Universal sample type nucleic acid releasing agent and application thereof

Abstract

The invention discloses a universal sample type nucleic acid releasing agent and application thereof. The nucleic acid releasing agent is prepared from the following components in molar concentration: 20 to 100 mM of Tris-HCl, 30 to 500 mM of sodium chloride, 30 to 200 mM of ammonium sulfate, 1 to 6 mM of EDTA (Ethylene Diamine Tetraacetic Acid), 1 to 8 mM of a reducing agent, 0.1 to 0.2 percent of sodium dodecyl sarcosinate, 0.1 to 3 mM of Surfactin, 5 to 30 percent of Chelex-100 and 5 to 15 percent of trehalose. According to the method, various samples can be mildly split, impurities such as impure proteins and lipids can be effectively removed, the complexity of nucleic acid samples is reduced, and the method is seamlessly jointed with subsequent PCR (Polymerase Chain Reaction); the kit has double effects of sample preservation and splitting decomposition, can strongly inhibit various nuclease, and can ensure the long-term storage stability of samples.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular biology, and particularly relates to a universal sample type nucleic acid releasing agent and application thereof. BACKGROUND

[0002] As a core nucleic acid amplification technology in the field of modern molecular biology, the polymerase chain reaction (PCR) has been widely used in clinical diagnosis, pathogen screening, forensic identification, agricultural breeding and other key fields due to its high sensitivity and high specificity. However, no matter what the application scenario of PCR is, the nucleic acid needs to be extracted and purified from the sample to be tested, which is a key step to determine the subsequent amplification effect and detection accuracy.

[0003] At present, the nucleic acid extraction methods mainly include alkali lysis method, phenol chloroform extraction method, column extraction method and magnetic bead method. The alkali lysis method is simple to operate, but it causes great damage to nucleic acid and has low purity, which is difficult to meet the high-precision PCR detection requirement; the phenol chloroform extraction method needs to use toxic organic reagents, and the operation risk is high and the time consumption is as long as 1h-2h; the column extraction method depends on special reagent kits, and the cost is high and it is difficult to adapt to the scene of rapid detection; the magnetic bead method is suitable for automatic operation, but it is easy to cause magnetic bead aggregation in the processing of complex samples (such as blood samples containing a large amount of protein), which leads to unstable extraction efficiency. It can be seen that the existing methods have problems such as long time consumption, insufficient application scenarios and complex operation.

[0004] In the related art, the nucleic acid releasing agent can be used for rapid lysis of samples, and the nucleic acid product after lysis can be directly used in the subsequent PCR amplification reaction. However, the existing nucleic acid releasing agent has problems such as single sample applicability (such as CN112980831A), no sample preservation function, and use of guanidine salt and other strong denaturants in the lysis component, which affects the downstream reaction (such as CN116732023A). SUMMARY

[0005] The present application provides a universal sample type nucleic acid releasing agent and application thereof to solve the technical problems of single sample applicability and insufficient mildness of the lysis process of the existing nucleic acid releasing agent.

[0006] In a first aspect, the present application provides a universal sample type nucleic acid releasing agent, which comprises the following components in terms of molar concentration: 20mM-100mM Tris-HCl, 30mM-500mM sodium chloride, 30mM-200mM ammonium sulfate, 1mM-6mM EDTA, 1mM-8mM reducing agent, 0.1%-0.2% sodium dodecyl sarcosinate, 0.1mM-3mM Surfactin, 5%-30% Chelex-100, 5%-15% trehalose.

[0007] In some embodiments, the nucleic acid releasing agent is used with a sample selected from the group consisting of oropharyngeal swab sample, anal swab sample, tissue sample, blood sample, and urine sample.

[0008] In some embodiments, the method of using the nucleic acid releasing agent comprises: For oropharyngeal swab sample and anal swab sample, the swab sample is immersed in the nucleic acid releasing agent, stirred thoroughly, and centrifuged after standing at room temperature for 3-5 minutes to obtain supernatant for PCR detection.

[0009] In some embodiments, the method of using the nucleic acid releasing agent comprises: For tissue sample, the tissue sample is mixed with the nucleic acid releasing agent, ground thoroughly, and heated in a metal bath at 70-90°C for 3-5 minutes, and then centrifuged to obtain supernatant for PCR detection.

[0010] In some embodiments, the method of using the nucleic acid releasing agent comprises: For blood sample, the blood sample is mixed with the nucleic acid releasing agent at a volume ratio of 1:9, and shaken uniformly, heated in a metal bath at 70-90°C for 3-5 minutes, and then centrifuged to obtain supernatant for PCR detection.

[0011] Optionally, the centrifugation condition is 5000g-10000g for 2 minutes.

[0012] In some embodiments, the nucleic acid releasing agent is used with a DNA sample or an RNA sample. The DNA and RNA released by the nucleic acid releasing agent can be stored for a long time. The DNA sample can be stored for a long time at -20°C or below, and the RNA sample can be stored for one year at -20°C and for a long time at -80°C.

[0013] In some embodiments, the reducing agent comprises one or both of β-mercaptoethanol and DTT.

[0014] In some embodiments, the nucleic acid releasing agent comprises the following components in molar concentration: 50-100 mM Tris-HCl, 200-500 mM sodium chloride, 50-150 mM ammonium sulfate, 1-6 mM EDTA, 1-8 mM reducing agent, 0.1-0.2% sodium lauryl sarcosinate, 0.1-3 mM Surfactin, 5-20% Chelex-100, and 10-15% trehalose.

[0015] In some embodiments, the pH value of the nucleic acid releasing agent is 7.5-9.0.

[0016] In a second aspect, the application provides a use of the universal sample type nucleic acid releasing agent in PCR detection.

[0017] Compared with the prior art, the application has the following beneficial effects: The Tris-HCl, sodium chloride, ammonium sulfate, EDTA, reducing agent, sodium dodecyl sarcosinate, Surfactin, Chelex-100 and trehalose are compounded to achieve mild lysis of various samples, and impurities such as miscellaneous proteins and lipids can be effectively removed, the complexity of the nucleic acid sample is reduced, and the subsequent PCR is seamlessly connected; the sample preservation and lysis dual functions are combined, various nucleases are strongly inhibited, and the long-term storage stability of the sample can be ensured; various samples are compatible, including but not limited to anal swabs, tissues, blood, etc., and are used in various nucleic acid detection scenes.

[0018] The Tris-HCl provides a stable buffer environment for nucleic acid release, helps to stabilize the system pH, protects the nucleic acid structure, and assists in lysis efficiency; the sodium chloride and ammonium sulfate are matched to help adjust the system ionic strength, realize stable nucleic acid structure, assist in lysis efficiency, promote impurity precipitation, and inhibit nuclease activity; EDTA as a metal ion chelator can chelate nuclease ligand Mg2+, inhibit the activity of the nuclease; the reducing agent helps to open the disulfide bond of the nuclease, and inhibit the activity of the nuclease; the sodium dodecyl sarcosinate as an anionic surfactant can lyse cells and denature proteins; SurFactin (Surfactin) as a biological surfactant can strongly lyse cells; Chelex-100 as a chelated ion exchange resin can effectively adsorb divalent metal ions, proteins, cell fragments and pigments, realize the purpose of inhibiting the activity of the nuclease and removing impurities; trehalose as a natural disaccharide helps to protect the integrity of the nucleic acid sample and improve the stability of the nucleic acid sample. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 FIG. 1 is an effect diagram of releasing nucleic acid from an H5N1 avian anal swab sample according to an embodiment of the application; Figure 2 FIG. 2 is an effect diagram of releasing nucleic acid from an H5N1 avian tissue sample according to an embodiment of the application; Figure 3 FIG. 3 is an effect diagram of releasing nucleic acid from an infected canine whole blood sample according to an embodiment of the application. DETAILED DESCRIPTION

[0020] To make the above-mentioned objects, features, and advantages of the present invention more apparent and understandable, specific embodiments of the present invention are described in detail below. Many specific details are set forth in the following description to provide a thorough understanding of the present invention. However, the present invention can be practiced in many other ways different from those described herein, and those skilled in the art can make similar modifications without departing from the spirit of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0021] As used herein, the terms “prepared from” and “comprising” are synonymous. The terms “comprising,” “including,” “having,” “containing,” or any other variations thereof, as used herein, are intended to cover non-exclusive inclusion. For example, a composition, step, method, article, or apparatus that includes the listed elements is not necessarily limited to those elements, but may include other elements not expressly listed or elements inherent to such composition, step, method, article, or apparatus.

[0022] When a quantity, concentration, or other value or parameter is expressed as a range, a preferred range, or a range defined by a series of upper and lower preferred values, this should be understood as specifically disclosing all ranges formed by any pair of any upper or preferred value with any lower or preferred value, regardless of whether the range is disclosed individually. For example, when the range “1 to 5” is disclosed, the described range should be interpreted as including the ranges “1 to 4”, “1 to 3”, “1 to 2”, “1 to 2 and 4 to 5”, “1 to 3 and 5”, etc. When numerical ranges are described herein, unless otherwise stated, the range is intended to include its endpoints and all integers and fractions within that range.

[0023] Furthermore, the indefinite articles “a” and “an” preceding the elements or components of this invention do not impose any limitation on the quantity requirement (i.e., the number of times) of the elements or components. Therefore, “an” or “a” should be interpreted as including one or at least one, and the singular form of an element or component also includes the plural form, unless the quantity clearly refers to the singular form.

[0024] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items. Example 1

[0025] The nucleic acid release agent comprises the following components in molar concentrations: 80 mM Tris-HCl, 250 mM sodium chloride, 100 mM ammonium sulfate, 4 mM EDTA, 4 mM β-mercaptoethanol, 0.1% sodium dodecyl sarcosinate, 1 mM Surfactin, 15% Chelex-100, and 10% trehalose. Example 2

[0026] The nucleic acid release agent comprises the following components in molar concentrations: 100mM Tris-HCl, 500mM sodium chloride, 30mM ammonium sulfate, 1mM EDTA, 4mM DTT, 0.2% sodium dodecyl sarcosinate, 1mM Surfactin, 10% Chelex-100, and 10% trehalose. Example 3

[0027] The nucleic acid release agent comprises the following components in molar concentrations: 80 mM Tris-HCl, 200 mM sodium chloride, 150 mM ammonium sulfate, 6 mM EDTA, 8 mM β-mercaptoethanol, 0.1% sodium dodecyl sarcosinate, 0.1 mM Surfactin, 30% Chelex-100, and 5% trehalose.

[0028] Comparative Example 1 The difference from Example 1 is that Comparative Example 1 does not contain ammonium sulfate.

[0029] Comparative Example 2 The difference from Example 1 is that Comparative Example 2 does not contain sodium chloride.

[0030] Comparative Example 3 The difference from Example 1 is that Comparative Example 3 does not contain EDTA.

[0031] Comparative Example 4 The difference from Example 1 is that Comparative Example 4 does not contain a reducing agent.

[0032] Nucleic acid release agent test using avian influenza anal swab samples: Experimental method: Anal swabs were collected from H5N1 infected birds according to the anal swab collection method in "Avian Influenza Diagnostic Techniques GB / T18936—2025". The swabs were placed in 1.2 ml of sample diluent, thoroughly squeezed and dried, and then discarded. The samples were centrifuged at 3000 r / min for 10 min and the supernatant was collected.

[0033] Following the above method, 5 anal swab samples were collected, and the supernatants were mixed to obtain a total of 4 ml of anal swab supernatant containing virus particles. The supernatant was mixed with nucleic acid release agent at a ratio of 1:4. Each nucleic acid release agent formulation was used to lyse the samples three times. The mixture was vortexed for 30 seconds, allowed to stand at room temperature for 3 minutes, and then centrifuged at 8000g for 2 minutes. 4 μL of the supernatant was added to the poultry H5N1 RT-qPCR system for testing.

[0034] Nucleotide sequences of primers and probes for detecting H5N1 in birds: H5-F: AGGGAGGATGGCAGGGAATG; H5-R: TCTTTGTCTGCAGCGTACCCACT; H5-P: FAM⁃ATGGTTGGTATGGGTACCACCATAGCAATG⁃BHQ1.

[0035] The RT-qPCR amplification system is configured as shown in Table 1: Table 1 RT-qPCR amplification system

[0036] RT-qPCR procedure: The detection device was Borg (FQD-96A), and the reaction conditions were: 50℃ for 15 min, 95℃ for 5 min; 95℃ for 15 s, 60℃ for 30 s, for 40 cycles. Fluorescence was collected at 60℃. The test results are shown in Table 2.

[0037] Evaluation of experimental results: The Ct values ​​between the examples are considered to be within 2, which meets the requirements; the CT difference between the comparative example and the examples is considered to be within 3.3, which meets the requirements.

[0038] Evaluation criteria: According to the principle of quantitative real-time PCR, a CT value difference of 3.3 between the example and the comparative example is equivalent to a 10-fold difference in the target nucleic acid concentration; if it exceeds 3.3, it means that the nucleic acid concentration of the released sample differs by 10 times, which does not meet the requirements.

[0039] Table 2 Test results of Examples 1 to 3 and Comparative Examples 1 to 4

[0040] As shown in Table 2, the difference in CT values ​​for samples treated with the nucleic acid releasing agents of Examples 1-3 was within 2, which met the requirements. Compared with Example 1, the difference in CT values ​​for samples treated with Comparative Example 1 (removal of ammonium sulfate), Comparative Example 2 (removal of sodium chloride), Comparative Example 3 (removal of DTT), and Comparative Example 4 (removal of β-mercaptoethanol) was greater than 4.31, indicating that the performance of the releasing agent had decreased and did not meet the requirements. Example 4

[0041] The nucleic acid release agent comprises the following components in molar concentrations: 80 mM Tris-HCl, 250 mM sodium chloride, 150 mM ammonium sulfate, 4 mM EDTA, 4 mM β-mercaptoethanol, 0.1% sodium dodecyl sarcosinate, 1 mM Surfactin, 10% Chelex-100, and 10% trehalose. Example 5

[0042] The nucleic acid release agent comprises the following components in molar concentrations: 50 mM Tris-HCl, 250 mM sodium chloride, 150 mM ammonium sulfate, 4 mM EDTA, 4 mM β-mercaptoethanol, 0.1% sodium dodecyl sarcosinate, 3 mM Surfactin, 20% Chelex-100, and 15% trehalose. Example 6

[0043] The nucleic acid release agent comprises the following components in molar concentrations: 80 mM Tris-HCl, 250 mM sodium chloride, 150 mM ammonium sulfate, 4 mM EDTA, 1 mM β-mercaptoethanol, 0.1% sodium dodecyl sarcosinate, 2 mM Surfactin, 20% Chelex-100, and 10% trehalose.

[0044] Comparative Example 5 The difference from Example 4 is that Comparative Example 5 does not contain sodium dodecyl sarcosinate.

[0045] Comparative Example 6 The difference from Example 4 is that Comparative Example 6 does not contain Surfactin.

[0046] Comparative Example 7 The difference from Example 4 is that Comparative Example 7 does not contain Chelex-100.

[0047] Nucleic acid release agent test using visceral tissue samples from H5N1 infected poultry: Experimental methods: Following the tissue sample processing method in "Avian Influenza Diagnostic Techniques GB / T18936—2025", lung, heart, and spleen tissues from diseased poultry were taken and homogenized at a ratio of 1g sample to 2ml sample dilution. The homogenized tissues were mixed with nucleic acid release agents at a ratio of 1:9, heated in a 70°C metal bath for 3-5 minutes, centrifuged at 8000g for 2 minutes, and 4ul of the supernatant was added to the avian H5N1 RT-qPCR system for testing. Each nucleic acid release agent was used to lyse the sample, and the process was repeated three times.

[0048] The nucleotide sequences of primers and probes for avian H5N1 detection, the RT-qPCR amplification system, the evaluation of experimental results, and the evaluation criteria were all based on the anal swab sample examples described above. The test results are shown in Table 3.

[0049] Table 3 Test results of Examples 4 to 6 and Comparative Examples 5 to 7

[0050] As shown in Table 3, the difference in CT values ​​for samples treated with the nucleic acid release agents of Examples 4-6 was within 2, which meets the requirements. Compared with Example 4, the difference in CT values ​​for samples treated with the nucleic acid release agents of Comparative Examples 7-9 was greater than 4.5, indicating that the performance of the release agent had decreased and did not meet the requirements.

[0051] Application Example 1: Comparison of nucleic acid detection in poultry anal and pharyngeal swabs with nucleic acid extraction kits.

[0052] The detection method includes the following steps: Take one anal swab and one pharyngeal swab from H5N1 infected birds, place the swabs directly into 1 ml of the nucleic acid release agent formulated in Example 1, vortex for 30 seconds, let stand at room temperature for 3 minutes, centrifuge at 8000g for 2 minutes, and take the supernatant for testing; take 1 μl, 2 μl, and 4 μl of the processed samples respectively to prepare qPCR systems, and perform two replicates for each volume of sample. The FAM channel detects H5N1 mRNA, and the VIC channel detects avian β-actin.

[0053] Control method: Nucleic acid was extracted using the total RNA extraction kit from Shanghai Feijie Biotechnology Co., Ltd., in accordance with the "Avian Influenza Diagnostic Techniques GB / T18936—2025". The nucleic acid extracted by the control method was added to 2 μL of the prepared qPCR system, and the experiment was repeated twice.

[0054] Nucleotide sequences of primers and probes for detecting H5N1 in birds: H5-F: AGGGAGGATGGCAGGGAATG; H5-R:TCTTTGTCTGCAGCGTACCCACT; H5-P: FAM⁃ATGGTTGGTATGGGTACCACCATAGCAATG⁃BHQ1.

[0055] Nucleotide sequences of primers and probes for avian ACTB detection: ACTB-F: CCAGACATCAGGTACGGCAAC; ACTB-R: CCTCAGCAGAACCACTCCCA; ACTB-P: VIC-CCGAACGCTCCTCCCTATCGTCC-BHQ1.

[0056] PCR amplification: The detection device was Borg (FQD-96A), and the reaction conditions were: 50℃ for 15 min, 95℃ for 5 min; 95℃ for 15 s, 60℃ for 30 s, for 40 cycles. Fluorescence was collected at 60℃. The test results are shown in Table 4. Figure 1 As shown.

[0057] Table 4 Comparison of the effects of release agents on anorectal swabs

[0058] From Table 4 and Figure 1 As can be seen, the nucleic acid release agent of this invention has good lysis and release effects on anoropharyngeal swabs, and neither DNA nor RNA is degraded during the release process, with effects comparable to column extraction. Furthermore, when 1 μL, 2 μL, and 4 μL of sample were added to a 20 μL system, the amplification curves for H5N1 and ACTB all differed by 1 CT, indicating that the release agent has good compatibility with RT-qPCR / qPCR and does not inhibit PCR amplification.

[0059] Application Example 2: Comparison of nucleic acid detection and nucleic acid extraction kits for poultry tissue samples.

[0060] The detection method includes the following steps: Take 50 mg of lung tissue from H5N1 diseased poultry and put it directly into 1 ml of the nucleic acid release agent in Example 4. Use a handheld homogenizer to homogenize the tissue sample thoroughly. Place the homogenized tissue sample in an 80℃ metal bath and incubate for 5 min. Then, centrifuge at 8000g for 2 min and take the supernatant for testing. Take 1 μl, 2 μl, and 4 μl of the processed samples to prepare qPCR systems. Each volume of sample is repeated twice. The FAM channel is used to detect H5N1 mRNA, and the VIC channel is used to detect avian β-actin.

[0061] Control method: Nucleic acid was extracted using the total RNA extraction kit from Shanghai Feijie Biotechnology Co., Ltd., in accordance with the "Avian Influenza Diagnostic Techniques GB / T18936—2025". The nucleic acid extracted by the control method was added to 2 μL of the prepared qPCR system, and the experiment was repeated twice.

[0062] Primers and probes for detecting H5N1 in birds, primers and probes for detecting ACTB in birds, and PCR amplification were used in the same application as in Example 1. Test results are shown in Table 5. Figure 2 As shown.

[0063] Table 5 Comparison of the effects of release agent treatment on tissue samples

[0064] From Table 5 and Figure 2As can be seen, the nucleic acid release agent of this invention exhibits good sample lysis and release effects on avian tissue samples, and neither DNA nor RNA is degraded during the release process, with effects comparable to column extraction. Furthermore, when 1 μL, 2 μL, and 4 μL of sample were added to a 20 μL system, the amplification curves for H5N1 and ACTB differed by approximately one CT, indicating that the release agent has good compatibility with RT-qPCR / qPCR and does not inhibit PCR amplification.

[0065] Application Example 3: Comparison of Nucleic Acid Detection and Nucleic Acid Extraction Kits for Canine Whole Blood Samples The detection method includes the following steps: Take 100 μL of canine whole blood sample, add 900 μL of the nucleic acid release agent from Example 4 directly, and mix thoroughly on a vortex mixer; Place the mixed sample in an 80°C metal bath, incubate for 5 min, centrifuge at 8000g for 2 min, and take the supernatant for testing; Take 1 μL, 2 μL, and 4 μL of the treated sample respectively to prepare qPCR systems, and perform two replicates for each volume of sample, and detect the canine 18S gene using the FAM channel.

[0066] Control reagent: Take 100 μL of canine whole blood sample, extract with Tiangen Genomic DNA Extraction Kit, and elute with 50 μL of TE buffer; add 2 μL of nucleic acid extracted by the control method to the prepared qPCR system, and repeat twice.

[0067] Nucleotide sequences of primers and probes for canine 18S gene detection: Upstream primer: ACTGCGAATGGCTCATTAAATC; Downstream primer: CCGTCGGCATGTATTAGCTCTA; Probe: FAM-CCTTTGGTCGCTCGCTCCTCTC-BHQ1.

[0068] PCR amplification: The detection device was Borg (FQD-96A), and the reaction conditions were: 50℃ for 15 min, 95℃ for 5 min; 95℃ for 15 s, 60℃ for 30 s, for 40 cycles. Fluorescence was collected at 60℃. The test results are shown in Table 6. Figure 3 As shown.

[0069] Table 6 Comparison of the effects of release agent treatment on canine whole blood samples

[0070] From Table 6 and Figure 3As can be seen, the nucleic acid release agent of this invention has good sample lysis and release effects on canine whole blood samples, and the DNA does not degrade during the release process, with effects comparable to column extraction. Furthermore, when 1 μL, 2 μL, and 4 μL of sample were added to a 20 μL system, the 18S gene amplification curves all differed by approximately one CT, indicating that the release agent has good compatibility with qPCR and does not inhibit PCR amplification.

[0071] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0072] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above descriptions are merely specific embodiments of the present invention and are not intended to limit the scope of protection of the present invention. In particular, it should be noted that any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention for those skilled in the art.

Claims

1. A universal sample-type nucleic acid release agent, characterized in that, Includes the following components of the molar concentration meter: 20mM~100mM Tris-HCl, 30mM~500mM Sodium Chloride, 30mM~200mM Ammonium Sulfate, 1mM~6mM EDTA, 1mM~8mM Reducing Agent, 0.1%~0.2% Sodium Dodecyl Sarcosinate, 0.1mM~3mM Surfactin, 5%~30% Chelex-100, 5%~15% Trehalose.

2. The universal sample-type nucleic acid release agent as described in claim 1, characterized in that, The nucleic acid release agent is suitable for samples including oropharyngeal swabs, anal swabs, tissue samples, blood samples, and urine samples.

3. The universal sample-type nucleic acid release agent as described in claim 2, characterized in that, The method of using the nucleic acid releasing agent includes: For oropharyngeal swab samples and anal swab samples, immerse the swab samples in the nucleic acid release agent, stir thoroughly, let stand at room temperature for 3 to 5 minutes, centrifuge and take the supernatant for PCR detection.

4. The universal sample-type nucleic acid release agent as described in claim 2, characterized in that, The method of using the nucleic acid releasing agent includes: For tissue samples, mix the tissue sample with the nucleic acid release agent, grind thoroughly, heat in a metal bath at 70℃~90℃ for 3min~5min, centrifuge and take the supernatant for PCR detection.

5. The universal sample-type nucleic acid release agent as described in claim 2, characterized in that, The method of using the nucleic acid releasing agent includes: For blood samples, mix blood samples and nucleic acid release agents at a volume ratio of 1:9 and shake well. After heating in a metal bath at 70℃~90℃ for 3min~5min, centrifuge and collect the supernatant for PCR detection.

6. The universal sample-type nucleic acid release agent according to any one of claims 1 to 5, characterized in that, The nucleic acid release agent is suitable for DNA or RNA samples.

7. The universal sample-type nucleic acid release agent as described in claim 1, characterized in that, The reducing agent includes one or both of β-mercaptoethanol and DTT.

8. The universal sample-type nucleic acid release agent as described in claim 1, characterized in that, Includes the following components of the molar concentration meter: 50mM~100mM Tris-HCl, 200mM~500mM Sodium Chloride, 50mM~150mM Ammonium Sulfate, 1mM~6mM EDTA, 1mM~8mM Reducing Agent, 0.1%~0.2% Sodium Dodecyl Sarcosinate, 0.1mM~3mM Surfactin, 5%~20% Chelex-100, 10%~15% Trehalose.

9. The universal sample-type nucleic acid release agent as described in claim 1, characterized in that, The pH value of the nucleic acid releasing agent is 7.5~9.

0.

10. The application of a universal sample-type nucleic acid release agent as described in any one of claims 1 to 9 in PCR detection.

Images