Space-controllable signal amplification nanometer assembly and preparation method and application thereof
By constructing signal amplification nanodevices based on DNA nano-origami technology and encapsulating them with cell membrane nanovesicles, spatiotemporal controllable signal amplification was achieved. This solved the problems of weak signal, poor specificity, and insufficient targeting in in vivo imaging caused by DNA signal amplification technology, thereby improving imaging accuracy and targeted delivery efficiency.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-12
- Publication Date
- 2026-04-03
AI Technical Summary
Existing DNA signal amplification technologies suffer from weak signals, poor specificity, easy degradation, and inability to achieve precise targeting in in vivo imaging, resulting in limitations in imaging accuracy and spatial resolution.
A spatially tunable signal amplification nanodevice was designed. By constructing a signal amplification nanodevice based on DNA nanoorigami technology and utilizing cell membrane nanovesicles for targeted delivery, and combining pH-responsive DNA strands with membrane fusion endocytosis, spatiotemporal controllable signal amplification was achieved.
It achieves highly sensitive and high signal-to-noise ratio detection of trace targets in specific locations, breaking through the bottlenecks of traditional methods in dynamic control and spatial positioning, and improving the accuracy of molecular imaging and the efficiency of targeted delivery.
Smart Images

Figure CN121775166A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to a spatially tunable signal amplification nanodevice, its preparation method, and its application. Background Technology
[0002] Molecular imaging technology is an important tool for revealing the mechanisms of disease occurrence and development at the molecular level, offering advantages such as in-situ specificity and real-time dynamics. Nanomaterial-based molecular imaging techniques possess good pharmacokinetic properties and versatility. An ideal molecular imaging probe should possess high specificity, high sensitivity, and the ability for real-time dynamic monitoring. Although nanomaterials show potential in this field due to their unique physicochemical properties, their inherent limitations restrict clinical translation: First, most nanoprobes operate on an always-on signal output mode, making them susceptible to interference from non-target regions and background noise during delivery; second, they generally lack effective built-in signal amplification mechanisms, limiting their ability to detect trace targets.
[0003] DNA nanotechnology offers a new approach to addressing these challenges. Functional DNA molecules, namely nucleic acid aptamers and DNAzymes, can recognize various targets with high specificity and can be designed as molecular switches to activate targets. More importantly, enzyme-free isothermal amplification techniques based on principles such as DNA strand displacement and hybridization chain reaction (HCR) can achieve efficient signal amplification under isothermal conditions, avoiding the problem of easy inactivation of proteases in living cells, thus exhibiting unique advantages in in vivo applications.
[0004] However, successfully applying DNA signal amplification technology to in vivo imaging still faces significant challenges. While most current DNA amplification strategies achieve enzyme-free amplification, their core design remains constantly activated. This means that if the probe comes into contact with the target in the bloodstream or non-target tissue before reaching the target site, it will prematurely initiate the amplification reaction, generating off-target signals and severely impairing imaging accuracy and spatial resolution. Furthermore, efficiently and accurately delivering DNA nanodevices carrying complex functions to specific lesion areas within the body remains another major bottleneck restricting their imaging performance. Multiple physiological barriers within the body reduce the targeted delivery efficiency of nanodevices, further exacerbating the spatial dispersion problem. Controlling the timing and location of signal amplification is difficult; therefore, developing a DNA signal amplification system that can synergistically address both timing and spatial targeting issues is crucial to overcoming current bottlenecks in in vivo molecular imaging technology and achieving high signal-to-noise ratio and high spatial specificity imaging of minute targets. Summary of the Invention
[0005] The technical problem this invention aims to solve is the shortcomings of biomarker detection in a live environment, such as weak signal, poor specificity, easy degradation, and inability to achieve precise targeting. An intelligent nanodevice integrating efficient signal amplification and precise spatial targeting capabilities is designed to achieve highly sensitive, high signal-to-noise ratio detection of trace targets at specific sites within the body.
[0006] To solve the above-mentioned technical problems, the present invention provides the following technical solution:
[0007] In a first aspect, the present invention provides a spatially tunable signal amplification nanodevice, which is constructed by encapsulating a signal amplification nanodevice with cell membrane nanovesicles. The cell membrane nanovesicles are used to achieve targeted delivery of the signal amplification nanodevice. The signal amplification nanodevice is constructed based on DNA nanoorigami technology and has the ability to amplify signals when triggered by a target nucleic acid molecule such as miRNA21. Specifically, the signal amplification nanodevice is a DNA tubular origami structure, which is formed by curling a rectangular DNA origami carrying a signal amplification structure through the regulation of a pH-locking chain. The signal amplification structure is located inside the tubular structure of the DNA tubular origami structure.
[0008] like Figure 1 As shown, the DNA rectangular origami structure with signal amplification, namely DON-HCR, is assembled from H1 hairpin strands, H2 hairpin strands, and DNA rectangular origami linked by complementary bases. The H2 hairpin strand carries a fluorescent quencher and a Cy5 fluorescent group. The H1 hairpin strand includes an initiating H1 hairpin strand and a post-initiating H1 hairpin strand. The initiating H1 hairpin strand, i.e., H1-initial, specifically recognizes the initiating H1 capture strand, and the post-initiating H1 hairpin strand specifically recognizes the post-initiating H2 capture strand. The signal amplification function is achieved jointly by the H1 and H2 hairpin strands. Upon detection of a target nucleic acid molecule, such as miRNA21, a hybridization chain reaction can be triggered. The initiation of the hybridization chain reaction enables spatially tunable signal amplification, significantly improving the accuracy of molecular imaging in specific organs. The DNA rectangular origami, or DON, is obtained by annealing and assembling an M13 backbone chain and a staple chain. The rectangular staple chain includes a staple chain, an H1 capture chain, an H2 capture chain, a Cy5 capture chain, a pH-responsive chain, and a locking chain. The H1 capture chain includes an initiating H1 capture chain and a subsequent initiating H2 capture chain.
[0009] After the addition of a pH-locking chain to the DON-HCR, the pH-locking chain binds to the pH-responsive chain and the "tube-locking chain" on the DON-HCR structure, forming a rectangular tube at 45°C to create a DNA tubular origami structure with pH-responsive function, which is the signal amplification nanodevice of the present invention.
[0010] Technical Principle: The nanodevice described in this invention achieves organ targeting through the biomimetic cell membrane's inherent biological tropism and enters the target cell via membrane fusion and endocytosis. The pH-responsive chain consists of an i-motif sequence rich in cytosine (C). This sequence maintains a stable double strand at normal physiological pH (~7.4), keeping the tubular structure closed and isolating the internal hairpin. When the device is enriched in the acidic pathological microenvironment of tumors or inflammatory sites, at pH 6.5~6.8, a quadruplex structure is formed between cytosine and protonated cytosine, preventing the formation of a stable hybrid double strand. This causes the tubular structure to open, exposing the H1 hairpin recognition sequence and triggering a subsequent target-dependent cascade hybridization chain reaction, achieving spatiotemporally controllable signal amplification.
[0011] Preferably, the initiating H1 capture chain sequence is SEQ ID NO.1~2, the subsequent H2 capture chain sequence is SEQ ID NO.3~16, the H2 capture chain sequence is SEQ ID NO.17~32, the pH response chain sequence is SEQ ID NO.33~38, the pH locking chain sequence is SEQ ID NO.63, the H1-initial hairpin chain sequence is SEQ ID NO.59, the subsequent H1 hairpin chain sequence is SEQ ID NO.60, the H2 hairpin chain sequence is SEQ ID NO.61, and the locking tube chain sequence is SEQ ID NO.39~44.
[0012] Preferably, the assembly conditions for the DNA rectangular origami are: a constant temperature of 95°C for 3 minutes, followed by an assembly at 0.1°C for 2 seconds. -1 The annealing rate was reduced to 25°C, and the entire annealing process took about 2 hours.
[0013] Preferably, the H1 hairpin strand, H2 hairpin strand, and DNA rectangular origami are assembled by base complementarity by annealing together in a water bath at 45°C for 12 hours.
[0014] Preferably, the cell membrane nanovesicles are uniformly sized vesicles obtained from erythrocytes, macrophages, or tumor cells through ultrasonic disruption, differential centrifugation, and membrane filtration. These signal amplification nanodevices can be directly encapsulated using a physical extrusion method to fabricate the spatially tunable signal amplification nanoassembly described in this invention. This spatially tunable signal amplification nanoassembly is a membrane-encapsulated structure that retains the natural targeting properties of the cell membrane, enabling specific recognition and enrichment.
[0015] A second aspect of the present invention provides a method for fabricating the spatially tunable signal amplification nanodevice, comprising the following steps:
[0016] The cell membranes of erythrocytes, macrophages, or tumor cells were washed three times with 0.1×PBS to rupture the cells, centrifuged at high speed for 5 minutes, and finally centrifuged three times with 1×PBS for 5 minutes each. The resulting solution was centrifuged at low speed for 5 minutes to remove large particles and stored at 4°C. The resulting vesicles of varying sizes were filtered through a filter to obtain vesicles with a diameter of approximately 200 nm. The uniformly sized nanovesicles were then fused with DNA nano-origination carriers through physical extrusion. Preferably, the physical extrusion procedure included: loading the mixture of cell membrane vesicles and DNA nano-origination carriers into a 10 ml syringe, connecting it to a 0.45 μm filter, and manually pushing the syringe to repeatedly pass the mixture through the filter membrane 3-5 times. During this process, the membrane structure ruptured and recombined under shear force, thereby completely encapsulating the DNA nano-origination carriers to form the cell membrane-encapsulated intelligent signal amplification nanodevice, i.e., the spatially tunable signal amplification nanocomponent.
[0017] A third aspect of this invention provides the application of the spatially tunable signal amplification nanocomponent in the preparation of reagents for targeted detection of bioactive molecules, including nucleic acid molecules, protein molecules, and peptide molecules. When the target molecule is a protein or peptide, by coupling an antibody or nucleic acid aptamer capable of specifically recognizing the target molecule to a reporter nucleic acid sequence, wherein the reporter nucleic acid sequence is partially complementary to the recognition region of the H1 hairpin strand, the target binding event is transformed into a triggering event on the H1 hairpin strand.
[0018] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0019] Existing DNA signal amplification technologies typically employ an always-on design, where the detection system continuously initiates the amplification process upon contact with the target, making precise control in both time and space impossible and limiting the accuracy of molecular imaging. To address this, this invention, based on structured DNA sequence design, constructs an environmentally responsive signal amplification module. By introducing an activatable hairpin switch, the system can initiate signal amplification according to a preset timing sequence under the guidance of specific pathological factors or external physical signals, thus solving the key technical bottleneck of dynamic control in traditional methods. Addressing the difficulty of precise localization in traditional DNA signal amplification technologies due to biological barriers and complex microenvironments, this invention constructs a spatially tunable signal amplification nanocomponent integrating a trigger-type signal amplification unit and nanovesicle targeting functionality through self-assembly technology. This design not only utilizes the inherent targeting properties of nanovesicles to achieve active delivery to specific cells and tissues, overcoming the bottleneck of spatial localization, but also establishes spatially controllable capabilities from organ targeting to cell localization through the synergy of multi-level response modules.
[0020] To address the shortcomings of existing molecular imaging techniques in terms of sensitivity and spatiotemporal specificity, which hinders the accurate capture of key biomarkers in pathological processes, this invention develops a spatiotemporally selective signal amplification nanodevice based on nanovesicles. For example, leveraging the excellent targeting properties of nanovesicles, this device can efficiently accumulate in the lungs, enabling precise imaging and highly sensitive detection of biomarkers related to infectious pneumonia. Attached Figure Description
[0021] Figure 1 This is a diagram showing the changes during the construction and detection of the spatially tunable signal amplification nanocomponent described in this invention;
[0022] Figure 2 These are atomic force microscopy images of the DNA rectangles and nanotubes in Example 1.
[0023] Figure 3 This is an atomic force microscope image of the DNA rectangle and the DNA rectangle with a hairpin mounted in Example 1;
[0024] Figure 4 This is a graph showing the agarose gel electrophoresis results from Example 1;
[0025] Figure 5a This refers to the state of the free hairpin probe and its anchoring target chain used in Example 2;
[0026] Figure 5b The origami structure load hairpin probe, i.e., the rectangular DON-HCR, and its anchoring target chain in Example 2 are shown.
[0027] Figure 6a This is a transmission electron microscope image of erythrocytes in Example 3;
[0028] Figure 6b This is a random optical reconstruction microscopy image of erythrocytes in Example 3;
[0029] Figure 7 The image shows the zeta potential and particle size of erythrocytes in Example 3;
[0030] Figure 8 This is a graph showing the results of sodium dodecyl sulfate polyacrylamide gel electrophoresis of erythrocytes in Example 3;
[0031] Figure 9a This is a transmission electron microscope image of macrophages in Example 4;
[0032] Figure 9b This is a random optical reconstruction microscopy image of macrophages in Example 4;
[0033] Figure 10 The image shows the Zeta potential and particle size of macrophages in Example 4.
[0034] Figure 11This is a graph showing the results of sodium dodecyl sulfate polyacrylamide gel electrophoresis of macrophages in Example 4;
[0035] Figure 12a This is a transmission electron microscope image of B16 cells in Example 5;
[0036] Figure 12b This is a random optical reconstruction microscopy image of B16 cells in Example 5;
[0037] Figure 13 Zeta potential and particle size distribution of B16 cells in Example 5;
[0038] Figure 14 This is a graph showing the sodium dodecyl sulfate polyacrylamide gel electrophoresis results of B16 cells in Example 5;
[0039] Figure 15 This is a graph showing the stability differences in the simulated physiological environment in Example 6;
[0040] Figure 16 This is a graph showing the anti-degradation performance in a DNase environment as described in Example 7;
[0041] Figure 17a This is an in vivo imaging of the 4T1 tumor cell membrane homology-targeted mouse in Example 8, completed at a time point of 24 hours.
[0042] Figure 17b for Figure 17a The fluorescence quantitative histogram;
[0043] Figure 18 This is a fluorescence imaging image of a mouse organ homologous to 4T1 tumor cell membranes in Example 8;
[0044] Figure 19 This refers to the 4T1 tumor cell membrane homologous targeted tumor section from Example 8;
[0045] Figure 20 This is a diagram of macrophages phagocytizing origami encapsulated in erythrocyte nanocapsules in Example 9;
[0046] Figure 21a This is an in vivo fluorescence imaging image of a mouse with erythrocyte nanovesicle spleen targeting at an 8-hour time point, as shown in Example 10.
[0047] Figure 21b for Figure 21a The corresponding quantitative fluorescence chromatogram;
[0048] Figure 22a This is a fluorescence imaging image of mice taken at the 8-hour time point in Example 11;
[0049] Figure 22b for Figure 22aThe fluorescence quantitative histogram;
[0050] Figure 23a To obtain fluorescence distribution images of isolated tissues by repeating fluorescence scanning with the in vivo imaging system in Example 11;
[0051] Figure 23b for Figure 23a The fluorescence quantitative histogram;
[0052] Figure 24 This is a flowchart simulating the hybridization chain reaction (HCR) of the free hairpin probe in Example 2. Detailed Implementation
[0053] The present invention will be further described below with reference to the accompanying drawings and specific embodiments to enable those skilled in the art to better understand and implement the invention, but the embodiments described are not intended to limit the invention. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the specification of the invention is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.
[0054] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, and the materials and reagents used are commercially available.
[0055] The specific design and source of the sequences involved in the following embodiments are shown below:
[0056] In the following embodiments, the M13 backbone chain used in the assembly of the DNA rectangular origami is the M13mp18 circular DNA backbone chain, and the M13mp18 is mixed with the required rectangular staple chain at a molar ratio of 1:8. The sequence of the M13mp18 circular DNA backbone chain was purchased from BioBio, and the specific sequence is the 7249bp sequence disclosed in GenBank Accession #: X02513. The sequence of the staple chain in the rectangular staple chain is the sequence disclosed in the literature Supporting Information of Bifacial DNA origami-directed discrete, three-dimensional, anisotropic plasmonic nanoarchitectures with tailored optical chirality.
[0057] In the following embodiments, the intermediate products of Cy5-labeled DON or DNA nanotubes used for fluorescence characterization in the experimental stage employ a Cy5 trapping chain to capture T-Cy5; however, the signal amplification nanodevices of this application are characterized using the Cy5 fluorescent group in the H2 hairpin chain. Therefore, the assembly of the DNA rectangular origami used to fabricate the intermediate products of Cy5-labeled DON or DNA nanotubes in the following embodiments requires replacing the original staple chains with the following H1 trapping chain, H2 trapping chain, pH-responsive chain, locking chain, and Cy5 trapping chain, respectively. The assembly of the DNA rectangular origami used to fabricate the signal amplification nanodevices requires replacing the original staple chains with the following H1 trapping chain, H2 trapping chain, pH-responsive chain, and locking chain, without replacing the original staple chains with the Cy5 trapping chain, directly utilizing the fluorescent group in the H1H2 hairpin.
[0058] It should be noted that the following sequences are all described in the order of 5'→3'; the "sequences used for capture" involved in all types of rectangular staple chains below are segments that did not participate in the origami assembly, and these segments are free on the surface of the DNA rectangular origami assembly structure when the DNA rectangular origami is completed;
[0059] The sequences that initiate the H1 capture chain are shown in SEQ ID NO. 1~2 below, wherein the sequence used for capture is the sequence shown in the first 24 bases:
[0060]
[0061] The sequences of the H2 capture chain are shown in SEQ ID NO.3~16, where the sequence used for capture is the sequence shown in the first to second 24 bases:
[0062]
[0063] The sequences of the H2 capture chain are shown in SEQ ID NO.17~32, wherein the sequence used for capture is the sequence shown in bases 33 to 56:
[0064]
[0065] The sequences of the pH-responsive chain are shown in SEQ ID NO. 33~38, wherein the sequence used to bind the pH-locking chain is the sequence shown in the first 17 bases:
[0066]
[0067] The locking chain sequences are shown in SEQ ID NO.39~44, wherein the sequence used for binding the pH-locking chain is shown in bases 41~57:
[0068]
[0069] The sequences of the Cy5 capture strand are shown in SEQ ID NO.45~58, where the sequence used for capture is the sequence shown in the first to 15 bases:
[0070]
[0071] The sequence of the H1-initial hairpin chain is shown in SEQ ID NO. 59 below: The sequence of the extended arm chain is shown in the first 24 bases:
[0072] SEQ ID NO.59: CTAACCTTGGGTCTCAGACATTCTTCAACATCAGTCTGATAAGCTACCTCTCTAGCTTATCAGACTGA;
[0073] The sequence of the H1 hairpin chain is shown in SEQ ID NO.60, and the sequence of the extended arm chain is shown in the sequence of the first to 24 bases:
[0074] SEQ ID NO.60: GTTCCTCTAAACACGTTGGGATGGGGTCGTTCAGTCTGATAAGCTACCTCTCTAGCTTATCAGACTGA;
[0075] The sequence of the H2 hairpin chain is shown in SEQ ID NO.61 below. The sequence of the extended arm chain is shown in the sequence of bases 45 to 68. The 8th base is the fluorescent quencher linkage site, and the 30th base is the Cy5 linkage site.
[0076] SEQ ID NO.61: TAGCTTAT(-BHQ2)CAGACTGAACGACCTCAGTCTG(-Cy5)ATAAGCTAGAGAGGCGTAGTTTCAAGCGCAGCCAGATT
[0077] The following examples use miRNA 21 as the target strand, the sequence of which is shown in SEQ ID NO.62:
[0078] SEQ ID NO.62: TAGCTTATCAGACTGATGTTGA;
[0079] The sequence of the pH-locking chain is shown in SEQ ID NO.63 below.
[0080] SEQ ID NO.63: CTATATCCCCTTACCCCTTACCCCTTACCCCCTATAT;
[0081] The sequence of T-Cy5 is shown in SEQ ID NO.64 below.
[0082] TTTTTTTTTTTTTTTTTTTT;
[0083] Example 1: Synthesis and Characterization of Signal Amplification Nanodevices
[0084] In this Example 1, the method for fabricating the signal amplification nanodevice with the above-mentioned nucleic acid chain as the main component is as follows:
[0085] Step S1: Mix the M13mp18 circular DNA backbone strand with the desired rectangular staple strand at a molar ratio of 1:8. The rectangular staple strand includes a portion of the original staple strand and H1 capture strand, H2 capture strand, pH-responsive strand, and locking strand that replace the original staple strand. The mixing system is 100 μL of 1×TAE-Mg. 2+ Buffer solution (containing 40 mM Tris, 2 mM Na2EDTA·2H2O, 12.5 mM Mg) 2+ (pH 8.0). After thorough mixing, the mixture was placed in a PCR instrument for annealing: first, it was held at 95°C for 3 minutes, then slowly cooled to 25°C at a rate of 0.1°C every 10 seconds, with the entire annealing process lasting approximately 2 hours. After annealing, the sample was purified using a 100 kDa ultrafiltration device with a molecular weight cutoff of 100 kDa, and then purified with 1×PBS-Mg... 2+ To remove unbound short DNA strands, the DNA was ultrafiltered three times at 3000 g centrifugation, with each centrifugation lasting 10 minutes, to remove the replacement buffer. The resulting purified DNA rectangular origami paper, or rectangular DON, served as the molecular platform for subsequent signal amplification analysis.
[0086] Step S2: Mix H1 hairpin strand, H2 hairpin strand, and DNA rectangular origami at a molar ratio of 20:1. Place the well-mixed sample in a water bath for annealing at 45℃ to 25℃ at a rate of 1℃ for 10 min. -1 After overnight annealing, rectangular DON-HCRs were prepared.
[0087] Step S3: Six pairs of pre-assembled pH-locked strands were mixed with rectangular DON-HCR at a molar ratio of 40:1. The mixture was then placed in a PCR instrument and subjected to an annealing program: starting at 45°C, the temperature was decreased to 25°C at a rate of 1°C every 5 minutes, and this cooling process was repeated 5 times to obtain the product DNA nanotubes, which serve as signal amplification nanodevices.
[0088] Atomic force microscopy characterization: The synthesized rectangular DON, rectangular DON-HCR, and DNA nanotubes were diluted to 2 nM, and 5-10 μL samples were added to clean mica sheets and allowed to adsorb for 3 min. Atomic force microscopy was used for observation and analysis, and the results are as follows: Figure 2 and Figure 3 As shown;
[0089] Figure 2 Figure (a) shows a field of view of an atomic force microscope (AFM) image of a DNA rectangular origami sample; Figure (b) shows a field of view of an AFM image of a DNA nanotube sample; and Figure (c) is a comparison of the height changes of the rectangular DON and DNA nanotubes in the field of view observed in Figures (a) and (b).
[0090] Figure 3 Figure (a) shows a field of view of a rectangular DON sample observed by atomic force microscopy; Figure (b) shows a field of view of a rectangular DON-HCR sample observed by atomic force microscopy; Figure (c) is a comparison of the height changes of rectangular DON and rectangular DON-HCR in the field of view observed by Figures (a) and (b), and the synthesized DON-HCR shows a uniform size distribution.
[0091] Agarose gel electrophoresis: The assembly of rectangular DONs and rectangular DON-HCRs was characterized by 1% agarose gel electrophoresis. 20 μL of each sample (6 nM concentration) was mixed with 1.5 μL of 6× loading buffer and loaded onto an agarose gel pre-stained with 0.01% GelRed solution. Electrophoresis was performed at 100 V in 1×TAE buffer for 1.5 h. The 1×TAE buffer consisted of 40 mM Tris, 2 mM Na₂EDTA·2H₂O, and 12.5 mM Mg²⁺. 2+ The composition was determined, and the pH was 8.0; subsequently, imaging was performed using a GenoSens 1850 UV gel imaging system (Clinx Science Instruments), such as... Figure 4 The results show that the band migration rate of the rectangular DON-HCR sample is significantly lower than that of the rectangular DON sample, confirming that the H1 and H2 hairpin strands have been successfully and precisely anchored to the surface of the DNA nano-origami carrier through base complementary pairing, forming a larger and more complex rectangular DON-HCR complex.
[0092] Example 2: Spatiotemporal Selective Signal Amplification of DON-HCR
[0093] like Figure 24As shown, to evaluate the difference in signal amplification efficiency between free hairpin probes and origami-structured hairpins, a hybridization chain reaction (HCR) between H1 and H2 was triggered using a 50 nM target strand, namely the aforementioned Target (miRNA 21) strand. Cy5 fluorescence intensity changes were detected using a microplate reader in the wavelength range of 650–700 nm. Signal acquisition was performed after incubating the reaction system for 1 hour following the addition of the target strand. In the comparative experiment, Figure 5a To determine the state of use of the free hairpin probe and its anchoring target chain, Figure 5b The state of the hairpin probe, namely the rectangular DON-HCR, and its anchoring target chain, was determined by loading a paper-fold structure. The total concentrations of H1 and H2 were controlled by appropriate dilution to ensure an equal total number of hairpins in the reaction system. Subsequently, the local HCR process induced by the target chain was monitored according to a standardized procedure. The results showed that the rectangular DON-HCR achieved a 9.4-fold signal amplification.
[0094] Example 3: Synthesis and characterization of red blood cell nanovesicle-based components
[0095] Synthesis of erythrocyte nanovesicles: Whole blood (C57 BL / 6 erythrocytes) was collected from the orbital rimus and treated with 10×EDTA anticoagulant at the appropriate concentration. The whole blood was centrifuged at 500 g and 4°C for 5 min to remove serum and the yellow layer, then washed twice with 1×PBS. Hemolysis: The cells were washed once with 0.1×PBS (3-5 min), centrifuged at 13500 rpm for 5 min at 4°C, and then hemolyzed with 0.1×PBS for 30-60 min, sonicated for 3-5 min, washed three times with 0.1×PBS, centrifuged at 13500 rpm for 5 min at 4°C, and then re-blocked. The cells were washed once with 10×PBS, centrifuged at 13500 rpm for 5 min at 4°C, and then incubated with 10×PBS for 1 hour. Finally, the cells were washed three times with 1×PBS, centrifuged at 13500 rpm for 5 min at 4°C, and sonicated for 5 min. The resulting solution was then centrifuged at 4000 rpm and 4°C for 5 min to remove large particles, yielding erythrocyte nanovesicles (RBC-V), which were stored at 4°C. The difference between the fabrication of the DNA nanotube origami structure used in this embodiment and the synthesis of the signal amplification nanodevice in Example 1 is only that: in step S1, the rectangular staple chain used in the assembly of the DNA rectangular origami is replaced with a Cy5 capturing chain to replace part of the original staple chain, while the other raw materials and operations are the same; and the operation in step S2 is omitted, and the DNA nanotubes, i.e., tubular DONs, are formed directly in step S3; the preparation of the Cy5-labeled DNA nanotube origami structure is to use the above-mentioned tubular DON origami with a concentration of 5 nM, anneal at 45°C for 3 h, and then attach Cy5 for fluorescence characterization. The fluorescence position of the origami determines that the origami is wrapped in vesicles. First, DIO working solution is added to RBC-V, the light is blocked for 20-30 minutes, and then it is rinsed twice with 1×pbs. After filtration through a filter head, tubular DON@RBC-V is formed.
[0096] Component synthesis: The obtained erythrocyte nanovesicles were mixed with pre-synthesized Cy5-labeled DNA nanotube origami structures at a 1:1 mass ratio. The vesicle membranes were then resealed and completely encapsulated within the tubular DNA origami structure using a physical extrusion method (0.45 μm filter) to form a tubular DON@RBC-V complex. Specifically, 1 mg / ml of vesicle suspension was mixed with an equal volume of 5 nM Cy5-labeled DNA tubular origami, filtered through a 0.45 μm filter, and incubated at room temperature for 1 hour to allow the tubular DNA origami and vesicles to fully fuse.
[0097] Transmission electron microscopy characterization: DON@RBC-V filtered through a filter head was centrifuged at 13000 rpm. 10 μl of the centrifuge solution was added to a copper mesh, allowed to air dry, and then observed and analyzed using a transmission electron microscope. Results are as follows: Figure 6a As shown, from left to right, are transmission electron microscope images of the structures of tubular DON, RBC-V (red blood cell nanovesicles), and tubular DON@RBC-V.
[0098] Random optical reconstruction microscopy characterization: 10 μL of the tubular DON@RBC-V sample prepared in this embodiment was dropped onto a glass slide and imaged using a random optical reconstruction microscope (Storm). Figure 6b As shown in the figure, the synthesized tubular DON@RBC-V exhibits a uniform distribution.
[0099] Nanoparticle size and Zeta potential measurement instrument characterization: Prepare tubular DON, RBC-V, and tubular DON@RBC-V with a concentration of 5 nmol. First, clean the quartz cuvette with 1 ml of PBS. Take an appropriate amount (about 1 ml of ultrapure water) and pour it into a clean quartz cuvette. Then add 20 μl of sample, place the cuvette in the sample compartment of the instrument, and measure the particle size three times and take the average value. Zeta potential measurement: Use a pipette to take an appropriate amount (about 0.8 ml of ultrapure water) and pour it into a clean quartz cuvette. Then add 20 μl of sample, place the cuvette in the sample compartment of the instrument, start the measurement program, and automatically measure each sample three times continuously. Figure 7 Figures a and b in the diagram show the particle size distribution of tubular DON, RBC-V, and DON@RBC-V. Figure 7 Figure c in the figure shows the Zeta potential characterization results. This indicates that a DNA nanodevice coated with a erythrocyte membrane was successfully constructed. Its hydrated particle size is significantly larger than that of free DNA origami and is consistent with the size range of erythrocyte vesicles. At the same time, the surface Zeta potential value of this complex is close to the negative potential characteristic of RBC-V, and is significantly different from DON.
[0100] SDS-PAGE gel chromatography analysis: Prepare tubular DON, erythrocyte nanocapsules (RBC-V), and erythrocyte nanovesicles encapsulated in origami paper (i.e., tubular DON@RBC-V) at a concentration of 5 nmol. Prepare a 5% upper gel and an 8% lower gel. Figure 8 From left to right, the samples are: DNA Marker (10-250 bp) purchased from Takara Bio, RBC-V, tubular DON, and tubular DON@RBC-V. An 8% SDS-PAGE gel was used. The upper gel was run at 70 V for 30 min. After the samples were transferred from the upper to the lower gel, the temperature was increased to 110 V for 80 min. After running, the gel was heated with ultrapure water for two minutes and washed three times. Finally, Prussian blue was added for staining. Based on the principle that the sample migration rate decreases with increasing molecular weight in SDS-PAGE gel electrophoresis, the protein content can be determined. The lanes of erythrocyte membrane vesicles showed multiple clear protein bands; while the lanes of purified tubular DON showed no obvious protein bands. The protein band pattern of the complex tubular DON@RBC-V was basically consistent with that of RBC-V. The results showed that during the preparation of tubular DON@RBC-V by physical extrusion, the natural protein components of the erythrocyte membrane were effectively preserved and successfully transferred to the surface of the complex, indicating that the nanodevices inherited the biological functions of the erythrocyte membrane.
[0101] Example 4: Synthesis and characterization of macrophage-based nanovesicle components
[0102] Macrophage culture and activation: Macrophages were cultured in DMEM medium containing 10% fetal bovine serum in a 37℃, 5% CO2 incubator. When the cells grew to a density of 80%~90%, the medium was discarded, and the cells were gently washed 2-3 times with phosphate-buffered saline (PBS). The cells were then scraped off with a cell scraper, centrifuged and collected, and resuspended and washed twice with PBS.
[0103] Ultrasonic cell disruption: Resuspend the cell pellet in pre-cooled disruption buffer and place it in an ice-water bath. Use an ultrasonic cell disruptor (300 W power, operating mode: 3 seconds of sonication followed by 5 seconds of intermittent sonication) for a total duration of 3-5 minutes, until the solution changes from turbid to slightly translucent.
[0104] Vesicle isolation and purification: The lysate after sonication was first centrifuged at 2000×g for 10 minutes to remove unbroken intact cells and nuclear precipitate. Then the supernatant was transferred to an ultracentrifuge tube and centrifuged at 130,00×g for 10 minutes at 4℃. The precipitate was collected as the obtained macrophage nanovesicles M1-V. Finally, it was resuspended in sterile PBS or physiological saline and stored at 4℃ or used immediately.
[0105] In Example 4, tubular DONs were prepared in the same manner as in Example 3. The obtained M1-type macrophage nanovesicles were mixed with Cy5-labeled tubular DONs at a mass ratio of 1:1. The vesicle membranes were resealed and the tubular DONs were completely encapsulated by physical extrusion (0.45 μm filter head) to form DON@M1-V complex.
[0106] The same transmission electron microscopy characterization, random optical reconstruction microscopy characterization, nanoparticle size and zeta potential measurement instrument characterization, and SDS-PAGE gel chromatography analysis methods as in Example 3 were used. Figure 9a Transmission electron microscopy (TEM) images of tubular DON, M1-V, and tubular DON@M1-V. Figure 9b Random optical reconstruction microscopy characterizations of tubular DON, M1-V, and tubular DON@M1-V. Figure 10 Figures a and b in the diagram show the particle size distribution of tubular DON, M1-V, and tubular DON@M1-V. Figure 10 Figure c in the diagram shows the Zeta potential characterization results, indicating the successful construction of a macrophage membrane-coated DNA nanodevice. Figure 11 Samples numbered 1-3 are SDS-PAGE gel chromatography analyses of tubular DON, M1-V, and tubular DON@M1-V, respectively. This indicates that during the physical extrusion preparation of DON@RBC-V, the natural protein components of the macrophage membrane were effectively preserved and successfully transferred to the surface of the complex, demonstrating that the nanodevice inherits the biological functions of the macrophage membrane.
[0107] Example 5: Synthesis and Characterization of Signal Amplification Nanoassemblies Based on B16 Tumor Cell Nanovesicles
[0108] B16 Cell Culture and Activation: B16 cells were cultured in DMEM medium containing 10% fetal bovine serum at 37℃ and 5% CO2. When the cell density reached 80%-90%, the medium was discarded, and the cells were gently washed 2-3 times with pre-chilled phosphate-buffered saline (PBS). Cells were then scraped off with a cell scraper, centrifuged, and resuspended twice with calcium- and magnesium-free PBS. Ultrasonic Cell Disruption: The cell pellet was resuspended in pre-chilled disruption buffer and placed in an ice-water bath. The cells were then disrupted using an ultrasonic cell disruptor (300W power). W, Working method: Sonication for 3 seconds, followed by a 5-second interval, for a total duration of 3-5 minutes, until the solution changes from turbid to slightly translucent; Vesicle separation and purification: The lysate after sonication is first centrifuged at 2000×g for 10 minutes to remove unbroken intact cells and nuclear precipitate. Then, the supernatant is transferred to an ultracentrifuge tube and centrifuged at 13000×g at 4℃ for 10 minutes. The precipitate is collected as the obtained B16 cell nanovesicles. Finally, it is resuspended in sterile PBS or physiological saline and stored at 4℃ or used immediately.
[0109] In Example 5, tubular DON was prepared in the same manner as in Example 3. The obtained B16 tumor cell nanovesicles were mixed with Cy5-labeled tubular DON at a mass ratio of 1:1. The vesicle membrane was resealed and the tubular DON was completely encapsulated by physical extrusion (0.45 μm filter head) to form DON@B16-V complex.
[0110] Figure 12a Transmission electron microscopy (TEM) images of tubular DON, B16-V, and tubular DON@B16-V. Figure 12b Random optical reconstruction microscopy characterization images of tubular DON, B16-V, and tubular DON@B16-V. Figure 13 Figures a and b in the diagram show the particle size distribution of tubular DON, B16-V, and tubular DON@B16-V. Figure 13 Figure c in the diagram shows the Zeta potential characterization results, indicating the successful construction of DNA nanodevices coated with B16 tumor cell membranes. Figure 14 Samples numbered 1-3 are SDS-PAGE gel chromatography analyses of tubular DON, B16-V, and tubular DON@B16-V, respectively. The results show that during the physical extrusion preparation of tubular DON@B16-V, the natural protein components of the B16 tumor cell membrane were effectively preserved and successfully transferred to the surface of the complex, indicating that the nanodevice inherits the biological functions of the B16 tumor cell membrane.
[0111] Example 6: Stability assessment of DNA origami in a serum environment
[0112] To evaluate the differences in stability between DNA origami and its complex encapsulated with functional nanovesicles in a simulated physiological environment, Example 6 uses macrophage nanovesicles as an example. Specifically, the macrophage nanovesicles were obtained according to the macrophage preparation method described in Example 4. Then, following the same labeling method as in Example 3 for Cy5-labeled DON, the DNA nanotubes from Example 1 were labeled with Cy5 to prepare Cy5-labeled DON-HCR. The obtained M1-type macrophage nanovesicles were mixed with Cy5-labeled DON-HCR at a 1:1 mass ratio, and the vesicle membranes were resealed and completely encapsulated using a physical extrusion method (0.45 μm filter) to form the DON-HCR@M1-V complex.
[0113] The Cy5-labeled DON prepared in Example 3 and the Cy5-labeled DON-HCR@M1-V from Example 6 were placed in a buffer solution containing 10% fetal bovine serum (FBS) and incubated at 37°C. Samples were taken at preset time points of 0.5 hours, 1 hour, 6 hours, 12 hours, and 24 hours. Fluorescence measurements were performed on the imaging instrument stage, and the percentage of intact DNA origami retained was quantitatively calculated using software. Figure 15 As shown, in a serum-containing environment, the structural integrity of the DON-HCR@M1-V group at each time point was significantly higher than that of the free DON group, and the stability was improved by 9.85 times, proving that functional nanovesicles can effectively protect DON-HCR origami from degradation by nucleases in serum.
[0114] Example 7: Degradation resistance test of DNA origami in a DNase environment
[0115] This embodiment uses random optical reconstruction microscopy to test the anti-degradation performance of DNA origami and its nanovesicle encapsulation complex in a DNase environment. Purified Cy5-labeled DON and Cy5-labeled DON-HCR@M1-V were prepared. 10 μl samples were added to a clean coverslip and allowed to stand at room temperature for 5 minutes to allow nanoparticle adsorption. Excess liquid was carefully blotted away with filter paper. An enzyme degradation environment was constructed by adding a buffer solution containing DNase I, and a DON buffer solution without DNase was used as a control. Serial imaging of the samples was performed using Storm at a constant temperature of 37°C. Figure 16 As shown, under DNase treatment conditions, the fluorescence signal of the free DON group decayed rapidly with prolonged incubation time, while the DON-HCR@M1-V group maintained a strong fluorescence intensity throughout the observation period, and the signal decay rate was significantly slowed down.
[0116] Example 8: Homologous Targeting Assay for 4T1 Tumor Cells
[0117] To evaluate the homologous targeting ability of 4T1 tumor cells, free (near-infrared fluorescent dye), Cy5-labeled DON at a concentration of 5 nM and Cy5-labeled DON@4T1-V prepared according to the method in Example 1 were prepared. 4T1 cells were cultured in DMEM containing 10% fetal bovine serum and 1% P / S under standard conditions (5% CO2, 37°C). 4T1 cells in good growth condition were collected, resuspended in PBS, and the cell density was adjusted to 1 × 10⁶ cells / year. 6 Cells / mL. A 4T1 mouse tumor model was constructed by subcutaneously inoculating 4T1 tumor cells (2 x 10⁻⁶ cells / mL). 6 (Number of cells) in the lateral dorsal region of BALB / c mice. When the tumor volume reaches 200 mm... 3 100 μl of Free (near-infrared fluorescent dye), Cy5-labeled DON, and Cy5-labeled DON@4T1-V were intravenously injected into 4T1 tumor-bearing mice. Nine tumor-bearing mice were randomly divided into three groups of three: Group 1 (Free group): Free DIR in PBS solution was injected via tail vein (DIR dose consistent with the nano-formulation group). Group 2: Cy5-labeled DON at a concentration of 5 nM was injected via tail vein. Group 3 (DIR@4T1-V group): Cy5-labeled DON@4T1-V solution was injected via tail vein. At each predetermined time point (1, 2, 4, 8, 12, and 24 hours post-injection), 15 μl of anesthetic was injected intraperitoneally into the mice. Hair removal cream was used to remove hair from the abdominal and back areas of the mice to eliminate interference from the fluorescence signal. The anesthetized mice were placed prone on the imaging instrument sample stage, maintaining a fixed posture. Figure 17a For live imaging completed within 24 hours, Figure 17b For quantitative fluorescence bar graphs. Mice were sacrificed under anesthesia after 24 hours. Tumors and major organs (heart, liver, spleen, lung, and kidney) were collected for in vitro imaging. The organs were gently rinsed with PBS. The organs were then neatly arranged in culture dishes. Figure 18 To obtain fluorescence distribution images of isolated tissues, a small animal in vivo imaging system was used to perform another fluorescence scan. Figure 19The above results show fluorescence imaging of tumor sections. As demonstrated, compared to free DIR dye and uncoated Cy5-labeled DON, Cy5-DON@4T1-V coated with 4T1 tumor cell membranes exhibited significant homologous targeting and tumor accumulation in tumor-bearing mice. Its in vivo fluorescence imaging signal continuously enhanced at the tumor site, reaching a peak at 24 hours. Ex vivo organ imaging further confirmed its strongest specific accumulation in tumor tissue, while non-specific uptake by the reticuloendothelial system in organs such as the liver and spleen was significantly reduced. Fluorescence imaging of tumor sections clearly showed the widespread distribution of Cy5-labeled DON@4T1-V within the tumor region. These results demonstrate that the cell membrane coating strategy effectively endows nanodevices with precise targeting capabilities, overcoming the non-specific distribution problem of traditional nanodelivery systems.
[0118] Example 9 Macrophage Uptake Efficiency Test
[0119] To evaluate the selective uptake efficiency of erythrocyte nanovesicles by macrophages, DON, DON@RBC-V, and DON and Cy5 were prepared according to the method in Example 1. DON and Cy5 were annealed at 45°C for three hours in a water bath and then ligated to 25°C. Cy5-labeled DNA was used to fold paper in two groups of samples. Macrophages were cultured according to the method in Example 4, with three confocal culture dishes for each group. Flow cytometry was used to detect the phagocytosis of different materials, and laser confocal microscopy was used to study the phagocytosis of macrophages after 6 hours of co-incubation. The results are as follows: Figure 20 As shown, where, Figure 20 The confocal images of macrophages co-incubated with different materials for 6 hours show that the DNA origami encapsulated by erythrocyte nanovesicles has a better macrophage phagocytic effect than free DNA origami.
[0120] Example 10 Spleen Targeting Test
[0121] To evaluate the spleen-targeting ability of senescent / damaged erythrocyte nanovesicles, Cy5-labeled DON and Cy5-labeled DON@4T1-V were prepared according to the method in Example 1. Six BALB / c mice were injected with 100 μl of the sample via the tail vein. The six tumor-bearing mice were randomly divided into two groups of three: Group 1: DON solution was injected via the tail vein; Group 2: DON@4T1-V solution was injected via the tail vein. At each predetermined time point (0.5, 1, 2, 4, 6, and 8 hours after injection), 15 μl of anesthetic was injected intraperitoneally into the mice. Hair removal cream was used to remove hair from the abdominal and back areas of the mice to eliminate interference from the fluorescence signal. The anesthetized mice were placed prone on the imaging instrument stage, maintaining a fixed posture. Figure 21a For live imaging completed at an 8-hour time point, Figure 21b for Figure 21aThe corresponding quantitative fluorescence image. Compared with free DON, DON@RBC-V, which is coated with erythrocyte membrane, exhibits rapid and significant spleen targeting in normal mice. Its in vivo fluorescence imaging signal is specifically enriched in the spleen region and continues to enhance for several hours after injection.
[0122] Example 11: Application of signal amplification imaging in a mouse lung LPS inflammation model
[0123] To evaluate the precise detection capability of intelligent signal amplification nanodevices for miRNA21 in a lung inflammatory environment, an acute lung inflammation model was established in mice by inducing LPS (10 mg / kg). Healthy C57BL / 6 mice were selected and divided into four groups: Control group, Free-HCR group injected with free Cy5-labeled H1 / H2 hairpin probes, DON-HCR group injected with DNA nanoparticles loaded with H1 / H2 hairpin probes, and DON-HCR@M1-V group injected with macrophage membrane-coated DNA nanoparticles loaded with signal amplification probes. The lung inflammation model was first established by intratracheal instillation of LPS (10 mg / kg), and 4 hours later, each group's formulation was injected via tail vein. Whole-body fluorescence imaging was performed at 1, 2, 4, and 8 hours post-injection using a small animal in vivo imaging system. Anesthetized mice were placed prone on the imaging stage to maintain a fixed posture. Figure 22a For live imaging completed at an 8-hour time point, Figure 22b for Figure 22a The fluorescence quantitative spectroscopy bar graph was obtained. Mice were euthanized under anesthesia after 12 hours, and major organs (heart, liver, spleen, lung, and kidney) were collected for in vitro fluorescence imaging. The organs were gently rinsed with PBS. Each organ was then neatly arranged in a culture dish. Figure 23a To obtain fluorescence distribution images of isolated tissues by performing a second fluorescence scan using a small animal in vivo imaging system, Figure 23b for Figure 23a The results showed that the DON-HCR@M1-V group exhibited the strongest fluorescence signal accumulation in the lung region, and the signal gradually increased over time. Ex vivo organ imaging showed that the fluorescence intensity in the lungs of this group was significantly higher than that in other organs, and the in vivo signal amplification intensity was 8.13 times higher than that of the Free-HCR group, indicating that macrophage membrane coating achieved effective lung targeting.
Claims
1. A spatially tunable signal amplification nanodevice, characterized in that, The signal amplification nanocomponent is constructed by encapsulating a signal amplification nanodevice with cell membrane nanovesicles. The cell membrane nanovesicles are used to achieve targeted delivery of the signal amplification nanocomponent. The signal amplification nanodevice is constructed based on DNA nanoorigami technology and has the ability to amplify signals when triggered by a target nucleic acid molecule such as miRNA21. The signal amplification nanodevice is a DNA tubular origami structure. The DNA tubular origami structure is formed by curling a rectangular DNA origami carrying the signal amplification structure through the regulation of pH-locking chains. The signal amplification structure is located inside the tubular structure of the DNA tubular origami structure. The DNA rectangular origami structure DON-HCR, which is a signal amplification load, is assembled from H1 hairpin chains, H2 hairpin chains, and DNA rectangular origami linked by complementary bases. The H2 hairpin chain contains a fluorescent quencher and a Cy5 fluorescent group. The H1 hairpin chain includes an initiating H1 hairpin chain and a post-initiating H1 hairpin chain. The initiating H1 hairpin chain (H1-initial) specifically recognizes the initiating H1 capture chain, and the post-initiating H1 hairpin chain specifically recognizes the post-initiating H2 capture chain. The signal amplification function is achieved jointly by the H1 and H2 hairpin chains. Upon detection of a target nucleic acid molecule, such as miRNA21, a hybridization chain reaction is triggered, initiating spatially regulated signal amplification. The DNA rectangular origami DON is obtained by annealing an M13 backbone chain and a staple chain. The rectangular staple chain includes a staple chain, an H1 capture chain, an H2 capture chain, a Cy5 capture chain, a pH-responsive chain, and a locking chain. The H1 capture chain includes an initiating H1 capture chain and a post-initiating H2 capture chain. After the addition of a pH-locking chain to the DON-HCR, the pH-locking chain binds to the pH-responsive chain and the locking chain on the DON-HCR structure, forming a rectangular tube at 45°C to create a DNA tubular origami structure with pH-responsive function, which is the signal amplification nanodevice of the present invention.
2. The spatially tunable signal amplification nanodevice as described in claim 1, characterized in that, The initiating H1 capture chain sequence is SEQ ID NO. 1~2, the subsequent H2 capture chain sequence is SEQ ID NO. 3~16, the H2 capture chain sequence is SEQ ID NO. 17~32, the pH response chain sequence is SEQ ID NO. 33~38, the pH locking chain sequence is SEQ ID NO. 63, the H1-initial hairpin chain sequence is SEQ ID NO. 59, the subsequent H1 hairpin chain sequence is SEQ ID NO. 60, the H2 hairpin chain sequence is SEQ ID NO. 61, and the locking tube chain sequence is SEQ ID NO. 39~44.
3. The spatially tunable signal amplification nanodevice as described in claim 1, characterized in that, The assembly conditions for the DNA rectangular origami are as follows: after being kept at 95℃ for 3 minutes, the assembly is carried out at 0.1℃ for 2 seconds. -1 The annealing rate was reduced to 25°C, and the entire annealing process took about 2 hours.
4. The spatially tunable signal amplification nanodevice as described in claim 1, characterized in that, The H1 hairpin strand, H2 hairpin strand, and DNA rectangular origami were assembled by base complementarity by annealing together in a 45°C water bath for 12 hours.
5. The spatially tunable signal amplification nanodevice as described in claim 1, characterized in that, The cell membrane nanovesicles are uniformly sized vesicles obtained from red blood cells, macrophages, or tumor cells through ultrasonic disruption, differential centrifugation, and membrane filtration. They can be directly encapsulated by physical extrusion to form the spatially tunable signal amplification nanoassemblies.
6. The method for fabricating the spatially tunable signal amplification nanodevice according to claim 1, characterized in that, Includes the following steps: The cell membranes of red blood cells, macrophages, or tumor cells were washed three times with 0.1×PBS to rupture the cells, centrifuged at high speed for 5 minutes, and then centrifuged three times at high speed for 5 minutes with 1×PBS. The resulting solution was centrifuged at low speed for 5 minutes to remove large particles and stored at 4°C. The resulting vesicles of different sizes were filtered through a filter to obtain vesicles with a diameter of 200 nm. The uniformly sized nanovesicles were fused with DNA nano-origination paper through physical extrusion.
7. The preparation method according to claim 6, characterized in that, The physical compression operation steps include: loading the mixed solution of the cell membrane vesicles and the DNA nano-origami carrier into a 10 ml syringe, connecting it to a 0.45 μm filter, and manually pushing the syringe to repeatedly pass the mixed solution through the filter membrane 3-5 times to completely encapsulate the DNA nano-origami carrier, forming the cell membrane-coated intelligent signal amplification nanodevice, namely the spatially tunable signal amplification nanoassembly.
8. The application of the spatially tunable signal amplification nanocomponent of claim 1 in the preparation of reagents for targeted detection of bioactive molecules.