African swine fever virus genotyping detection kit, detection method and application

Abstract

The invention relates to the technical field of animal epidemic disease detection, in particular to an African swine fever virus genotyping detection kit, a detection method and application. Specific primers are designed by aiming at a conserved region of an X64R gene and a differential region of an EP402R gene as diagnosis targets, and a primer pair capable of performing specific typing detection on ASFV nucleic acid is finally obtained through screening and optimization; the rapid detection of the gene type I, the gene type II and the gene type I / II recombinant ASFV is realized by combining duplex nucleic acid lateral chromatography test paper. A product obtained by isothermal amplification is detected by a nucleic acid detection test strip and then directly subjected to result interpretation, expensive instruments and equipment are not needed in the whole detection process, and a detection result can be obtained only through naked eye interpretation. The method can effectively distinguish the gene I type ASFV from the gene II type ASFV, can identify the gene I / II type recombinant African swine fever virus currently popular in China, and has a wide application prospect in the aspect of rapid typing detection of ASFV infection at a basic level and on site.

Description

Technical Field

[0001] This invention relates to the field of animal disease detection technology, specifically to an African swine fever virus genotyping detection kit, detection method, and application. Background Technology

[0002] African swine fever (ASF) is an acute, highly contagious disease caused by the African swine fever virus (ASFV), primarily infecting domestic and wild pigs. Symptoms are mainly characterized by fever and hemorrhage. Since the emergence of type II ASFV, it has caused enormous economic losses to the pig farming industry. Furthermore, ASFV vaccines based on genotype II ASFV (HLJ / 18 strain) offer no protection against virulent type I / II recombinant ASFV strains, further increasing the difficulty of ASF control. Moreover, given the current frequent occurrence of type I / II recombinant strains, accurate identification of the strain type is crucial for vaccine development and epidemic prevention and control.

[0003] Currently, molecular biology methods such as multiplex quantitative PCR, nano-PCR, and CRISPR-Cas12a / 13a systems are mainly used domestically and internationally for ASFV typing and diagnosis. In serological testing for ASFV, enzyme-linked immunosorbent assays (ELISA), immunochromatographic test strips, and time-resolved fluorescence immunoassay targeting ASFV p30, p54, CD2v, and pp62 proteins are used for post-infection antibody detection to aid in determining the strain type, but they cannot be used alone for typing. Although the above detection methods play an important role in the identification, detection, and diagnosis of ASFV, they are generally complex to operate, time-consuming, require sophisticated equipment, and are only suitable for laboratory diagnosis and epidemic monitoring, making it difficult to meet the needs of multi-target combined typing detection and portable on-site testing for ASFV infection in clinical practice.

[0004] In recent years, recombinase-aided amplification (RAA) technology has shown great potential in in vitro detection for purposes other than disease diagnosis, and has been widely used worldwide. Because the entire RAA amplification process does not require complex and expensive instruments—only a thermostat or even body temperature is needed to complete the detection—RAA technology is very suitable for development and application in rapid on-site testing. Summary of the Invention

[0005] The purpose of this invention is to provide an African swine fever virus (ASFV) genotyping detection kit, detection method, and application to solve the technical problem of achieving rapid, visual, and on-site identification and detection of ASFV infection. Based on meeting on-site detection requirements, this invention combines a self-developed dual-component colloidal gold immunochromatographic test strip with nucleic acid isothermal amplification, thereby achieving rapid, visual, and on-site identification and detection of ASFV infection.

[0006] The technical solution of the present invention is as follows: An African swine fever virus genotyping detection kit includes: A primer set for recombinase-mediated isothermal amplification, comprising a first primer pair and a second primer pair. The first primer pair is for the X64R gene, and the second primer pair is for the EP402R gene. The X64R gene primer pair has its upstream primer labeled with DIG at the 5' end and its downstream primer labeled with Biotin at the 5' end. The EP402R gene primer pair has its upstream primer labeled with DIG at the 5' end and its downstream primer labeled with FITC at the 5' end. A nucleic acid lateral flow chromatography test strip, the test strip comprising a binding pad on which colloidal gold-labeled anti-DIG antibody is immobilized, detection lines T1 and T2 respectively immobilized with avidin and anti-FITC antibody, and a control line immobilized with Staphylococcus aureus protein A; RAA isothermal amplification reaction reagent.

[0007] Further optimization was performed, and the sequences of the first primer pair are shown in SEQ ID NO: DIG-X64R-1F and SEQ ID NO: Biotin-X64R-2R. The sequences of the second primer pair are shown in SEQ ID NO: DIG-EP402R-3F and SEQ ID NO: FITC-EP402R-3R.

[0008] Further optimization involves labeling the colloidal gold-labeled anti-DIG antibody with ascites fluid prepared from a hybridoma cell line with accession number CCTCC NO: C202536.

[0009] Further optimization is achieved by including lyophilized recombinase reaction beads and a 280 mM magnesium acetate solution in the RAA isothermal amplification reaction reagent.

[0010] Further optimization includes a positive control and a negative control. The positive control is a standard positive plasmid containing the full length of the ASFV X64R gene and the EP402R gene, and the negative control is an empty vector plasmid that does not contain the ASFV genome.

[0011] A method for detecting African swine fever virus genotyping includes the following steps: Step 1: Based on the comparative analysis of the genomes of type I, type II, and type I / II recombinant ASFV, the conserved region of the X64R gene was identified as a diagnostic target for the simultaneous detection of type I and type I / II recombinant ASFV; the differential region of the EP402R gene was identified as a diagnostic target to differentiate between type II and type I / II recombinant ASFV. Based on the identified target and the characteristics of recombinase-mediated isothermal amplification technology, functional primer pairs were screened according to the following design principles: GC content 40-60%, primer length 30-35 nucleotides, and amplification product size 100-300 bp; and functional primer sets were screened accordingly. Step 2: Extract genomic DNA from the sample to be tested; Step 2: Using the extracted genomic DNA as a template, perform isothermal amplification using the functional primer set obtained from Step 1 and RAA amplification reagent to obtain RAA amplification products; Step 3: Dilute the RAA amplification product and add it to the sample application area of ​​the nucleic acid lateral flow chromatography test strip; Step 4: Observe the results after incubation at room temperature: If the T1 test line shows color, it is determined to be a type I ASFV infection; If the T2 test line shows color, it is determined to be a type II ASFV infection; If both test lines T1 and T2 show color, it is determined to be a type I / II recombinant infection.

[0012] Further optimization includes observing whether the control line shows color; if it does, the test is valid; otherwise, the test is invalid.

[0013] Application of nucleic acid lateral flow chromatography test strips in the preparation of an African swine fever virus genotyping detection kit, wherein the test strips are used to detect nucleic acid amplification products double-labeled by DIG and Biotin or DIG and FITC, and the test strips comprise: The conjugate pad has a colloidal gold-labeled anti-DIG antibody immobilized on it; The detection membrane has the following features: The first detection line is immobilized with avidin to capture biotin-labeled nucleic acid fragments; The second detection line is immobilized with anti-FITC antibodies to capture FITC-labeled nucleic acid fragments; The quality control line is immobilized with Staphylococcus aureus protein A.

[0014] Application of an African swine fever virus genotyping detection kit in the preparation of medical devices for identifying genotype I, II, and I / II recombinant ASFV.

[0015] The beneficial effects of this technical solution are: 1. Based on in-depth genomic analysis, this invention creatively selects the conserved region of the X64R gene and the differentially expressed region of the EP402R gene as typing targets, and optimizes the design of highly specific primers for the characteristics of RAA technology. This strategy ensures the accuracy of detection, clearly distinguishing between genotype I, II, and I / II recombinant ASFV, effectively solving the problem of inaccurate typing or missed detection by traditional methods in the context of complex prevalent strains. Combined with a self-developed dual-label (DIG / Biotin and DIG / FITC) detection system and matching chromatographic test strips, it achieves simultaneous and specific capture of multiple targets, significantly improving the specificity and reliability of detection, with a sensitivity of up to 1. copies / μL; 2. Based on RAA, this invention combines a self-developed dual colloidal gold immunochromatographic test strip for detecting digoxigenin-labeled nucleic acids. The antibody concentration, detection line concentration, and position of the colloidal gold label on the dual colloidal gold immunochromatographic test strip have been optimized and compared. This invention enables rapid visualization of the identification test results without the need for complex professional background. 3. The RAA reaction can be completed in just a few minutes at a constant temperature of 37℃, eliminating the dependence on expensive and complex PCR instruments; the test results can be directly read by the naked eye through the color of the bands on the test strip, without any auxiliary equipment. The entire process from nucleic acid amplification to result analysis can be completed within 20 minutes. It is simple and fast to operate, which can meet the needs of rapid and high-throughput screening on site. The test process is convenient and quick, and the test results are safe and reliable. In summary, the rapid typing capability of this invention helps to promptly grasp the variation and distribution of circulating strains, providing key data support for vaccine research and development and evaluation, source tracing, and precise formulation of purification plans, by achieving early, rapid, and on-site typing. Attached Figure Description

[0016] Figure 1 This is a diagram showing the RAA-specific primer screening results for the X64R gene in an embodiment of the present invention; Figure 2 This is a diagram showing the RAA-specific primer screening results for the EP402R gene in this embodiment of the invention; Figure 3 This is a graph showing the RAA sensitivity test results for the X64R gene in an embodiment of the present invention; Figure 4 This is a graph showing the RAA sensitivity test results for the EP402R gene in an embodiment of the present invention; Figure 5This is a graph showing the sensitivity test results of the RAA dual detection method based on the X64R gene and EP402R gene in this embodiment of the invention. Figure 6 This is the optimized labeling concentration result of the nucleic acid dual colloidal gold immunochromatographic test strip in this embodiment of the invention; Figure 7 This is the result of optimizing the concentration of colloidal gold-labeled anti-DIG monoclonal antibody and the position of the detection line in the nucleic acid dual colloidal gold immunochromatographic test strip in this embodiment of the invention; Figure 8 The RAA-LFA test results for type I, type II, and I / II recombinant ASFV strains are shown in the embodiments of the present invention. Detailed Implementation

[0017] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only for explaining the invention and are not intended to limit the invention; that is, the described embodiments are merely some embodiments of the invention, and not all embodiments. The components of the embodiments of the invention described and shown in the accompanying drawings can generally be arranged and designed in various different configurations.

[0018] Therefore, the following detailed description of the embodiments of the invention provided in the accompanying drawings is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments of the invention. All other embodiments obtained by those skilled in the art based on the embodiments of the invention without inventive effort are within the scope of protection of the invention.

[0019] It should be noted that relational terms such as "first" and "second" are used merely to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Without further limitations, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes said element.

[0020] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0021] A specific embodiment of the African swine fever virus genotyping detection kit, detection method, and application of the present invention is as follows: Figure 1-8 As shown.

[0022] Example 1

[0023] An African swine fever virus genotyping detection kit includes: A primer set for recombinase-mediated isothermal amplification includes a first primer pair and a second primer pair. The first primer pair is for the ASFV X64 gene, and its sequences are shown in SEQ ID NO: DIG-X64R-1F and SEQ ID NO: Biotin-X64R-2R. The second primer pair is for the ASFV EP402R gene, and its sequences are shown in SEQ ID NO: DIG-EP402R-3F and SEQ ID NO: FITC-EP402R-3R. The primer pair for the ASFV X64 gene has a 5' label of DIG on the upstream primer and a 5' label of Biotin on the downstream primer. The primer pair for the ASFV EP402R gene has a 5' label of DIG on the upstream primer and a 5' label of FITC on the downstream primer. Specifically: Upstream primer targeting the X64R gene (DIG-X64R-1F): 5'-DIG-ATTATAGTAGCATATGTAAGTTATAAATTGGTTCC-3' Downstream primer targeting the X64R gene (Biotin-X64R-12R): 5'- Biotin- AAATCCGGATCTTTCATTTATATCTAATTTTTC -3' Upstream primer targeting the EP402R gene (DIG-EP402R-3F): 5'-DIG-ATAATTCTTTTAATACACTAGCTACATGTGGAA-3' Downstream primer for the EP402R gene (FITC-EP402R-3R): 5'-FITC-CATCATTATGAGGAAAAATAGTTAAGCTACAA-3'.

[0024] The construction of the RAA amplification system includes: 20.75 μL of deionized water, 0.50 μL each of 10 μM upstream and downstream primers (DIG-1F, Biotin-2R, DIG-3F, FITC-3R), 1.00 μL of DNA extract from the sample to be tested, and 1.25 μL of 280 mM magnesium acetate solution.

[0025] A nucleic acid lateral flow chromatography test strip comprises colloidal gold-labeled anti-DIG monoclonal antibody ascites fluid. The T1 line immobilizes avidin (SA) to capture biotin-labeled amplification products. The T2 line immobilizes a monoclonal antibody against fluorescein isothiocyanate (FITC) to capture specific FITC-labeled amplification products. The C line immobilizes Staphylococcal Protein A (SPA) to bind excess gold-labeled anti-DIG monoclonal antibody as a quality control. Qualitative detection of the target nucleic acid is achieved by using a sandwich method of DIG-labeled gold antibody and avidin / anti-FITC antibody. The colloidal gold-labeled anti-DIG antibody is obtained by labeling ascites fluid prepared from a hybridoma cell line (accession number CCTCC NO: C202536, depository of China Center for Type Culture Collection).

[0026] The test kit also includes a positive control and a negative control. The positive control is a standard positive plasmid containing the full length of the X64R and EP402R genes, and the negative control is an empty vector plasmid that does not contain the ASFV genome.

[0027] The detection method for identifying dual nucleic acids of ASFV with multiple genotypes is shown in the following steps.

[0028] Step 1: Based on the comparative analysis of the genomes of type I, type II, and type I / II recombinant ASFV, the conserved region of the X64R gene was identified as a diagnostic target for the simultaneous detection of type I and type I / II recombinant ASFV; the differential region of the EP402R gene was identified as a diagnostic target to differentiate between type II and type I / II recombinant ASFV. Based on the identified target and the characteristics of recombinase-mediated isothermal amplification technology, functional primer pairs were screened according to the following design principles: GC content 40-60%, primer length 30-35 nucleotides, and amplification product size 100-300 bp; and functional primer sets were screened accordingly. Step 2: Extract genomic DNA from the sample to be tested; Step 3: Using the extracted genomic DNA as a template, perform isothermal amplification using the functional primer set obtained from Step 1 and RAA amplification reagent to obtain RAA amplification products; Step 4: Dilute the RAA amplification product and add it to the sample application area of ​​the nucleic acid lateral flow chromatography test strip; Step 5: Observe the results after incubation at room temperature: If the T1 test line shows color, it is determined to be a type I ASFV infection; If the T2 test line shows color, it is determined to be a type II ASFV infection; If both test lines T1 and T2 show color, it is determined to be a type I / II recombinant infection.

[0029] Further optimization includes observing whether the control line shows color; if it does, the test is valid; otherwise, the test is invalid.

[0030] Application of a nucleic acid lateral flow chromatography test strip in the preparation of a dual nucleic acid detection kit for identifying multiple ASFV genotypes, wherein the test strip is used to detect nucleic acid amplification products double-labeled with DIG and Biotin or DIG and FITC, and the test strip comprises: The conjugate pad has a colloidal gold-labeled anti-DIG antibody immobilized on it; The detection membrane has the following features: The first detection line is immobilized with avidin to capture biotin-labeled nucleic acid fragments; The second detection line is immobilized with anti-FITC antibodies to capture FITC-labeled nucleic acid fragments; The quality control line is immobilized with Staphylococcus aureus protein A.

[0031] Application of the kit in the preparation of medical devices for identifying genotype I, II and I / II recombinant ASFV.

[0032] Example 2

[0033] Design and screening of specific primers This invention compares and analyzes the genomes of all currently prevalent ASFV strains in my country. The results show that the X64R gene of genotype I ASFV strains is 100% homologous to that of genotype I / II recombinant ASFV strains, and the EP402R gene of genotype II ASFV strains is 100% homologous to that of genotype I / II recombinant ASFV strains, but significantly different from that of genotype I ASFV strains. This invention targets the conserved region of the X64R gene and the differentially expressed region of the EP402R gene as diagnostic targets. The key to RAA amplification lies in primer design. However, RAA differs from conventional PCR reactions, and currently there is no software or mature design principles for primer design. Based on long-term practical research, RAA primer design considers multiple factors: GC content (40-60%), length (30-35 nt), and amplification product size (100-300 bp). See Table 1 for details.

[0034] Table 1. RAA primers designed for the ASFV X64R / EP402R gene

[0035] Using the orthogonal combination of RAA primers designed for the X64R gene in Table 1, 10 5 After RAA amplification of the full-length ASFVX64R gene standard positive plasmid (copies / μL), the primers ASFV-X64R-1F / ASFV-X64R-2R were selected by agarose gel electrophoresis to show the best amplification effect on the full-length X64R gene standard positive plasmid. Figure 1 Using the orthogonal combination of RAA primers designed for the EP402R gene in Table 1, 10 5 After RAA amplification of the full-length ASFV X64R gene standard positive plasmid (copies / μL), the amplification efficiency of primer combinations was compared by agarose gel electrophoresis. Primer combinations ASFV-EP402R-1F / ASFV-EP402R-1R, ASFV-EP402R-3F / ASFV-EP402R-3R, and ASFV-EP402R-5F / ASFV-EP402R-6R were selected, and the concentration of the full-length ASFV EP402R gene standard positive plasmid was reduced to 10. 4 After copies / μL were collected, RAA amplification was performed, and the results of agarose gel electrophoresis showed that ( Figure 2 The ASFV-EP402R-3F / ASFV-EP402R-3R primer combination exhibited good band specificity, with no non-specific amplification and high amplification efficiency. The ASFV-X64R-1F / ASFV-X64R-2R and ASFV-EP402R-3F / ASFV-EP402R-3R primers were labeled as shown in Table 2 for subsequent experiments.

[0036] Table 2. RAA marker primers targeting the ASFV X64R / EP402R gene

[0037] Example 3 RAA Sensitivity Test Standard positive plasmids for the full-length ASFV X64R gene, the full-length ASFV EP402R gene, and the full-length ASFV X64R+EP402R gene were selected as templates and serially diluted 10-fold with double-distilled water to a concentration of 10. 8The standard plasmid template was prepared in 1 copy / μL format, with an empty vector plasmid template without the ASFV genome as a negative control. After RAA reaction for 10 min, agarose gel electrophoresis showed that the minimum detectable template amount for the X64R gene with the ASFV-X64R-1F / ASFV-X64R-2R primer pair was 10 copies / μL. 2 copies / μL ( Figure 3 The minimum detectable template amount for the EP402R gene using the ASFV-EP402R-3F / ASFV-EP402R-3R primer pair is 10 copies / μL. Figure 4 ); when performing a dual RAA detection of the X64R and EP402R genes, the sensitivity was as high as 1 copies / μL ( Figure 5 ).

[0038] Example 4

[0039] Optimization of the detection line concentration for nucleic acid lateral flow chromatography test strips The pH of the colloidal gold solution was adjusted to 9.0 with 0.2 mol / L K2CO3. Ascites fluid containing the anti-DIG monoclonal antibody to be labeled was centrifuged and then labeled with colloidal gold at a rate of 2 μL per mL. Nitrocellulose membranes were cut into strips of 2.5 × 30 cm², placed on the platform of an XYZ 3000 spray spectrometer, and fixed with pressure strips. SA was diluted to 2 mg / mL, 3 mg / mL, and 4 mg / mL with double-distilled water; anti-Texas Red antibody was diluted to 2 mg / mL, 3 mg / mL, and 4 mg / mL with PBS; and anti-FITC antibody was diluted to 0.5 mg / mL and 1 mg / mL with PBS. Using a Biojet Quanti 3000, SA, anti-Texas Red antibody, and anti-FITC antibody were sprayed at 1 μL / cm to form the detection line, and 2 mg / mL SPA solution was sprayed as the control line. The membranes were dried at 42℃ for 30 min. A desiccant was added to the membranes, and they were stored in a sealed container at 4℃. The prepared nitrocellulose membrane was attached to the PCV substrate. An absorbent pad was attached to the upper end of the nitrocellulose membrane and pressed tightly. A binding pad containing colloidal gold-labeled anti-DIG monoclonal antibody was attached to the lower end of the nitrocellulose membrane and pressed tightly. Finally, the sample spot was pressed tightly onto the binding pad. The assembled test strip was dried at room temperature and stored. After using the corresponding labeled primers to amplify the RAA negative and positive templates, 175 μL of buffer was added to dilute the strip, and the solution was added to the sample wells of the strip. The strip was incubated at room temperature for 5-10 min, and the results were observed. The results showed ( Figure 6When the test lines were 3 mg / mL SA, 4 mg / mL anti-Texas Red antibody and 1 mg / mL anti-FITC antibody, the test lines showed clear and uniform brick-red bands, and the negative RAA reaction had a clean background and a clear distinction between positive and negative results.

[0040] Example 5

[0041] Optimization of the combination of gold-labeled antibody concentration and test line position on nucleic acid lateral flow chromatography test strips The test strips are labeled with 3 mg / mL SA, 4 mg / mL anti-Texas Red antibody, and 1 mg / mL anti-FITC antibody as the detection line, and 2 mg / mL SPA solution is sprayed as the control line. The test strips are assembled in the following order from top to bottom: COMB1: C-SPA, T1-SA, T2-Texas Red; COMB2: C-SPA, T1-SA, T2-FITC; COMB1: C-SPA, T1-Texas Red, T2-FITC. After assembling the test strips as described above, RAA amplification of negative and positive templates is performed using the corresponding labeled primers. The strips are then diluted with 175 μL of buffer and added to the sample wells of the strips. After incubation at room temperature for 5-10 min, the results are observed.

[0042] The results show that ( Figure 7 When each milliliter of colloidal gold is labeled with 4 μL of ascites fluid and the detection line positions are T1-SA and T2-FITC, the corresponding target shows an independent colorimetric response, appearing as a clear and uniform brick-red band.

[0043] Example 6

[0044] Nucleic acid lateral flow chromatography test strips for the identification and detection of type I, type II, and recombinant type I / II ASFV strains Using the genomes of well-preserved, laboratory-grown ASFV strains of type I, II, and I / II recombinant strains as templates, identification and detection were performed according to the above-described kit for identifying and detecting type I, II, and I / II recombinant ASFV strains. The results are shown in the figure. Figure 8 When detecting type I ASFV strains, the T1 line shows color; when detecting type II ASFV strains, the T2 line shows color; when detecting type I / II recombinant ASFV strains, both the T1 and T2 lines show color; and negative samples are visually judged to be absolutely clean, with no "shadow bands" appearing. This meets the clinical needs for multi-target combined typing detection of ASFV infection and portable on-site testing, with a convenient and rapid testing process and safe and reliable results.

[0045] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. The scope of patent protection of the present invention shall be determined by the claims. Similarly, any equivalent structural changes made based on the description and drawings of the present invention shall also be included within the scope of protection of the present invention.

Claims

1. An African swine fever virus genotyping detection kit, characterized in that, include: A primer set for recombinase-mediated isothermal amplification, comprising a first primer pair and a second primer pair. The first primer pair is for the X64R gene, and the second primer pair is for the EP402R gene. The X64R gene primer pair has its upstream primer labeled with DIG at the 5' end and its downstream primer labeled with Biotin at the 5' end. The EP402R gene primer pair has its upstream primer labeled with DIG at the 5' end and its downstream primer labeled with FITC at the 5' end. A nucleic acid lateral flow chromatography test strip, the test strip comprising a binding pad on which colloidal gold-labeled anti-DIG antibody is immobilized, detection lines T1 and T2 respectively immobilized with avidin and anti-FITC antibody, and a control line immobilized with Staphylococcus aureus protein A; RAA isothermal amplification reaction reagent.

2. The African swine fever virus genotyping detection kit according to claim 1, characterized in that, The sequences of the first primer pair shown are as shown in SEQ ID NO: DIG-X64R-1F and SEQ ID NO: Biotin-X64R-2R; The sequences of the second primer pair are shown in SEQ ID NO: DIG-EP402R-3F and SEQ ID NO: FITC-EP402R-3R.

3. The African swine fever virus genotyping detection kit according to claim 1, characterized in that, The colloidal gold-labeled anti-DIG antibody was obtained by labeling ascites fluid prepared from a hybridoma cell line with accession number CCTCC NO: C202536.

4. The African swine fever virus genotyping detection kit according to claim 1, characterized in that, The RAA isothermal amplification reaction reagent includes lyophilized recombinase reaction beads and a 280 mM magnesium acetate solution.

5. The African swine fever virus genotyping detection kit according to claim 1, characterized in that, It also includes a positive control and a negative control. The positive control is a standard positive plasmid containing the full length of the X64R gene and the EP402R gene, and the negative control is an empty vector plasmid that does not contain the ASFV genome.

6. A method for detecting African swine fever virus genotyping, characterized in that, Includes the following steps: Step 1: Based on the comparative analysis of the genomes of type I, type II, and type I / II recombinant ASFV, the conserved region of the X64R gene was identified as a diagnostic target for the simultaneous detection of type I and type I / II recombinant ASFV. The differentially expressed region of the EP402R gene is used as a diagnostic target to differentiate between type II and type I / II recombinant ASFV. Based on the identified target and the characteristics of recombinase-mediated isothermal amplification technology, functional primer pairs were screened according to the following design principles: GC content 40-60%, primer length 30-35 nucleotides, and amplification product size 100-300 bp; and functional primer sets were screened accordingly. Step 2: Extract genomic DNA from the sample to be tested; Step 3: Using the extracted genomic DNA as a template, perform isothermal amplification using the functional primer set obtained from Step 1 and RAA amplification reagent to obtain RAA amplification products; Step 4: Dilute the RAA amplification product and add it to the sample application area of ​​the nucleic acid lateral flow chromatography test strip; Step 5: Observe the results after incubation at room temperature: If the T1 test line shows color, it is determined to be a type I ASFV infection; If the T2 test line shows color, it is determined to be a type II ASFV infection; If both test lines T1 and T2 show color, it is determined to be a type I / II recombinant infection.

7. A method for detecting African swine fever virus genotyping according to claim 6, characterized in that, The observation results also include whether the control line shows color. If it does, the test is valid; otherwise, the test is invalid.

8. The application of nucleic acid lateral flow chromatography test strips in the preparation of a kit for African swine fever virus genotyping, characterized in that, The test strip is used to detect nucleic acid amplification products double-labeled with DIG and Biotin or DIG and FITC, and the test strip comprises: The conjugate pad has a colloidal gold-labeled anti-DIG antibody immobilized on it; The detection membrane has the following features: The first detection line is immobilized with avidin to capture biotin-labeled nucleic acid fragments; The second detection line is immobilized with anti-FITC antibodies to capture FITC-labeled nucleic acid fragments; The quality control line is immobilized with Staphylococcus aureus protein A.

9. The use of the African swine fever virus genotyping kit as described in any one of claims 1-5 in the preparation of medical devices for identifying genotype I, II and I / II recombinant ASFV.

Images