector. Its single-stranded form offers addressability and programmability, enabling precise gene expression regulation in cell-free systems and mammalian cells. By designing specific CssDNA sequences, it is hoped that new genetic circuits can be created to regulate specific biological functions or metabolic pathways. Overall, circular single-stranded DNA holds immense potential in medical synthetic biology. Future research on circular single-stranded DNA requires the integration of knowledge and technologies from multiple disciplines, including physics (structure and modification), engineering (chassis component discovery and optimization), biology (synthesis and modification), and medicine (endogenous immunity and gene therapy). This will hopefully develop circular single-stranded DNA into one of the most important molecular tools in the field of medical synthetic biology. Furthermore, single-stranded circular DNA can also be applied in food, biology, and medicine. In molecular biology, it can be used as a template for rolling circle amplification and transcription. In detection, G-tetramers and DNAzymes can be designed onto circular molecular machines for the detection of ions and other substances in samples. Single-stranded circular DNA is also gradually becoming an important component in constructing advanced nanostructures such as DNA origami and molecular machines.

[0005] Currently, research on single-stranded circular DNA mainly focuses on the applications of small single-stranded loops (less than 100 nt) and large single-stranded loops (thousands of nt) isolated from natural bacteriophages. Among these, Zheng et al. successfully prepared DNA nanotube structures using single-stranded circular DNA as the basic unit; several research groups have used single-stranded circular DNA as raw material to prepare interlocking ring structures with two or more interlocking DNA loops, and have fabricated them into controllable molecular switches or molecular machines.

[0006] Besides naturally occurring CssDNA, there is also artificially synthesized CssDNA. Artificially synthesized CssDNA can be divided into two categories based on its size: long CssDNA and short CssDNA. Long CssDNA mainly originates from bacteriophage M13mp18 and has a size of 1000-50000 nt (nucleotides); short CssDNA has a size of 10-1000 nt. This type of CssDNA can be synthesized through chemical ligation or enzyme-mediated methods.

[0007] Currently, the detection methods for whether artificially synthesized CssDNA has been successfully circularized include the following two methods: (1) mass spectrometry detection based on the target molecular weight, and (2) experimental verification. Both methods have the problem of high time cost. How to quickly and accurately detect single-stranded circular DNA is an urgent problem to be solved.

[0008] In view of this, the present invention is proposed. Summary of the Invention

[0009] The purpose of this invention is to provide a single-stranded circular DNA marker, its preparation method, and its application to achieve rapid and accurate detection of single-stranded circular DNA.

[0010] This invention is implemented as follows: In a first aspect, the present invention provides a method for preparing a single-stranded circular DNA marker, comprising the following steps: i: Design multiple single-stranded DNA fragments and at least one ligation clip sequence. The single-stranded DNA fragments have different lengths. Mix each single-stranded DNA fragment with the ligation clip sequence and perform a ligation reaction using DNA ligase or cyclase to obtain single-stranded circular DNA. The two ends of each single-stranded DNA fragment are complementary to at least one ligation clip sequence. The molar ratio of each single-stranded DNA fragment to the ligation clip sequence is 1:0.1-5. ii: Purify each single-stranded circular DNA product obtained from the ligation reaction, and then blend the purified single-stranded circular DNA products in a specified proportion.

[0011] Secondly, the present invention also provides a single-stranded circular DNA Marker, which is prepared by the above-described method for preparing a single-stranded circular DNA Marker.

[0012] Thirdly, the present invention also provides the application of single-stranded circular DNA markers in the detection of single-stranded circular DNA circulation or the detection of single-stranded circular DNA molecular weight.

[0013] The present invention has the following beneficial effects: This invention provides a DNA marker specifically for detecting the circularization of single-stranded circular DNA. After testing, the DNA marker prepared according to the method provided by this invention has the characteristics of uniform bands, sharpness, and obvious brightness between bands. It can be widely used for molecular weight indication in CssDNA electrophoresis and can be stored at room temperature for a long time, making it convenient to use.

[0014] This invention uses a ligase method to prepare ssDNA into CssDNA. Multiple CssDNAs are mixed in a certain proportion to form a marker. Electrophoresis can easily, accurately and efficiently indicate whether the CssDNA is circular and indicate the length (or molecular weight) of the CssDNA.

[0015] The CssDNA Marker preparation method of this invention has high stability and can ensure reproducible production between batches, thereby realizing large-scale production. The production process of this method is simple. After the circularization is completed in the early stage, the subsequent Marker production cost is very low. The production volume can be large or small and the storage is very convenient. Attached Figure Description

[0016] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0017] Figure 1 A schematic diagram illustrating the preparation of single-stranded circular DNA; Figure 2 Mass spectra of 15nt, 32nt, and 40nt CssDNA after HPLC purification; Figure 3 Mass spectra of 56nt, 81nt, and 99nt CssDNA after HPLC purification; Figure 4 The mass spectrum of 249nt CssDNA after HPLC purification; Figure 5 CssDNA PAGE gel images of 15nt, 32nt, 40nt, 56nt, 81nt, 99nt and 249nt; Figure 6 CssDNA Marker PAGE gel image; Figure 7 Image showing 31 nt ssDNA and CssDNA marker indicators; Figure 8PAGE gel images of 25 nt ssDNA, 52 nt ssDNA, and the marker from Example 3. Detailed Implementation

[0018] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0019] In a first aspect, the present invention provides a method for preparing a single-stranded circular DNA marker, comprising the following steps: i: Design multiple single-stranded DNA fragments and at least one ligation clip sequence. The single-stranded DNA fragments have different lengths. Mix each single-stranded DNA fragment with the ligation clip sequence and perform a ligation reaction using DNA ligase or cyclase to obtain single-stranded circular DNA. The two ends of each single-stranded DNA fragment are complementary to at least one ligation clip sequence. The molar ratio of each single-stranded DNA fragment to the ligation clip sequence is 1:0.1-5. ii: Purify each single-stranded circular DNA product obtained from the ligation reaction, and then blend the purified single-stranded circular DNA products in a specified proportion.

[0020] The inventors discovered that by ligating the ligation clip sequence with each single-stranded DNA fragment using DNA ligase or cyclase, multiple single-stranded circular DNA products of different lengths can be obtained. These products can then be blended in a specific ratio to create single-stranded circular DNA markers. Multiple CssDNA fragments form a marker, and since each CssDNA fragment has a different length and molecular weight, the molecular weight of the CssDNA to be tested can be preliminarily determined by electrophoresis.

[0021] After testing, the DNA Marker prepared according to the method provided by this invention has the characteristics of uniform bands, sharpness, and obvious brightness between bands. It can be widely used for molecular weight indication in CssDNA electrophoresis process, and can be stored at room temperature for a long time, which is convenient for use.

[0022] This invention uses a ligase method to prepare ssDNA into CssDNA. Multiple CssDNAs are mixed in a certain proportion to form a marker. Electrophoresis can easily, accurately and efficiently indicate whether the CssDNA is circular and indicate the length (or molecular weight) of the CssDNA.

[0023] The CssDNA Marker preparation method of this invention has high stability and can ensure reproducible production between batches, thereby realizing large-scale production. The production process of this method is simple. After the circularization is completed in the early stage, the subsequent Marker production cost is very low. The production volume can be large or small and the storage is very convenient.

[0024] In this invention, the splint sequence is synonymous with the splint sequence. The splint sequence is used to join the complementary ends of linear single-stranded DNA to form a circular structure.

[0025] In one implementation, the splint sequence may remain the same; in another implementation, the splint sequence used for circular ligation of each single-stranded DNA fragment may be different.

[0026] The mixing molar ratio of each single-stranded DNA fragment to the ligation splice sequence is, for example, 1:0.1, 1:0.5, 1:0.8, 1:1, 1:1.2, 1:1.5, 1:1.8, 1:2, 1:2.5, 1:3, 1:3.5, 1:4, 1:4.5, or 1:5. Good ligation efficiency is achieved at these mixing molar ratios.

[0027] In a preferred embodiment of the present invention, the length of the connecting clamp sequence is 12-100 nt. For example, the length of the connecting clamp sequence is 12nt, 13nt, 14nt, 15nt, 16nt, 17nt, 18nt, 20nt, 25nt, 30nt, 35nt, 40nt, 42nt, 45nt, 50nt, 55nt, 60nt or 15-38nt, 60-80nt, 70nt, 75nt, 80nt, 85nt, 90nt, 95nt or 100nt.

[0028] In a preferred embodiment of the present invention, the number of single-stranded DNA fragments is 5-15. For example, the number of single-stranded DNA fragments may be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15.

[0029] In a preferred embodiment of the present invention, there are 7 types of single-stranded DNA fragments, whose nucleotide sequences are shown in SEQ ID NO: 1-7, and the nucleotide sequences of the splice sequences are shown in at least one of SEQ ID NO: 8-15.

[0030] SEQ ID NO: 1: GCTAGTTCTTGTTAT; SEQ ID NO: 2: AATGTGGTCAGCGGAACGGCTCGGATGTGAGG; SEQ ID NO: 3: GGTGGTGATGACTTGAGGAGCGACTCTGACGGTGCTTGAA; SEQ ID NO:4: GCTCCAGAACGTCCCAATGTCGCATTCGGTTCATACTAAGAGGTACACTCCACACT; SEQ ID NO:5: GACTTGTTTGTAGTTGAGCTGTCACTTTAGATTGATGTGATTTCGTTGATTTAGCTTTCCTGCTTCATTCATTTAACCCAT; SEQ ID NO:6: GTAAGATTAATCCTGTGTCGTTCTGGTCGTCCTGGTATTCATACTTACAACTTATCAGTTGTCTGATACTAATTCTGTTATAAGCTAATACTTGATATC; SEQ ID NO:7: CGTTAGTCTAAATCGTTCCTTGCTCTCTGCGTTTATCGGGCTTGAGACCGACGTGTAAATTATTGCCGCATTATGTTGCTCTCTGTTAGCGTTTCTTATCGGGCTTGAGACCGACGTGTAAATTATTTACACGGCCGCATTACAAGTGGTTCTTGATGCCTTTGAGTTCCTTTCTACAAGTGAAAACCCTTTCAGCCCTAATACGACTCACTATAGGATTGGTTACGAACCTTACACGTTAGCTTACCC; SEQ ID NO:8: ACTAGCATAACA; SEQ ID NO:9: CACATTCCTCAC; SEQ ID NO:10: ACCACCTTCAAGCA; SEQ ID NO:11: TCTGGAGCAGTGTGGA; SEQ ID NO:12: CAAACAAGTCATGGGTTAAA; SEQ ID NO:13: TTAATCTTACGATATCAAGT; SEQ ID NO:14: GCCCGATAAGAAACGCTAACAGAGAGCAACATAATGCGGC; SEQ ID NO: 15: GGGTAAGCTAACGTGTAAGGTTCGTAACCAATCCTATAGT.

[0031] In a preferred embodiment of the present invention, the molar ratio of each single-stranded DNA fragment to the linker sequence is 1:2-5. For example, the molar ratio of each single-stranded DNA fragment to the linker sequence is 1:2, 1:3, 1:4, or 1:5.

[0032] In a preferred embodiment of the present invention, the ligation reaction is carried out using T4 DNA ligase, Taq DNA ligase, or cyclase, under the following conditions: ligation at 12-40℃ for 6-24 hours. For example, ligation at 12-30℃ for 6-24 hours, 15-40℃ for 6-24 hours, 20-40℃ for 6-24 hours, or 30-40℃ for 6-24 hours.

[0033] In a preferred embodiment of the present invention, purification includes the following steps performed sequentially: alcohol precipitation, first heat treatment, filtration, exonuclease treatment, second heat treatment, filtration, and HPLC purification.

[0034] Alcohol precipitation allows single-stranded circular DNA to separate from other substances in the form of a precipitate.

[0035] In a preferred embodiment of the present invention, the first heat treatment is performed in a water bath at 70℃±0.5℃ for 10-40 minutes; the purpose of the first heat treatment is to inactivate the protein, thereby removing the protein by filtration.

[0036] The second heat treatment is performed in a water bath at 80℃±0.5℃ for 15-40 min. This second heat treatment is used to inactivate the exonucleases in the system, facilitating subsequent protein removal by filtration.

[0037] Nucleases are selected from specific exonucleases with 3'→5' single-strand activity, such as Exonuclease I.

[0038] The mobile phase for HPLC purification was TEAB and acetonitrile, eluted with a gradient of 5% to 95% acetonitrile. The elution program included: 0-7 min, 0-5% acetonitrile; 7-15 min, 5-30% acetonitrile; 16-21 min, 3-95% acetonitrile; 21-30 min, 95% acetonitrile.

[0039] The above-mentioned ssDNA synthesis methods can be selected from phosphorous amide chemical synthesis, enzymatic DNA synthesis, PCR synthesis, or restriction enzyme digestion synthesis, with phosphorous amide chemical synthesis being preferred; Modifications to ssDNA include 5'P, 5'-terminal adenylation (5'RAPP), and 3'-phosphate, with 5'P modification being preferred.

[0040] Secondly, the present invention also provides a single-stranded circular DNA Marker, which is prepared by the above-described method for preparing a single-stranded circular DNA Marker.

[0041] Thirdly, the present invention also provides the application of single-stranded circular DNA markers in the detection of single-stranded circular DNA circulation or the detection of single-stranded circular DNA molecular weight.

[0042] In the detection of single-stranded circular DNA circulation or molecular weight, the single-stranded circular DNA to be tested is loaded onto a gel along with a marker. The circulation result and molecular weight of the single-stranded circular DNA are obtained by electrophoresis and comparing the marker bands.

[0043] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0044] Example 1 This embodiment provides a method for designing splint sequences. Based on existing ssDNA sequences, the sequence is designed as an ssDNA sequence with 5' phosphorylation modification. The gap should avoid repetitive sequences, and the DNA splint is precisely designed (as a complementary sequence to the gap region). For multiple similar DNA sequences, without changing the original sequence, the 5' end base of the sequence can be moved to the 3' end, so that the bases in the gap region of these similar sequences are the same, and the same splint sequence can be used. For example, the sequences NNNNNNNNNNNATTCATACTTACAACTTATCAGTTGTCTGANNNNNNNNNNNNNNNNNNNNN and ATTCATACTTACAACTTATCAGTTGTCTGANNNNNNNNNNNNNNNNNNNNNN, both containing ATTCATACTTACAACTTATCAGTTGTCTGA, can be designed as 5'P modified TATCAGTTGTCTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNATTCATACTTACAACT and 5'P modified TATCAGTTGTCTGANNNNNNNNNNNNNNNNNNNNATTCATACTTACAACT, with splint being the complementary sequence ACAACTGATAAGTTGTAAGT in ATTCATACTTACAACTTATCAGTTGTCTGA.

[0045] For long-chain DNA that cannot be synthesized in one go, such as SEQ ID NO: 7, the sequence needs to be divided into two segments, DNA1 and DNA2, both of which require 5' phosphorylation modification, usually half of the original sequence. The gap should avoid repetitive sequences, and the DNA clip (complementary sequence to the region at the gap) should be precisely designed.

[0046] Spare plate design requirements: 1. When the sequence exceeds 100 nt, the length should be set to 20 ~ 40 nt; when it is less than 60 nt, the length should be set to 12 ~ 20 nt. 2. At the same time, the oligonucleotide annealing temperature should exceed the reaction temperature of 37 ℃. 3. Avoid repetitive sequences in the design.

[0047] According to the above splint design requirements, splint designs were performed for SEQ ID NO: 1 ~ 7, respectively, resulting in SEQ ID NO: 8: ACTAGCATAACA; SEQ ID NO: 9: CACATTCCTCAC; SEQ ID NO: 10: ACCACCTTCAAGCA; SEQ ID NO: 11: TCTGGAGCAGTGTGGA; SEQ ID NO: 12: CAAACAAGTCATGGGTTAAA; SEQ ID NO: 13: TTAATCTTACGATATCAAGT; SEQ ID NO: 14: GCCCGATAAGAAACGCTAACAGAGAGCAACATAATGCGGC; SEQ ID NO: 15: GGGTAAGCTAACGTGTAAGGTTCGTAACCAATCCTATAGT.

[0048] Example 2 This embodiment provides a method for preparing single-stranded circular DNA markers, the preparation principle and process of which are as follows: Figure 1 As shown, the seven ssDNA strands were separately prepared into CssDNA using the T4 ligase method. The seven CssDNA strands were then mixed to form a single-stranded circular DNA marker, which can be used to detect the molecular weight of CssDNA in a simple, accurate, and efficient manner.

[0049] The ssDNA information is as follows:

[0050] The nucleotide sequences of the seven ssDNAs are shown in SEQ ID NO: 1-7, with lengths of 15 nt, 32 nt, 40 nt, 56 nt, 81 nt, 99 nt, and 249 nt, respectively. They were chemically synthesized via the phosphoramide method, with a phosphorylation modification (5'P) at the 5' end during synthesis. It should be noted that SEQ ID NO: 7 exceeded the length limit for chemical synthesis, so it was split into two Oligo sequences (SEQ ID NO: 16, 17) for synthesis.

[0051] SEQ ID NO: 16: CCTTACACGTTAGCTTTACCCCGTTAGTCTAAATCGTTCCTTGCTCTCTGCGTTTATCGGGCTTGAGACCGACGTGTAAATTATTGCCGCATTATGTTGCTCTCT; SEQ ID NO: 17: GTTAGCGTTTCTTATCGGGCTTGAGACCGACGTGTAAATTATTTACACGGCCGCATTACAAGTGGTTCTTGATGCCTTTGAGTTCCTTTCTACAAGTGAAAACCCTTTCAGCCCTAATACGACTCACTATAGGATTGGTTACGAA.

[0052] The nucleotide sequence of the splint sequence (i.e., the splint-connecting sequence) is shown below: SEQ ID NO: 8: ACTAGCATAACA; SEQ ID NO: 9: CACATTCCTCAC; SEQ ID NO: 10: ACCACCTTCAAGCA; SEQ ID NO: 11: TCTGGAGCAGTGTGGA; SEQ ID NO: 12: CAAACAAGTCATGGGTTAAA; SEQ ID NO: 13: TTAATCTTACGATATCAAGT; SEQ ID NO: 14: GCCCGATAAGAAACGCTAACAGAGAGCAACATAATGCGGC; SEQ ID NO: 15: GGGTAAGCTAACGTGTAAGGTTCGTAACCAATCCTATAGT.

[0053] The experimental materials and reagents involved in the preparation process are as follows: The main components of the reaction system include ssDNA, splint, 10x Reaction Buffer, T4 DNA ligase, and sterile water.

[0054] TEAB (A510932, Sangon Biotech), acetonitrile (A362610, Sangon Biotech), alcohol precipitation solution (70% ethanol, self-prepared), Urea-PAGE gel preparation kit (R0218S, Beyotime), TBE buffer (B040124, Sangon Biotech), TBE-Urea loading buffer (C506046, Sangon Biotech).

[0055] The preparation method of single-stranded circular DNA markers specifically includes the following steps: (1) Dissolve ssDNA and the corresponding splint dry powder in ddH2O to 100 μM respectively. Prepare reaction solutions according to the reaction systems shown in Tables 1-7. Connect overnight at 37℃. After the reaction process reaches the expected stage, take 100 μL of sample for alcohol precipitation (i.e., precipitation with ethanol) and send it for mass spectrometry detection. The reaction can be terminated when the product accounts for more than 80% of the substrate. (2) Purification: The sample was placed in a 70℃ water bath for 10 min, and the protein was filtered using a 0.22 μm filter membrane. Exonuclease I was added to the clarified liquid to remove the remaining ssDNA and splint, and the mixture was incubated at 37℃ for 30 min and then heated at 80℃ for 15 min to inactivate the protein. The protein was filtered using a 0.22 μm filter membrane, and the clarified liquid was stored at -80℃ for subsequent HPLC purification.

[0056] Table 1. Connection Reaction System

[0057] Table 2. Connection Reaction System Table

[0058] Table 3. Connection Reaction System Table

[0059] Table 4. Connection Reaction System Table

[0060] Table 5. Connection Reaction System Table

[0061] Table 6. Connection Reaction System Table

[0062] Table 7. Connection Reaction System

[0063] Results analysis: Mass spectrometry results showed that the conversion rate of ssDNA of all lengths to CssDNA was over 95%, which is ready for further purification.

[0064] (3) HPLC purification The cyclization reaction product after enzyme removal was prepared at room temperature using high-performance liquid chromatography (HPLC). Different elution peaks were collected. The mobile phase was TEAB and acetonitrile, with an injection volume of 500 μL and a gradient elution of 5%–95% acetonitrile. The elution program included: 0–7 min, 0%–5% acetonitrile; 7–15 min, 5%–30% acetonitrile; 16–21 min, 3%–95% acetonitrile; 21–30 min, 95% acetonitrile. The eluent was collected and sent for mass spectrometry analysis. Elution buffer with a mass spectrometry purity of 95% or higher was selected, preferably 100%, for subsequent CssDNA marker preparation and stored at -80℃.

[0065] Results analysis: Mass spectrometry results showed that the purity of CssDNA at the main peak in the liquid phase reached 100%. Figure 2 , Figure 3 and Figure 4 As shown in the figure, pure CssDNA was collected, concentrated into dry powder under vacuum, and set aside for later use.

[0066] (4) PAGE glue verification Prepare a 10% urea-denaturing polyacrylamide gel with a sample loading volume of 0.05 OD. Mix the sample with 2X TBE-Urea loading buffer and heat in a 70℃ water bath for 5 min. Perform electrophoresis using the 10% urea-denaturing polyacrylamide gel at an electrophoresis pressure of 120 V. After electrophoresis, stain with a 0.05% nucleic acid dye and observe the bands under UV conditions.

[0067] Results Analysis: PAGE results are as follows Figure 5 As shown, the CssDNA sample obtained after HPLC purification is a clean single band, indicating that the sample can be used for marker preparation.

[0068] Example 3 Preparation of CssDNA marker.

[0069] This embodiment provides a method for preparing a CssDNA marker. CssDNA samples of 15 nt, 32 nt, 40 nt, 56 nt, 81 nt, 99 nt, and 249 nt, purified by HPLC and verified by mass spectrometry and PAGE gel imaging, were mixed in a volume ratio of 0.5:0.5:1:0.5:0.5:1:0.5 to form the marker.

[0070] Mix the marker with 2X TBE-Urea loading buffer, heat in a 70℃ water bath for 5 min, load 0.05 OD, and perform electrophoresis analysis using a 10% urea denaturing polyacrylamide gel. Stain and observe the results.

[0071] Results Analysis: PAGE results are as follows Figure 6 As shown, the CssDNA Marker obtained after HPLC purification and mixing in a certain proportion has the characteristics of uniform bands, sharpness, and obvious brightness between bands.

[0072] Example 4 This embodiment provides an example of the application of the CssDNA marker in practical detection. A 31-base 5'P modified single-stranded DNA (TCTTTAATAGTGGACTCTTGTTCCAAACTGG) and the corresponding splint (ATTAAAGACCAGTTTG) were synthesized. The cyclization reaction was completed using T4 ligase, and the cyclized product was obtained by HPLC purification.

[0073] A 10% urea-denaturing polyacrylamide gel was prepared, with a loading volume of 0.05 OD. 31 nt ssDNA and the circularized product CssDNA were mixed separately with 2X TBE-Urea loading buffer and heated in a 70℃ water bath for 5 min. Electrophoresis was performed using the 10% urea-denaturing polyacrylamide gel at a pressure of 120 V. After electrophoresis, the gel was stained with a 0.05% nucleic acid dye, and the bands were observed under UV light. The electrophoresis results are as follows. Figure 7 As shown. Under the guidance of the CssDNA marker prepared in Example 3, the 31-base circularized CssDNA is slightly smaller than the 32-nt position in the marker. It is 31 nt both before and after circularization, indicating that the prepared CssDNA marker has a good indicative effect.

[0074] Example 5 This embodiment provides an example of the application of the CssDNA marker in practical detection. Two single-stranded DNAs with 5'P modification and corresponding splints (splint1: GTTAATATCACCTGAA; splint2: CATATTTGAAATGCTCGATG), ssDNA1: 25 nt (ATATTAACGTTTACAATTTCAGGTG), ssDNA2: 52 nt (TTCAAATATGTATCCGCTCATGAATTAATTCTTAGAAAAACTCATCGAGCAT), were cyclized using T4 ligase, and the cyclized products were purified by HPLC.

[0075] A 10% urea-denaturing polyacrylamide gel was prepared, with a loading volume of 0.05 OD. 25 nt ssDNA and 52 nt ssDNA were mixed separately with 2X TBE-Urea loading buffer and heated in a 70℃ water bath for 5 min. Electrophoresis was performed using the 10% urea-denaturing polyacrylamide gel at a pressure of 120 V. After electrophoresis, the gel was stained with a 0.05% nucleic acid dye, and the bands were observed under UV light. The electrophoresis results are shown below. Figure 8 As shown. Under the indication of the CssDNA marker prepared in Example 3, the 25 nt circularized CssDNA band was between 32 nt and 15 nt, smaller than the 32 nt band; the 52 nt CssDNA was smaller than the 56 nt CssDNA marker, indicating that the prepared CssDNA marker has a good indicative effect on the circularized products.

[0076] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A method for preparing a single-stranded circular DNA marker, characterized in that, It includes the following steps: i: Design multiple single-stranded DNA fragments and at least one ligation clip sequence. The multiple single-stranded DNA fragments have different lengths. Mix each of the single-stranded DNA fragments with the ligation clip sequence and perform a ligation reaction using DNA ligase or cyclase to obtain single-stranded circular DNA. The two ends of each single-stranded DNA fragment are complementary to at least one of the ligation clip sequences. The molar ratio of each single-stranded DNA fragment to the ligation clip sequence is 1:0.1-5. ii: Purify each single-stranded circular DNA product obtained from the ligation reaction, and then blend the purified single-stranded circular DNA products in a specified proportion.

2. The method for preparing the mixture of single-stranded circular DNA markers according to claim 1, characterized in that, The length of the connecting clamp sequence is 12-100 nt.

3. The method for preparing a single-stranded circular DNA marker according to claim 1, characterized in that, The number of single-stranded DNA fragments is 5-15.

4. The method for preparing a single-stranded circular DNA marker according to claim 3, characterized in that, The number of single-stranded DNA fragments is 7, and their nucleotide sequences are shown in SEQ ID NO: 1-7 respectively. The nucleotide sequences of the splice sequences are shown in at least one of SEQ ID NO: 8-15.

5. The method for preparing a single-stranded circular DNA marker according to claim 1, characterized in that, The mixing molar ratio of each of the single-stranded DNA fragments to the linker sequence is 1:2-5.

6. The method for preparing a single-stranded circular DNA marker according to claim 5, characterized in that, The ligation reaction is carried out using T4 DNA ligase, Taq DNA ligase, or cyclase, under the following conditions: ligation at 12-40℃ for 6-24 h.

7. The method for preparing a single-stranded circular DNA marker according to claim 1, characterized in that, The purification process includes the following steps performed sequentially: first heat treatment, filtration, exonuclease treatment, second heat treatment, filtration, and HPLC purification.

8. The method for preparing a single-stranded circular DNA marker according to claim 7, characterized in that, The first heat treatment was performed in a water bath at 70℃±0.5℃ for 10-40 min; The second heat treatment is performed in a water bath at 80℃±0.5℃ for 15-40 min; The mobile phase for HPLC purification was TEAB and acetonitrile, eluted with a gradient of 5% to 95% acetonitrile. The elution program included: 0-7 min, 0%-5% acetonitrile; 7-15 min, 5%-30% acetonitrile; 16-21 min, 3%-95% acetonitrile; 21-30 min, 95% acetonitrile.

9. A single-stranded circular DNA marker, characterized in that, It is prepared by the method for preparing a single-stranded circular DNA marker according to any one of claims 1-8.

10. The application of the single-stranded circular DNA marker as described in claim 9 in the detection of single-stranded circular DNA circulation or the determination of single-stranded circular DNA molecular weight.

Images