Candida utilis and application thereof as well as protein feed and preparation method thereof
By using sulfur dioxide-resistant Candida utilis to degrade sugars and lactic acid in corn steep liquor, the problem of easy moisture absorption and clumping of corn steep liquor fermentation substrate was solved, enabling the preparation of low-sugar, low-viscosity protein feed, reducing production costs and improving product stability.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-30
- Publication Date
- 2026-04-07
AI Technical Summary
In the existing technology, when preparing Candida utilis protein using corn steep liquor as a fermentation base, the high sugar content, high lactic acid bacteria content, and high viscosity of the corn steep liquor cause the dry powder product to easily absorb moisture and clump, affecting the physical properties and storage and transportation of the product.
Fermentation was carried out using sulfur dioxide-tolerant Candida utilis (CGMCC No. 39065) to degrade monosaccharides, polysaccharides and lactic acid in corn steep liquor. The resulting protein feed had low sugar content, low viscosity and was not prone to moisture absorption or clumping.
This technology enables the preparation of protein feed using corn steep liquor as a fermentation base under low sugar, low lactic acid, and low viscosity conditions, reducing production costs and improving product stability and storability.
Smart Images

Figure CN121801718A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbiology and its application technology, specifically to a strain of Candida utilis and its application, and to protein feed and its preparation method. Background Technology
[0002] A large amount of corn steep liquor byproducts are generated during the deep processing of corn. Currently, the main methods for handling this byproduct include: directly spraying the liquor into feed, but this has the problem of high vomitoxin content, affecting feed safety and sales value; selling it directly as a liquid raw material, but market demand is limited and prices are low; or drying it into corn steep liquor powder, but it is highly hygroscopic, has poor flowability, and is prone to clumping, which seriously affects storage, transportation, and subsequent use.
[0003] In the field of feed protein raw materials, *Candida utilis* protein is a common single-cell protein product. Current technologies typically use corn steep liquor, glucose, or glucose mother liquor as culture media, employing *Candida utilis* for liquid fermentation, followed by spray drying to produce a powdered product. However, directly preparing *Candida utilis* protein using corn steep liquor, which has a complex composition, high viscosity, and is rich in lactic acid bacteria and toxins, as the main culture medium still faces a series of technical challenges, and a mature and efficient industrial application solution has not yet been developed.
[0004] Therefore, it is necessary to establish a complete production process for Candida utilis protein using corn steep liquor as raw material, and to improve the fermentation characteristics of corn steep liquor by screening or constructing suitable viscosity-reducing and sugar-reducing microbial strains. Summary of the Invention
[0005] The purpose of this invention is to overcome the technical problems existing in the prior art where corn steep liquor, due to its high sugar content, high lactic acid bacteria content, and high viscosity, leads to subsequent dry powder products being prone to moisture absorption and clumping, affecting the physical properties of the product. This invention provides a strain of *Candida utilis* and its application, as well as protein feed and its preparation method. The *Candida utilis* strain of this invention has strong tolerance to sulfur dioxide and can efficiently degrade monosaccharides, polysaccharides (such as maltose), and lactic acid in corn steep liquor. Protein feed prepared using corn steep liquor as a fermentation base with the *Candida utilis* strain of this invention has low sugar and lactic acid content, low viscosity, and is less prone to moisture absorption and clumping.
[0006] To achieve the above objectives, the first aspect of the present invention provides a strain of Candida utilis (…). Candida utilis The preservation number of the *Candida utilis* is CGMCC No. 39065.
[0007] A second aspect of the present invention provides the application of the Candida utilis strain described herein in protein feed.
[0008] A third aspect of the present invention provides a method for preparing protein feed, the method comprising the following steps: (1) The Candida utilis strain described in this invention is subjected to seed culture to obtain seed liquid; (2) The seed liquid is inoculated into a fermentation medium containing corn steep liquor for fermentation.
[0009] A fourth aspect of the present invention provides a protein feed prepared by the method described herein.
[0010] The fifth aspect of the present invention provides a fermentation agent, wherein the fermentation agent comprises the Candida utilis strain described in the present invention.
[0011] Through the above technical solution, the present invention achieves at least the following beneficial effects: (1) The Candida utilis of the present invention has strong tolerance to sulfur dioxide and can efficiently degrade monosaccharides, polysaccharides (such as maltose) and lactic acid in corn steep liquor. Protein feed prepared by using the Candida utilis of the present invention with corn steep liquor as fermentation base has low sugar and lactic acid content, low viscosity, and is not easy to absorb moisture or clump. (2) The method of the present invention enables the reuse of fermentation liquid, realizes continuous or semi-continuous fermentation, reduces the cultivation cost of fresh seed liquid, and lowers production costs.
[0012] Biological Preservation The strain provided by this invention is classified and named *Candida utilis*. Candida utilis It was isolated from distiller's grains collected in Hunan Province and deposited on November 19, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC No. 39065. Attached Figure Description
[0013] Figure 1 This is a colony morphology diagram of the Candida utilis CCNH046 of the present invention.
[0014] Figure 2 This is a microscopic image of the cell morphology of *Candida utilis* CCNH046, the present invention.
[0015] Figure 3 These are product state diagrams of the Candida utilis protein powder and corn steep liquor spray-dried powder prepared in Example 4 of this invention, when placed at room temperature. Figure 3 (A) is a product state diagram of corn steep liquor spray-dried powder after being left at room temperature for 10 minutes. Figure 3 (B) is a product state diagram of the Candida utilis protein powder prepared in Example 4 after being stored at room temperature for 6 months. Detailed Implementation
[0016] The endpoints and any values of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoint values of the various ranges, the endpoint values of the various ranges and individual point values, and individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.
[0017] In this invention, "CCNH046" is the number of the Candida utilis provided by the inventors during the research process, and "CGMCC No." is the preservation number of the strain. The two represent the same strain, and their numbers can be used interchangeably in the following text.
[0018] The first aspect of this invention provides a strain of Candida utilis (… Candida utilis The preservation number of the *Candida utilis* is CGMCC No. 39065.
[0019] A second aspect of the present invention provides the application of the Candida utilis strain described herein in protein feed.
[0020] A third aspect of the present invention provides a method for preparing protein feed, the method comprising the following steps: (1) The Candida utilis strain described in this invention is subjected to seed culture to obtain seed liquid; (2) The seed liquid is inoculated into a fermentation medium containing corn steep liquor for fermentation.
[0021] According to some embodiments of the present invention, in step (1), the seed culture method includes inoculating the Candida utilis into YPD liquid culture medium for a first expansion culture to obtain a primary seed culture; and then inoculating the primary seed culture into corn steep liquor culture medium for a second expansion culture to obtain a seed culture. Preferably, the YPD liquid culture medium comprises yeast extract, peptone, glucose, and water.
[0022] More preferably, in the YPD liquid culture medium, the content of yeast extract is 10-20 g / L, the content of peptone is 20-30 g / L, and the content of glucose is 20-40 g / L.
[0023] Preferably, the corn steep liquor culture medium comprises yeast extract, corn steep liquor, glucose, and water.
[0024] More preferably, based on the total mass of the corn steep liquor culture medium, the amount of yeast extract is 1-1.5 wt%, the amount of corn steep liquor is 3.0-6.0 wt%, and the amount of glucose is 2-4 wt%.
[0025] In this invention, preferably, the conditions for the first expansion culture include: a temperature of 30-33°C and a time of 16-20 hours.
[0026] In this invention, the first expansion culture is carried out in a shake flask, and preferably, the rotation speed of the first expansion culture is 90-120 rpm.
[0027] Preferably, the conditions for the second expansion culture include: a temperature of 33-37℃ and a time of 8-12 hours.
[0028] In this invention, the second expansion culture is carried out in a seed tank, and preferably, the rotation speed of the second expansion culture is 300-800 rpm.
[0029] Preferably, the inoculation amount of the primary seed solution is 1-1.5 (v / v)% based on the total volume of the corn steep liquor culture medium.
[0030] In this invention, corn steep liquor is a byproduct of corn starch production. It is made from corn, which is soaked in sulfite and then concentrated to form a yellowish-brown liquid containing soluble proteins, growth hormones, and other components. According to some embodiments of this invention, the solids content in the corn steep liquor is ≥40wt%; the sulfite content in the corn steep liquor is 0.4-0.6g / L.
[0031] Preferably, in step (2), the amount of corn steep liquor used is 0.03-0.06L relative to 1L of the fermentation medium.
[0032] Preferably, in step (2), the inoculation amount of the seed liquid is such that the viable count of *Candida utilis* in the fermentation medium is ≥1×10⁻⁶. 8 CFU / mL.
[0033] Preferably, the fermentation conditions include a temperature of 34-36℃ and a time of 17-22h.
[0034] In this invention, fermentation is carried out in a fermenter. Preferably, the fermentation conditions also include a rotation speed of 300-800 rpm.
[0035] In this invention, step (2) further includes adding corn syrup during the fermentation process.
[0036] Preferably, the method for adding corn steep liquor includes: during the fermentation process, when the pH of the fermentation broth is greater than 6.5, corn steep liquor is started to be added.
[0037] Preferably, the amount of corn steep liquor added is such that the solid content in the fermentation broth is ≥20wt%.
[0038] In this invention, during the process of adding corn syrup, the ventilation ratio is 1:0.3-0.6vvm.
[0039] In this invention, there are no particular limitations on the timing and speed of adding corn steep liquor. Adding corn steep liquor should be stopped when the dry matter content of the fermentation liquid reaches 20 wt%. There are no specific limitations on the number of times corn steep liquor is added; for example, 5-10 times are acceptable.
[0040] In this invention, the method further includes inoculating the fermentation broth with Bacillus subtilis after the fermentation is completed for secondary fermentation.
[0041] In this invention, preferably, the Bacillus subtilis has the accession number CGMCC No. 14597 (disclosed in CN109593665A).
[0042] In this invention, Bacillus subtilis needs to undergo seed liquid culture before being inoculated into the fermentation broth.
[0043] Preferably, the method for secondary fermentation includes: inoculating Bacillus subtilis glycerol tubes into seed culture medium, culturing at 30-33℃ and 100-150 rpm for 18-24 hours to obtain Bacillus subtilis seed culture; inoculating the seed culture into fermentation broth, culturing at 35-37℃ and 600-800 rpm for 18-24 hours.
[0044] Preferably, the seed culture medium comprises: tryptone, yeast extract and sodium chloride.
[0045] More preferably, the total mass of the seed culture medium is used as a basis, the amount of tryptone is 1-2 wt%, the amount of yeast extract is 0.5-1.0 wt%, the amount of sodium chloride is 1-2 wt%, and the pH is 7-7.5.
[0046] Preferably, the inoculation amount of the seed liquid is 10-20 (v / v)% based on the total volume of the fermentation broth.
[0047] In this invention, the method further includes spray drying the fermentation broth after the second fermentation to obtain Candida utilis protein powder.
[0048] Preferably, the spray drying is carried out in a spray drying tower. Preferably, the conditions for spray drying include: inlet air temperature of 140-150℃, outlet air temperature of 85-95℃, feed rate of 100-150L / h, and atomization pressure of 0.3-0.5MPa.
[0049] In this invention, the fermentation broth can be evaporated and concentrated before spray drying. There are no particular limitations on the method of evaporation and concentration, such as multi-effect evaporation and concentration.
[0050] A fourth aspect of the present invention provides a protein feed prepared by the method described herein.
[0051] A fifth aspect of the present invention provides a fermentation agent, the fermentation agent comprising the Candida utilis strain described in the present invention.
[0052] According to some embodiments of the present invention, the content of *Candida utilis* is ≥1×10⁻⁶ based on the total mass of the fermentation agent. 9 CFU / g.
[0053] The present invention will be described in detail below through embodiments.
[0054] In the following examples, corn steep liquor is a byproduct of corn starch production. It is made from corn, which is concentrated after being soaked in sulfurous acid to form a yellowish-brown liquid containing soluble protein, growth hormones, and other components.
[0055] Example 1 The *Candida utilis* CCNH046 of this invention was isolated from distiller's grains collected in Hunan Province. The specific process is as follows: (a) Screening of strains Leveraging the rapid screening capabilities of the ultra-high throughput platform, we screened the protein production capacity of 300 yeast strains, obtaining 50 strains with a protein production capacity increase of >50%. Then, using the Biolog biochemical identification instrument, we rapidly identified the carbon source utilization capacity of high-protein-producing strains (≥50%). Using the main carbon sources in corn steep liquor as benchmarks, we screened and identified 6 yeast strains that can use glucose, fructose, and lactic acid as carbon sources, thus initially achieving accurate capture of target strains.
[0056] Six yeast strains were screened and precisely identified using molecular biology: the ITS sequence (SEQ ID No. 1) was amplified and sequenced, and the sequencing results were compared with the sequences of three standard yeast strains in databases such as GenBank: if the homology was ≥99%, the corresponding yeast was identified, and one strain of Candida utilis, one strain of Kluyveromyces martensii, and one strain of Saccharomyces cerevisiae were obtained; since only Candida utilis protein products were available in the feed ingredient catalog, Candida utilis was selected for corn steep liquor fermentation in the experiment.
[0057] ITS sequence (SEQ ID No.1): CTTCCCCTTGGGGGGGGACTGCGGAAGGATCATTAAAGAAATTTAATTGATTTGTCTGAGCTCGGAGAGAGACATCTCTGGGGAGGACCAGTGTAGACACTCAGGAGGCTCCTAAAATATTTTCTCTGCTGTGAATGCTATTTCTCCTGCCTGCGCTTAAGTGCGCGGTTGGTGGGTGTTCTGCAGTGGGGGGAGGGAGCCGACAAAGACCTGGGAGTGTGCGTGGATCTCTCTATTCCAAAGGAGGTGTTTTATCACACGACTCGACACTTTCTAATTACTACACACAGTGGAGTTTACTTTACTACTATTCTTTTGTTCGTTGGGGGAACGCTCTCTTTCGGGGGGGAGTTCTCCCAGTGGATGCAAACACAAACAAATATTTTTTTAAACTAATTCAGTCAACACAAGATTTCTTTTAGTAGAAAACAACTTCAAAACTTTCAACAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACACGTTGTGTTTGGTAGTGAGTGATACTCTCGTTTTTGAGTTAACTTGAAATTGTAGGCCATATCAGTATGTGGGACACGAGCGCAAGCTTCTCTATTAATCTGCTGCTCGTTTGCGCGAGCGGCGGGGGTTAATACTGTATTAGGTTTTACCAACTCGGTGTTGATCTAGGGAGGGATAAGTGAGTGTTTTGTGCGTGCTGGGCAGACAGACGTCTTTAAGTTTGACCTCAAATCAGGTAGGGTTACCCGCTGAACTTAAGCATATCATAGGGGCGGAAGAAAAA。
[0058] (1)Sulfur dioxide tolerance test Yeast generally has a low tolerance to sulfur dioxide. In production scenarios such as feed and single-cell protein fermentation, the total sulfur dioxide concentration in the culture medium must usually be controlled below 50 mg / L. When the sulfur dioxide concentration in the culture medium is too high, it will damage the cell membrane structure, inhibit the activity of intracellular metabolic enzymes, and thus reduce the growth rate and protein synthesis efficiency of the cells. This strain of Candida utilis was cultured in shake flasks, seed tanks with corn steep liquor, and fed-batch fermentation. At the end of the fermentation, the sulfur dioxide concentration reached 200-300 mg / L, and the yeast was still able to germinate and proliferate. This strain can tolerate sulfur dioxide concentrations of 200-300 mg / L.
[0059] The strain was named CCNH046 and stored in a glycerol tube at -80°C for later use.
[0060] (II) Strain identification (1) Morphological identification: Observing the colony morphology of strain CCNH046, it was found that its colonies on Bengal red agar plates were usually 1-2 mm in diameter, round, with neat edges; the colonies were light red, raised in the middle, with a bright, smooth and moist surface, soft texture, and easy to pick up (the colony morphology of strain CCNH046 is as follows). Figure 1 (As shown); then the strain was observed under a microscope. The cells were round or oval and relatively uniform in size (the cell morphology of strain CCNH046 under a microscope is shown in the figure). Figure 2 (As shown).
[0061] (III) Biological Preservation The strain provided by this invention is classified and named *Candida utilis*. Candida utilis It was isolated from distiller's grains in Hunan Province and deposited on November 19, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC No. 39065.
[0062] Example 2-1 Shake flask culture (1) Prepare YPD liquid culture medium: 40g yeast extract, 80g peptone, 80g glucose, adjust the initial pH to 6, 4L distilled water; divide the 4L culture medium into 8 bottles (bottle volume is 2L, each bottle is 500mL), autoclave at 121℃ for 20min, and cool for later use. (2) Inoculation and culture: Glycerol tubes containing Candida utilis CCNH046 (with a viable count of 1.2 × 10⁻⁶) were inoculated. 5Inoculate 0.2% (v / v) of sterilized YPD liquid medium into a shake flask and culture it in a constant temperature shaker at 30℃ and 90rpm for about 16 hours to obtain the first-stage seed culture. Detect the pH, yeast count, etc. of the seed culture (see Table 1 for specific data). After the inoculation conditions are met, transfer it to a seed tank for further culture.
[0063] Example 2-2 Seed tank culture (1) Prepare corn steep liquor culture medium: 1wt% yeast extract, 4.5wt% corn steep liquor (the dry matter content of corn steep liquor is 40wt%), 2wt% glucose, the initial pH is not adjusted, 350L / tank, autoclave at 121℃ for 20min, cool and set aside. (2) Inoculation and culture: The above-mentioned primary seed culture was inoculated into sterilized corn steep liquor medium at an inoculation rate of 1 (v / v)% for seed tank culture (the viable count of Candida utilis in the corn steep liquor medium was 4 × 10⁻⁶). 7 CFU / mL), culture conditions: 30℃, 300 rpm (if dissolved oxygen (DO) in the seed solution is >20%, increase the speed to 800 rpm), culture period is about 9 hours, secondary seed solution is obtained, pH, yeast count, etc. of the seed solution are detected (see Table 1 for specific data), after the inoculation conditions are met, it is transferred to a fermenter for fermentation culture.
[0064] Table 1 Seed liquid quality
[0065] Example 2-3 Fermentation tank culture (1) Preparation of fermentation medium: 2.0m 3 (2000L) Fermentation substrate (containing 450L corn steep liquor, 350L secondary seed liquid, and 1200L water), prepare the corresponding volume of seed liquid and water according to the number of yeasts in the seed tank; (2) Fermentation culture: The above secondary seed culture was inoculated into the fermentation medium at an inoculation rate of 17.5 (v / v)% for fermentation culture (the viable count of Candida utilis in the fermentation medium was 1×10⁻⁶). 8Fermentation was carried out at 35℃ and 300 rpm (if the dissolved oxygen (DO) of the seed liquid was >20%, the speed was increased to 800 rpm). The pH of the fermentation broth was monitored using an online pH meter. When the pH value was >6.5, corn steep liquor (with a dry matter content of 40 wt%) was added. Corn steep liquor was continuously added until the dry matter content of the fermentation broth reached 20 wt%, at which point the addition of corn steep liquor was stopped. The aeration ratio was 1:0.3 vvm, and the speed was 300 rpm. When the pH rose back to above 6.5, corn steep liquor was added a second time until the pH of the fermentation broth reached 5.0, at which point the addition of corn steep liquor was stopped. This cycle of adding corn steep liquor was repeated 10-15 times. When the fermentation broth reached the standard of pH 6.5, glucose and fructose content 0%, and dry matter content above 20 wt%, the fermentation was considered to have reached its endpoint, and fermentation broth A was obtained.
[0066] Examples 2-4 Fermentation broth reuse (1) Preparation of fermentation medium: 2.0m 3 (2000L) Fermentation substrate (450L corn steep liquor, 350L fermentation liquid, 1200L water); (2) Fermentation is carried out at 35℃ and 300 rpm. During the fermentation process, corn steep liquor (with a dry matter content of 40 wt%) is added when the pH value is >6.5. Corn steep liquor is continuously added until the dry matter content of the fermentation liquid reaches 20 wt%. The ventilation ratio is 1:0.3vvm and the rotation speed is 300 rpm. When the pH rises back to above 6.5, corn steep liquor is added again until the pH of the fermentation liquid reaches 5.0. This cycle of adding corn steep liquor is repeated 10-15 times. When the pH of the fermentation liquid reaches 6.5, the glucose and fructose content is 0%, and the dry matter content is above 20 wt%, the fermentation is considered to be at its end, and fermentation liquid B is obtained.
[0067] The viable count of Candida utilis, the content of glucose, fructose, lactic acid, crude protein, acid-soluble protein, and oligopeptides in the fermentation broths of Examples 2-3 and 2-4 were determined respectively. The specific data are shown in Table 2.
[0068] The viable count of Candida utilis, and the contents of glucose, fructose, lactic acid, crude protein, acid-soluble protein, and oligopeptides were determined using the methods specified in GB / T 45033-2024 Determination of Candida utilis in feed microbial preparations, GB 5009.8-2023 National Food Safety Standard: Determination of fructose, glucose, sucrose, maltose, and lactose in food, GB / T 23877-2009 Determination of citric acid, fumaric acid, and lactic acid in feed acidifiers by high performance liquid chromatography, GB / T 6432-2018 Determination of crude protein in feed by Kjeldahl method, NY / T 3801-2020 Determination of acid-soluble protein in feed ingredients, and DB35 / T1089-2011 Determination of oligopeptide content in fermented fishmeal.
[0069] As shown in Table 2, the methods of Examples 2-3 and 2-4 can save on seed culture by directly using fermentation broth as seed culture. Experiments show that the fermentation broth can be reused for fermentation more than ten times. After fermentation, the pH is greater than 6.5, sugar and acid are reduced by more than 90%, crude protein is increased by more than 15%, and acid-soluble protein content is increased by more than 80%. The fermentation broth can be reused for continuous fermentation, which reduces the cost by 90% compared to single-batch fermentation of seed culture.
[0070] Table 2
[0071] Note: The oligopeptides in Table 2 refer to peptides with a molecular weight of less than 1000, which are generally composed of 2-10 amino acid residues.
[0072] Example 3 (1) Culture medium preparation: 1 wt% tryptone, 1 wt% yeast extract, 1 wt% sodium chloride, 1 L distilled water. Adjust the initial pH of the culture medium to 7.2 with 5 mol / L sodium hydroxide solution. Dispense 100 mL into two bottles (500 mL capacity) in a shake flask. Sterilize in an autoclave at 121℃ for 20 min and then cool.
[0073] (2) Shake flask inoculation and culture: 1% (v / v) of Bacillus subtilis CGMCC No. 14597 (disclosed in CN109593665A) cryopreservation solution was added to the above culture medium. The culture was incubated in a shaker at 31.5℃ and 100 rpm for 15 h to obtain Bacillus subtilis seed culture. One flask was used to measure pH and OD. The desired values were met (OD 2-4, pH around 7.0, viable count 1.2 × 10⁻⁶). 9 (CFU / mL) (3) Seed tank inoculation and culture: 1 wt% tryptone, 1 wt% yeast extract, 1 wt% sodium chloride, and 340 mL distilled water were added. The initial pH of the culture medium was adjusted to 7.2 with 5 mol / L sodium hydroxide solution. The medium was sterilized at 121℃ for 20 min and then cooled. The above shake flask seed solution was inoculated into the sterilized culture medium at an inoculation rate of 1.0 (v / v)% for seed tank culture. When the pH was around 7.0, the viable cell count was 1×10⁻⁶. 9 CFU / mL or higher can be transferred to a seed tank; (4) Inoculate the Bacillus subtilis seed culture from step (3) into fermentation broth A of Examples 2-3 at an inoculation rate of 10% (v / v). The viable count of Bacillus subtilis in the fermentation broth after inoculation is 1×10⁻⁶. 8 CFU / mL, cultured at 35℃ and 800 rpm for 18 h; fermentation broth C was obtained after fermentation.
[0074] (5) Inoculate the Bacillus subtilis seed culture from step (3) into fermentation broth B of Examples 2-4 at an inoculation rate of 10% (v / v). The viable count of Bacillus subtilis in the fermentation broth after inoculation is 1.0 × 10⁻⁶. 8 CFU / mL, cultured at 35℃ and 800 rpm for 24 h; fermentation broth D was obtained after fermentation.
[0075] The number of Candida utilis and the number of viable Bacillus subtilis in fermentation broths C and D were determined, and the content of vomitoxin in fermentation broths C and D was also determined. The specific data are shown in Table 3.
[0076] The viable count and vomitoxin content of Bacillus subtilis were determined using the methods specified in NY / T 2131-2012 Feed Additive Bacillus subtilis and GB / T 30956-2014 Determination of deoxynivalenol in Feed by Immunoaffinity Column Purification-High Performance Liquid Chromatography.
[0077] Table 3
[0078] Example 4 The fermentation broth from Example 3 was spray-dried, with corn steep liquor as a control, to prepare Candida utilis protein powder and corn steep liquor spray-dried powder, respectively. The specific methods are as follows: (1) Inlet air temperature: Maintain at 140-150℃ to quickly evaporate the moisture on the surface of the mist droplets using the higher initial temperature; (2) Air outlet temperature: Controlled at 85-90℃ to ensure that the moisture content of the final product drops to 4%-6% and avoid incomplete drying due to low dryness. (3) Feeding rate of 140-160L / h to prevent the liquid with low dry matter and high moisture content from sticking to the wall due to the droplets not drying in time because the feed is too fast.
[0079] (4) Atomization pressure: Maintain 0.3-0.5MPa to ensure that the liquid is atomized into fine droplets of 15-30μm, increase the contact area with hot air, and make up for the shortcoming of low dryness of dry matter.
[0080] The Candida utilis protein powder prepared by spray drying does not stick to the inner wall of the equipment. After being stored at room temperature for 6 months, the Candida utilis protein powder did not clump (e.g., Figure 3 (As shown in (B)), the hygroscopicity was significantly improved; corn steep liquor spray-dried powder (control group) showed severe clumping after 10 minutes at room temperature (as shown in (B)). Figure 3 (As shown in (A)).
[0081] Comparative Examples 1-2 The method of Example 4 was followed, except that Candida utilis CGMCC No. 39065 was replaced with Candida utilis CGMCC No. 2.2949 (purchased from China General Microbiological Culture Collection Center) and Saccharomyces cerevisiae CCTCCA1.25 (purchased from Angel Yeast Co., Ltd., commercial model Angel Super Brewing High-Activity Dry Yeast). The other steps and conditions were the same as in Example 4, and protein powder was prepared.
[0082] The crude protein, crude ash, moisture, and peptide content of the Candida utilis protein powder prepared in Example 4 and the protein powder prepared in the comparative example were measured respectively. The specific data are shown in Table 4.
[0083] Table 4
[0084] As shown in Table 4, the Candida utilis protein powder prepared by the method of Example 4 of the present invention has high crude protein content, high total peptide content, high oligopeptide content, and low vomitoxin content.
[0085] Test case Feeding trial (1) Experimental subjects: 1-day-old AA white-feathered broiler chickens, selected individuals with similar weight and no disease, totaling 432.
[0086] (2) Experimental period: 42 days.
[0087] (3) Group design: There are 4 groups in total, with 3 replicates in each group and 36 chickens in each replicate. There is no significant difference in the initial weight of each group.
[0088] Control group (CK): Basal diet (containing 50wt% corn flour + 42wt% soybean meal, with the remainder being soybean oil, lysine, phosphate, etc.).
[0089] Experimental Group 1 (T1): 1% of the corn flour and soybean meal in the basal diet of the control group were replaced with the Candida utilis protein powder prepared in Example 4, and the remaining components were the same as those of the control group.
[0090] Experimental Group 2 (T2): 3% of the corn flour and soybean meal in the basal diet of the control group were replaced with Candida utilis protein powder prepared in Example 4, and the remaining components were the same as those of the control group.
[0091] Experimental Group 3 (T3): 5% of the corn flour and soybean meal in the basal diet of the control group were replaced with Candida utilis protein powder prepared in Example 4, and the remaining components were the same as those of the control group.
[0092] (4) Feeding and management The rearing environment was the same for all groups of chickens. The temperature (34-35℃ for 1-3 days old, decreasing by 2-3℃ per week, and maintaining 24-26℃ after 21 days old), humidity (60%-70% for 1-10 days old, 50%-60% in the later stage), lighting (24 hours of light for 1-3 days old, 16 hours of light / 8 hours of darkness after 4 days old), and ventilation conditions were completely consistent.
[0093] Feeding method: Free access to food and water. Record the amount of food consumed by each group daily. Clean the feed troughs and water troughs regularly to maintain hygiene.
[0094] Health monitoring: Observe the chickens' mental state and feces daily, record the number of cases and deaths, and promptly dissect and analyze the causes of death.
[0095] (5) Feeding effect: See Table 5 for specific data.
[0096] Table 5 Feeding Trial
[0097] As shown in Table 5, the Candida utilis protein powder prepared by the method of the present invention can replace fish meal and soybean meal in a proportion of up to 5%, thereby reducing the feed conversion ratio and production costs.
[0098] The preferred embodiments of the present invention have been described in detail above; however, the present invention is not limited thereto. Within the scope of the inventive concept, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be considered as the content disclosed in the present invention and are all within the protection scope of the present invention.
Claims
1. A strain of Candida utilis ( Candida utilis ), characterized in that, The preservation number of the *Candida utilis* is CGMCC No. 39065.
2. The application of the Candida utilis according to claim 1 in protein feed.
3. A method for preparing a protein feed, characterized in that, The method includes the following steps: (1) seed culture of the Candida utilis according to claim 1 to obtain seed liquid; (2) The seed liquid is inoculated into a fermentation medium containing corn steep liquor for fermentation.
4. The method according to claim 3, wherein, In step (1), the seed culture method includes inoculating the Candida utilis into YPD liquid medium for the first expansion culture to obtain a primary seed culture; The primary seed culture was then inoculated into corn steep liquor medium for a second expansion culture to obtain the seed culture. Preferably, the YPD liquid culture medium comprises yeast extract, peptone, glucose, and water; More preferably, in the YPD liquid culture medium, the content of yeast extract is 10-20 g / L, the content of peptone is 20-30 g / L, and the content of glucose is 20-40 g / L; Preferably, the corn steep liquor culture medium comprises yeast extract, corn steep liquor, glucose, and water; More preferably, based on the total mass of the corn steep liquor culture medium, the amount of yeast extract is 1-1.5 wt%, the amount of corn steep liquor is 3-6 wt%, and the amount of glucose is 2-4 wt%.
5. The method according to claim 3 or 4, wherein, The corn steep liquor contains ≥40 wt% solids and 0.4-0.6 g / L of sulfite. Preferably, in step (2), the amount of corn steep liquor used is 0.03-0.06L relative to 1L of the fermentation medium; Preferably, in step (2), the inoculation amount of the seed liquid is such that the viable count of *Candida utilis* in the fermentation medium is ≥1×10⁻⁶. 8 CFU / mL.
6. The method according to claim 4, wherein, The conditions for the first expansion culture include: a temperature of 30-33℃ and a time of 16-20 hours; Preferably, the conditions for the second expansion culture include: a temperature of 33-37℃ and a time of 8-12 hours; Preferably, based on the total volume of the corn steep liquor culture medium, the inoculation amount of the primary seed solution is 1-1.5% (v / v)%. Preferably, the fermentation conditions include: a temperature of 34-36℃, a time of 17-22h, and a rotation speed of 300-800rpm.
7. The method according to any one of claims 3-6, wherein, In step (2), the method further includes adding corn steep liquor during the fermentation process; Preferably, the method for adding corn steep liquor includes: during the fermentation process, when the pH of the fermentation broth is >6.5, the corn steep liquor is started to be added; Preferably, the amount of corn steep liquor added is such that the solid content in the fermentation broth is ≥20wt%.
8. The protein feed prepared by the method according to any one of claims 3-7.
9. A fermentation agent, characterized in that, The fermentation agent includes the Candida utilis as described in claim 1.
10. The fermentation agent according to claim 9, wherein, Based on the total mass of the fermentation agent, the content of *Candida utilis* is ≥1×10⁻⁶. 9 CFU / g.
Citation Information
Patent Citations
Bacillus subtilis, microbial inoculum comprising bacillus subtilis, kit, application of bacillus subtilis, microbial inoculum and kit, and method for degrading vomitoxin
CN109593665A