Chip type nucleic acid visual detection sensor based on composite dam structure and application of chip type nucleic acid visual detection sensor

Abstract

The invention relates to a composition and a sensor for judging target nucleic acid based on a dam breaking drainage phenomenon driven by a target molecule, and a preparation method and application of the composition and the sensor. Specifically, the invention provides a single nucleic acid sensing chip and a dual nucleic acid sensing chip. Furthermore, the target nucleic acid activates the CRISPR / Cas system to trigger the wettability of the composite dam interface to be converted, so that whether the target nucleic acid exists or not can be judged by observing whether the sample liquid in the sample adding pool flows from the sample adding pool to a preset flow channel and a liquid collecting area or not. According to the invention, whether the target nucleic acid exists or not can be judged with high sensitivity. In addition, large instruments are not needed, operation is convenient and fast, rapid and high-sensitivity detection of the target nucleic acid can be achieved through a naked eye observation method, and related devices are easy to prepare and low in cost.

Description

Technical Field

[0001] This invention relates to the field of biosensors and molecular diagnostics, and in particular to nucleic acid visualization detection chips and their usage methods. Background Technology

[0002] In recent years, the frequent occurrence and spread of emerging infectious diseases have led to a significant increase in demand for rapid, highly sensitive, and low-cost nucleic acid testing methods. As the core carriers of genetic information for many pathogens, nucleic acid molecules play a crucial role in the specific detection of infectious diseases, epidemic prevention and control, food safety, and environmental monitoring. Particularly in the detection of highly variable pathogens such as the novel coronavirus and influenza virus, traditional detection methods face a trade-off between detection sensitivity, cost, and portability. For example, while RT-PCR has good detection sensitivity, it requires expensive equipment and complex operations, making it unsuitable for large-scale on-site testing; while methods such as colloidal gold test strips offer advantages in portability and low cost, their limited sensitivity often leads to missed detections of early infections.

[0003] To address the aforementioned issues, molecular diagnostic technologies based on CRISPR / Cas systems have attracted widespread attention. These technologies achieve efficient amplification of nucleic acid signals by activating the non-specific lateralization activity of enzymes after specifically recognizing target sequences. Existing studies have utilized Cas12a / Cas13a to construct detection platforms with multiple signal output methods, including fluorescence, electrochemical, and colorimetric methods. However, most of these systems still rely on external readout devices (such as fluorometers and colorimeters), making it difficult to achieve truly instrument-free detection. Furthermore, chip platforms for multi-target parallel detection also face challenges such as insufficient sample splitting, cross-contamination risks, and difficulties in result reading, indicating a bottleneck in technology transfer.

[0004] Therefore, there is an urgent need to develop a nucleic acid detection platform that is highly specific, has a rapid response, is easy to read, has a simple structure, and is low in cost. In particular, there is a detection technology system that can support multi-target detection, has good visualization output capabilities, and does not require complex equipment, so as to meet the application needs of on-site nucleic acid screening, home monitoring, and public health emergency testing. Summary of the Invention

[0005] To address the technical bottlenecks of existing nucleic acid detection methods in terms of sensitivity, equipment dependence, detection throughput, and field adaptability, this invention provides a chip-based nucleic acid detection sensor based on the "dam-breaking and diversion" effect. By regulating the interface wettability of the composite dam structure, liquid flow is triggered in the presence of the target nucleic acid, enabling visual interpretation without instruments and achieving single or dual target detection.

[0006] Therefore, this application provides a CRISPR / Cas system-based chip for nucleic acid detection. The chip includes one or more composite isolation structures, a sample loading chamber, and a display area disposed on a substrate. The sample loading chamber and the display area are separated by the composite isolation structures. The composite isolation structures include physical isolation structures and molecular isolation structures. The molecular isolation structure is a probe disposed on the surface of the physical isolation structure. The probe has the following structure: [hydrophilic linker]-[switch]-[hydrophobic group] or [switch]-[hydrophobic group], where the [switch] is a single-stranded nucleic acid chain. In this application, the composite isolation structure can be hydrophobically or hydrophilically modified with the CRISPR / Cas system through the molecular isolation structure to precisely control the flow behavior of fluids.

[0007] In a preferred embodiment, the composite isolation structure is hydrophobic. In a preferred embodiment, the CRISPR / Cas system may be selected from the CRISPR / Cas12a system and the CRISPR / Cas13a system.

[0008] In a preferred embodiment, the display area has a hydrophilic surface.

[0009] In addition, in addition to the composite isolation structure, sample cell and display area on the chip substrate, a hydrophobic peripheral signal enhancement area can be provided in one or more areas. Preferably, the area outside the composite isolation structure, sample cell and display area is a hydrophobic peripheral signal enhancement area.

[0010] During the detection process, if the target nucleic acid is present, the CRISPR / Cas system modifies the surface of the composite isolation structure to be hydrophilic, altering its wettability. The detection solution then flows from the composite isolation structure into the display area, resulting in a visible output. If the target nucleic acid is absent, this modification does not occur, and the detection solution remains in the sample loading chamber without flowing. The chip structure can be designed for the detection of single or multiple targets, depending on requirements.

[0011] In one aspect, this application also provides a method for detecting nucleic acids using the aforementioned chip.

[0012] In another aspect, this application also provides a kit for detecting nucleic acids, the kit comprising the aforementioned chip and CRISPR / Cas recognition reagents.

[0013] Beneficial effects

[0014] This invention provides a chip-based biosensor platform that eliminates dependence on instruments (especially electronic instruments) and enables highly sensitive nucleic acid detection by directly observing liquid movement. It belongs to POCT (point-of-care testing) and home molecular diagnostic technologies with great application potential.

[0015] The sensor described in this invention features a construction and material selection that closely resembles actual production conditions, making it suitable for commercial application. This chip platform can utilize low-cost glass substrates (such as standard glass slides or custom glass slides) as its core material. Compared to microfluidic materials that currently require special synthesis or lack factory-scale production capabilities, such as polymer materials like PDMS, the glass substrate used in this invention has a broad social production base, mature industrial process capabilities, and extremely low per-piece material cost, providing a solid foundation for the large-scale fabrication and widespread application of the sensor.

[0016] Furthermore, this invention combines the high specificity of CRISPR / Cas systems for nucleic acid recognition with their "side-cutting" amplification capabilities. In the presence of the target nucleic acid, it can synergistically cleave a large number of probes within the composite isolation structure, causing a sudden change in the wettability of the composite isolation structure interface (i.e., from hydrophobic to hydrophilic), thereby triggering a significant "dam-breaking and diversion" phenomenon, realizing the transformation from molecular events to macroscopic liquid behavior. This interface regulation principle enables the single-detection chip sensor of this invention to achieve visual detection of nucleic acid targets with concentrations as low as 10 aM within 2 minutes. The dual-detection chip sensor can achieve visual detection of nucleic acid targets with concentrations as low as 100 aM within 5 minutes.

[0017] In summary, this invention is not only innovative in its structural design, but also has an excellent foundation for engineering transformation in terms of material selection and testing mechanisms. It is applicable to a variety of application scenarios, such as on-site testing, home testing, and emergency response to major epidemics, and has good practical value and commercial prospects. Attached Figure Description

[0018] Figure 1 This is a schematic diagram illustrating the fabrication and detailed parameters of a single-detection chip according to an embodiment of this application. The substrate of this single-detection chip is made of glass and includes a sample loading cell, a composite dam structure, a flow channel, a liquid collection area, and a hydrophobic boundary design.

[0019] Figure 2 This is a schematic diagram illustrating the fabrication and detailed parameters of a dual-detection chip according to an embodiment of this application. The dual-detection chip has a glass substrate and includes a sample loading chamber, two sets of composite dam structures, flow channels, an automatic liquid replenishment system, and a hydrophobic boundary design. The two sets of composite dam structures correspond to the fixation regions of two different crRNAs and are connected to independent flow channels to achieve differentiated responses and result output for dual targets.

[0020] Figure 3 This is a schematic diagram illustrating the detection principle of a single-chip and a dual-chip according to embodiments of this application. Figure 3A is a schematic diagram of the single-chip detection principle. After adding the sample to be tested and the CRISPR / Cas system containing components such as crRNA and Cas protein, if the target nucleic acid (such as the N gene of the novel coronavirus) is present in the sample, the system is activated and the probe is cleaved, causing the surface of the dam to change from hydrophobic to hydrophilic. The liquid breaks through the dam and flows through the channel area, and is finally collected in the collection area. Figure 3 b is a schematic diagram of the dual-chip detection principle. The two dam regions are pre-modified with crRNA1 and crRNA2 respectively to identify the nucleic acids of two different pathogens (e.g., the PB2 gene of influenza A virus and the PB1 gene of influenza B virus). When either target is present, the corresponding dam body activates the cleavage reaction, and the droplet breaks through the dam and flows into the channel, achieving a dual-target distinguishing response.

[0021] Figure 4 This image shows experimental results of detecting the N gene of a serially diluted standard SARS-CoV-2 virus using a single-chip assay according to an embodiment of this application. The concentration range is from 1 aM to 10 pM. The image shows the detection results at a detection time of 2 min, with a detection limit of 10 aM.

[0022] Figure 5 These are photographs of experimental results for the detection of COVID-19 in clinical nasal swab samples using a single-chip assay according to an embodiment of this application. The results include 10 clinical nasal swab samples with CT values ​​between 28 and 33 (positive) and 1 clinical nasal swab sample with a CT value of 38 (negative). The photographs show the detection results at a testing time of 2 minutes. The chip detection results and the "gold standard" RT-PCR detection results show good consistency.

[0023] Figure 6 The diagram and photograph show representative detection results of dual-chip detection of influenza A virus PB2 gene and influenza B virus PB1 gene standards according to the embodiments of this application. The photograph shows the detection results at a detection time of 5 minutes. Figure 6 Group A is negative, and neither dam body responded. Figure 6 Group b is positive for influenza A. In this case, the dam broke, and liquid entered the flow channel. In this case, the dam for influenza B did not react. Figure 6 Group C is positive for influenza B. In this case, the dam of influenza B breached, and liquid entered the flow channel. The dam of influenza A showed no reaction. Figure 6 Group d was positive for both influenza A and influenza B, and both sides of the dam experienced dam breaches.

[0024] Figure 7 These are photographs of experimental results for dual-chip detection of synthetic IAV-PB2 and IBV-PB1 RNA targets at equal concentrations according to embodiments of this application. The concentration range is from 10 aM to 10 pM, and the photographs show the detection results at a detection time of 5 min, with a detection limit of 10 aM.

[0025] Figure 8 These are photographs of experimental results from clinical nasal swab samples for dual-chip detection of influenza A and influenza B viruses according to an embodiment of this application. The results include pooled detection of 10 groups of clinical nasal swab samples with CT values ​​between 28 and 33 (positive) for influenza A and influenza B viruses, and 1 group of clinical nasal swab samples with a CT value of 36 (negative). The photographs show the detection results at a detection time of 5 minutes. The chip detection results and the "gold standard" RT-PCR detection results show good consistency. Detailed Implementation

[0026] The present invention will be further described below with reference to the accompanying drawings and specific embodiments. However, the present invention is not limited to the following embodiments. Any modifications, substitutions, improvements, etc., made by those skilled in the art without departing from the spirit and essence of the present invention shall fall within the protection scope of the present invention.

[0027] This application integrates the molecular recognition and catalytic properties of the CRISPR / Cas system, the engineering control capabilities of interfacial wettability, and the micro / nano structure design concept to construct a novel nucleic acid detection device with advantages such as high sensitivity, high specificity, low cost, instrument-free operation, speed, and visualization. Specifically, this invention belongs to the technical direction of on-site rapid detection platforms and is suitable for rapid screening of respiratory viruses (such as influenza A / B viruses, SARS-CoV-2), pathogenic microorganisms, and genetic disease targets; early diagnosis of animal and plant diseases; public health emergency response; primary healthcare testing; and home self-testing, among other molecular diagnostic scenarios. It also possesses high modularity, scalability, and multi-target parallel detection capabilities.

[0028] To maximize chip sensitivity, designing a structure with signal amplification capabilities is crucial. Specifically, this invention requires filling the sample cell with a volume several times larger than the sample volume itself, causing the sample to form a threshold state where it "wants to break through the dam but cannot." Through target molecule mediation, the degradation of the weak molecular dam probe allows the sample to gush out, achieving highly sensitive detection.

[0029] Therefore, this application provides a chip for detecting nucleic acids based on a CRISPR / Cas system. The chip includes one or more composite isolation structures, a sample loading chamber, and a display area disposed on a substrate. The sample loading chamber and the display area are separated by the composite isolation structures. The composite isolation structures include physical isolation structures and molecular isolation structures. The molecular isolation structure is a probe disposed on the surface of the physical isolation structure. The probe has the following structure: [hydrophilic linker]-[switch]-[hydrophobic group] or [switch]-[hydrophobic group], where the [switch] is a single-stranded ribose chain. In this application, the composite isolation structure can be hydrophobically or hydrophilically modified with the CRISPR / Cas system through the molecular isolation structure to precisely control the flow behavior of fluids.

[0030] The molecular dam is modified onto the surface of the physical dam and is composed of a functionalized nucleic acid probe. In a preferred embodiment, the hydrophilic group in the probe may be a flexible hydrophilic spacer arm, for example, selected from an alkyl chain (e.g., a hexane chain) or PEG;

[0031] The switching switch can be single-stranded DNA or single-stranded RNA, which can be cleaved by the activated Cas12a system or Cas13a system, respectively.

[0032] The hydrophobic group may be a dodecyl alkyl group.

[0033] In a preferred embodiment, the probe may have the following structure: NH2-(CH2)6-(PEG6)2-ssDNA-(CH2) 12 Or NH2-(CH2)6-(PEG6)2-ssRNA-(CH2) 12 .

[0034] During sample addition, the sample liquid cannot flow directly into the display area due to the obstruction of the isolation structure. Only when the liquid in the sample addition pool reaches a certain amount and is forced by external force (i.e., the hydrophobic surface of the composite isolation structure becomes hydrophilic) to cross the isolation structure can the liquid cross the isolation structure and enter and wet the display area.

[0035] In a specific implementation, the physical isolation structure is a raised dam integrally formed on the chip body, or a raised dam obtained by etching, and its height H1 is less than the depth H2 of the sample cell. The height difference between the two is ΔH = H2 - H1, and preferably, the height difference ΔH ranges from 0.01 mm to 0.5 mm.

[0036] More preferably, ΔH is between 0.01 mm and 0.05 mm, and more preferably 0.03 mm.

[0037] In some embodiments, the thickness of the physical isolation structure in its liquid flow direction is T, where T can be 10 μm ≤ T ≤ 500 μm. Preferably, the thickness T is 50 μm ≤ T ≤ 200 μm. More preferably, the thickness T is 80-110 μm, for example 90 or 100 μm.

[0038] The length L of the physical isolation structure perpendicular to the flow direction is preferably the same as or less than the width W of the display area.

[0039] In some implementations, crRNA may also be immobilized on the composite isolation structure.

[0040] The shape of the sample loading cell is not limited, but it is preferably circular (e.g., with a diameter of 1-50 mm, preferably 15-25 mm). In a preferred embodiment, the depth H2 of the sample loading cell is 0.1-10 mm, preferably 0.2-0.5 mm.

[0041] In a preferred embodiment, the surface of the sample addition cell is hydrophilic.

[0042] Regarding the display area, its shape is not limited, but it is preferably a flow channel. In some embodiments, the length of the display area is 10-50 mm, and the width W is equal to or greater than the length L of the composite isolation structure, for example, 1L ≤ W ≤ 3L. In one aspect, the depth H3 of the flow channel is equal to or greater than the depth of the sample cell. To facilitate the display of results, the depth of the flow channel can be from H2 to 1.5H2.

[0043] In a preferred embodiment, the surface of the display area is hydrophilic.

[0044] In a preferred embodiment, a liquid collection chamber is further provided at one end of the display area for receiving liquid in the display area.

[0045] A collection chamber can also be set at the other end of the flow channel to receive the liquid in the flow channel, and its shape is not limited.

[0046] In addition, in addition to the composite isolation structure, sample cell and display area on the chip substrate, a hydrophobic peripheral signal enhancement area can be provided in one or more areas. Preferably, the area outside the composite isolation structure, sample cell and display area is a hydrophobic peripheral signal enhancement area.

[0047] In a specific implementation, the chip can be used for single-target detection, i.e., detecting one target nucleic acid. Such a chip may include a composite isolation structure, a sample loading chamber, a display area, and optionally a collection area. Of course, this type of chip can also detect two or more targets, as long as corresponding multiple crRNAs are used. It should be noted that when targeting multiple targets, a positive result indicates the presence of at least one of the target nucleic acids.

[0048] In a specific implementation, the chip can be used for multiplex detection, i.e., detecting multiple target nucleic acids. In such a chip, each crRNA is preferably immobilized on different composite isolation structures to enable precise confirmation of the target nucleic acid in a single detection. The multiplex detection chip may include multiple composite isolation structures (to bind multiple targets), a sample loading chamber, multiple display areas (matched to the target images to be detected), and an optional collection chamber.

[0049] In some embodiments, the chip for multiple detections may further include a replenishment chamber to replenish liquid to the sample loading cell as needed.

[0050] In specific embodiments, this application provides single-detection chips and dual-detection chips. For example, the dimensions of the single-detection chip are 76.2 mm × 25.4 mm × 1 mm (standard glass slide); the dimensions of the dual-detection chip are 50 mm × 50 mm × 1 mm. The sample cell has a diameter of 18 mm and a depth of 0.3 mm; the flow channel has a width of 3 mm and a depth of 0.3 mm. The physical isolation structure is a microstructure formed integrally or by laser etching, specifically a protruding structure between the sample cell and the flow channel. The height and width of the physical isolation structure are key factors affecting whether the test liquid can form a hemispherical threshold state of "wanting to break through the dam but unable to proceed." In a preferred embodiment, the width is set to 0.09 mm and the dam height is 0.27 mm. Under these conditions, after fixing the molecular dam probe, the sample cell can hold a liquid volume of 600 μL, and the test liquid can form an ideal threshold state of "wanting to break through the dam but unable to proceed" in a hemispherical shape. Higher molecular dams are also feasible.

[0051] During the detection process, the target sample is added to the CRISPR reaction system solution (e.g., the reaction system contains Cas protein, crRNA, Mg²⁺ buffer, etc.), and then loaded into the sample loading chamber (the dual detection chip is loaded into the sample loading chamber and the replenishment chamber simultaneously). At this point, the test liquid forms an ideal threshold state of "wanting to break through the dam but unable to move forward" in a hemispherical shape. If the sample contains the target nucleic acid sequence, the target nucleic acid sequence binds to crRNA, the Cas protease is activated, and it cuts the single-stranded nucleic acid in the middle segment of the probe fixed on the dam, causing the release of hydrophobic groups. The surface of the dam changes from hydrophobic to hydrophilic, and the liquid breaks through the dam, flows into the flow channel and merges into the collection area, forming a visible "drainage" result, which is interpreted as positive. If the sample does not contain the target nucleic acid, the probe structure remains intact, and the liquid continues to be blocked by the hydrophobic dam, and the result remains in a "non-flowing" state, which is interpreted as negative.

[0052] In a specific embodiment of the present invention, the chip physically includes a sample loading cell, a physical dam, a molecular dam, a flow channel, and a liquid collection area, and may further include an automatic liquid replenishment system. The physical dam is formed by laser etching and is used to locally fix the conversion probe. The molecular dam is constructed using the aforementioned probe.

[0053] In this specification, the term "chip" generally refers to a micro-carrier platform with a microstructure design for sample detection and signal conversion, characterized by integration, high throughput, and miniaturization. The chip typically consists of a solid substrate with one or more pre-defined structural regions on its surface, including but not limited to sample loading cells, response dams, flow channels, collection areas, and signal stabilization regions, used to guide, react with, and interpret the sample.

[0054] Without being limited by theory, the chip described in this paper may include identification reagents (such as CRISPR / Cas systems) for sample identification, conversion units (such as probes) for interface property conversion, and transducer structures (such as dam structures, flow channel drainage structures, etc.) for physical current limiting or guiding signal reading. Therefore, the chip described in this invention belongs to a functionalized reaction platform that integrates identification, conversion and transducer functions.

[0055] The chip in this invention can be designed as a single-target detection structure (such as one pool and one dam) or a multi-target detection structure (such as one pool and multiple dams or multiple pools and multiple dams) depending on the application. It can be further integrated with automatic liquid replenishment structure, signal enhancement area, cover film encapsulation structure, etc., to adapt to different application scenarios such as home testing and on-site screening.

[0056] The chip is not limited in physical form to any specific shape or material. Any form that has the following functional modules is considered to fall within the scope of the "chip" of this invention:

[0057] A type of base;

[0058] At least one conversion unit (such as a probe);

[0059] At least one identification system (such as a CRISPR / Cas system);

[0060] At least one transducer structure (such as a liquid threshold structure).

[0061] Optional features include a liquid replenishment module, readout channel, or packaging accessories.

[0062] In a preferred embodiment, the chip of the present invention can be used as a disposable on-site nucleic acid testing device, or it can be integrated into the core detection unit of a portable POCT testing instrument, and has the characteristics of batch preparation, low cost and convenient operation.

[0063] base

[0064] In this invention, the "substrate" is the core carrier structure constituting the chip sensor of this invention. It is used to support the reaction region, construct the response dam, define the liquid channel, and construct hydrophobic or hydrophilic interfaces. The surface of the substrate can be constructed into a composite structure with distinct functions through chemical modification and physical etching.

[0065] In some embodiments, the probe forms a stable covalent bond with the substrate surface through its connecting end (e.g., an amino group), modifying a predetermined reaction region so that the region is generally hydrophobic, serving as a "threshold site" for liquid flow.

[0066] In some implementations, probes can be modified on the entire surface of the substrate, or only on one or more specific regions, to define the reaction space, form a molecular dam structure, or construct a multi-target detection unit.

[0067] In some embodiments, the substrate can be in various configurations, such as a flat plate type, a microchannel type, or a micro-recessed structure type. In a preferred embodiment, the substrate is a flat plate-shaped chip structure, on which a sample loading cell, a physical dam, a molecular dam, a flow channel, and a collection area are integrated. For a flat plate-type substrate, multiple dam regions can be set on its surface at specific intervals to achieve single or multiple detection.

[0068] In some embodiments, the substrate may be selected from a variety of materials, including but not limited to: glass substrate, silicon substrate, silicon dioxide substrate, indium tin oxide (ITO) substrate, gold substrate, silver substrate, copper substrate, polymethyl methacrylate (PMMA) substrate, polycarbonate (PC) substrate, polydimethylsiloxane (PDMS) substrate, polyvinyl chloride (PVC) substrate, polyamide fiber substrate, polyethylene terephthalate (PET) substrate, and composite substrates of any of the above materials.

[0069] For ease of visual inspection, transparent, semi-transparent, or light-colored substrates are preferred. Among these, glass is the preferred substrate material in this invention due to its excellent optical transparency, laser processing compatibility, and cost advantages.

[0070] In this invention, the substrate preferably has a size suitable for manual operation and visual reading. For example:

[0071] The substrate for the single-detection chip can be a standard glass slide (76.2 mm × 25.4 mm × 1 mm).

[0072] The dual detection chip substrate can be a custom glass plate (50 mm × 50 mm × 1 mm), which is suitable for setting up multiple reaction units and replenishment modules.

[0073] In this invention, the substrate surface area connected to the probe is referred to as the reaction region. In some embodiments, the entire substrate surface may be the reaction region; while in a preferred embodiment, only the dam area is designated as the reaction region to enhance positioning accuracy and signal contrast.

[0074] In a preferred embodiment, the substrate further includes a signal enhancement region, which preferably has persistent hydrophobicity to stabilize the liquid boundary and enhance the visibility of the signal output. The signal enhancement region is disposed completely or partially around the chip structure region, and its size can extend outwards by a certain distance according to the boundary of the reaction region, with a side length / diameter equal to or greater than the size of the reaction region. For example, if the reaction region is circular or rectangular, the signal enhancement region can also be of a corresponding shape or its outer envelope.

[0075] In a further embodiment, the substrate may be equipped with a sealing device, such as a transparent film, cover plate, or microcap that matches the shape of the chip, for liquid protection and contamination isolation during transportation, storage, and reaction. The sealing element is preferably made of transparent, translucent, or light-colored material, such as a transparent PET film or a white polypropylene cover plate, to facilitate visual observation of flow changes on the chip surface during the reaction.

[0076] The single-detection chip includes a set of composite dam structures and channels, suitable for detecting the nucleic acid of a single pathogen (such as SARS-CoV-2). The dual-detection chip includes two sets of independent dam structures and channels, suitable for the simultaneous detection of the nucleic acids of two pathogens (such as influenza A virus and influenza B virus). In addition to fixing the probe, the two dams in the dual-detection chip are each modified with specific crRNA molecules at a concentration of 40 nM. The dual-detection chip also integrates a replenishment structure to maintain a relatively stable liquid volume in the sample loading chamber. When liquid transfer occurs on one side of the reaction, the replenishment area can add liquid to the sample loading chamber, ensuring accurate and reliable results in the other channel and avoiding false negatives or incomplete reactions due to reduced liquid in the sample loading chamber.

[0077] In the preferred embodiment, the single-detection chip has been experimentally verified to achieve clear fluid signal output at a nucleic acid target concentration of 10 aM, with a reaction time within 2 minutes; the dual-detection chip also achieves clear fluid signal output at a nucleic acid target concentration of 100 aM, with a reaction time within 5 minutes, suitable for rapid detection needs. Furthermore, this invention allows for the design of different crRNA sequences to detect different nucleic acids, exhibiting high platform scalability. The chip material can also be replaced with PMMA, PC, or other laser-etchable materials while maintaining a consistent fabrication process, making it suitable for different application scenarios.

[0078] Composite isolation structure

[0079] In this invention, the composite isolation structure, also known as the composite dam structure, is a structure set in the chip platform to control the flow of liquid. The composite isolation structure is composed of two parts: a physical isolation structure and a molecular isolation structure.

[0080] Physical isolation structure

[0081] In this invention, a "physical isolation structure" refers to a solid protrusion structure, or physical dam, formed on the surface of a chip substrate through microstructural processing. Its main function is to prevent spontaneous diffusion of liquid between the sample loading cell and the flow channel. The physical isolation structure has a mechanical flow-limiting function and serves as the interface threshold control unit for the entire reaction zone.

[0082] In a preferred embodiment, the physical isolation structure is formed on a chip substrate (e.g., glass) using laser etching technology. Its typical structure is a raised structure retained between the sample cell and the flow channel, with a length consistent with the width of the flow channel, used to construct a spatial barrier.

[0083] In some implementations, the physical isolation structure may be linear, curved, or wraparound, and the specific shape may be designed according to the chip structure to meet the needs of single detection or multiple detection.

[0084] Molecular isolation structure

[0085] In this invention, "molecular isolation structure" refers to a molecular layer structure modified on the surface of the physical dam, possessing controllable interfacial wettability conversion capability, i.e., a molecular dam. Its composition mainly relies on functionalized nucleic acid probes that can be cleaved by an activated CRISPR / Cas system, which simultaneously possess surface immobilization and hydrophobic blocking capabilities.

[0086] The probe has the following structure:

[0087] NH2-(CH2)6-(PEG6)2-ssRNA-(CH2) 12 ,

[0088] in,

[0089] NH2 is the stationary group used for covalent bonding;

[0090] (CH2)6-(PEG6)2 is a flexible hydrophilic spacer arm used to improve steric hindrance and connection stability;

[0091] ssRNA is a nucleic acid sequence that can be cleaved by an activated CRISPR / Cas13a system;

[0092] (CH2) 12 It is a hydrophobic alkyl chain used to maintain the hydrophobic state of the dam body.

[0093] In a preferred embodiment, the probe is immobilized on the surface of an APTES-modified physical isolation structure via glutaraldehyde crosslinking, forming a high-density hydrophobic molecular film on the isolation structure. When the target nucleic acid is present, the CRISPR / Cas system in the recognition system is activated and cleaves the nucleic acid chain in the middle of the probe, causing the hydrophobic groups to lose their connection. The hydrophobicity of the isolation structure surface disappears and it becomes hydrophilic, thereby causing the liquid to break through the isolation structure and move along the flow channel, triggering a "dam-breaking and diversion" signal.

[0094] Collaboration mechanism

[0095] In this invention, the physical isolation structure and the molecular isolation structure work together to construct the fluid control interface:

[0096] Physical isolation structures provide spatial barrier functionality;

[0097] Molecular isolation structures provide interfacial energy barriers and controllable collapse mechanisms.

[0098] When the target nucleic acid is not detected, the liquid is confined by the physical isolation structure and stops diffusing under the hydrophobic effect of the molecular isolation structure, which is judged as negative; when the target nucleic acid is present, the CRISPR / Cas system is activated to start the enzyme cleavage reaction, causing the isolation structure to change from hydrophobic to hydrophilic, and the liquid flows through the isolation structure region into the channel, triggering a visual positive signal.

[0099] In a further embodiment, the chip can integrate two or more sets of physical isolation structures and molecular isolation structures, each set independently performing nucleic acid detection for one target. Independent flow channels and buffer structures are set between the regions of each set of isolation structures to avoid cross-contamination and liquid interference, making it suitable for parallel detection of dual or even multiple targets.

[0100] Automatic fluid replenishment system

[0101] In this invention, to ensure the stability of the liquid volume in the chip reaction system during multi-target detection and to avoid reaction interference caused by liquid dissipation or loss in a single channel, an automatic liquid replenishment structure with passive response capability is designed to maintain the synchronization and integrity of the dual detection reaction system.

[0102] This structure is typically located on the side edge of the chip substrate and includes a replenishment reservoir, a replenishment channel, and a trigger interface. The replenishment liquid is the same as the liquid in the sample loading reservoir, stored in the replenishment reservoir, and connected to the sample loading reservoir via the replenishment channel.

[0103] That is, the chip of this application may also contain a replenishment chamber, which contains a second liquid; and it also has a connecting channel connected to the sample loading cell.

[0104] The shape and volume of the replenishment chamber are not limited.

[0105] During chip operation, if a channel experiences a "dam breach" due to the presence of target nucleic acid, causing the liquid level in the sample loading chamber to drop, the surface energy difference between the sample loading chamber and the replenishment chamber will automatically replenish the liquid in the replenishment area to the sample loading chamber. This process is non-force-driven, passively triggered, and possesses a certain degree of self-regulation capability.

[0106] In a preferred embodiment, the automatic liquid replenishment structure utilizes the principle of surface energy difference to achieve precise, quantitative, and delayed liquid replenishment. The related liquid replenishment behavior has the following characteristics:

[0107] Maintain stability before testing begins;

[0108] Flow only occurs after the liquid level in the sample loading cell drops;

[0109] It does not interfere with the initial mixing and diffusion equilibrium of the original reaction system;

[0110] This maintains a stable reaction environment for another channel that has not yet tested positive.

[0111] This automatic fluid replenishment structure makes the invention more reliable in dual-target detection, especially suitable for asymmetric reaction scenarios where one side of the target is positive and the other side is negative, effectively avoiding problems such as false negative judgment, signal drift and insufficient fluid.

[0112] Changeover switch

[0113] In a specific embodiment, the switching switch is a single-stranded nucleic acid segment. In a preferred embodiment, the single-stranded nucleic acid is single-stranded RNA, the length of which can be selected from 5-10 nt, more preferably 5-8 nt, and most preferably 5 or 6 nt.

[0114] The sequence of the single-stranded RNA can be any sequence. For example, the single-stranded RNA may be a 5-10 nt ribonucleic acid chain composed of uracil ribonucleotides (hereinafter referred to as U).

[0115] For example, the single-stranded RNA may be selected from the following: 5'-UUUUU-3', 5'-UUUUUU-3', or 5'-UUUUUUU-3'.

[0116] In this invention, the hydrophilic group may be formed from one or more of the following: nucleic acid chains composed of deoxynucleotides (e.g., deoxyribonucleic acid with a length of 12-100 bases), polyethylene glycol (hereinafter referred to as PEG, e.g., HO(CH2CH2O)). m H, where m is an integer between 5 and 13, or PEG derivatives, polyacrylic acid, polyacrylic acid, polyurethane, and polyamide. For the above polymers, there is no upper limit to their degree of polymerization in this invention, as long as they provide the required hydrophilicity or hydrophobicity.

[0117] In a specific embodiment, the hydrophilic group may be formed from a substance selected from the following: HO(CH2CH2O) m H, where m is an integer between 5 and 13, and its derivatives; and nucleic acid chains composed of deoxynucleotides (e.g., the group may contain 12-100 bases in length, such as 20-40 bases in length).

[0118] In this invention, the polyethylene glycol derivative may include a monophosphate derivative of PEG. In a preferred embodiment, the hydrophilic group may include one or more monophosphate-PEG groups.

[0119] Preferably, the hydrophilic group is selected from: HO(CH2CH2O) m H, where m is an integer between 5 and 13, preferably between 5 and 8, and most preferably 6, and its monophosphate derivatives.

[0120] In this invention, the hydrophobic group is selected from groups based on optionally substituted or unsubstituted alkyl groups. In this invention, straight-chain alkyl groups are preferred. In some embodiments, the C-chain length of the alkyl group may be between 10-100, preferably 10-20, more preferably 10-15, for example, it may be -(CH2). n-1 CH3, wherein n can be an integer selected from 10-100, preferably 10-15. In some embodiments, the alkyl group may optionally be substituted with a halogen (e.g., fluorine, chlorine, bromine or iodine).

[0121] In a specific implementation, the probe may be selected from: [single-stranded RNA]-[CH3(CH2)] n-1 ]、[HO(CH2CH2O)m H or its derivatives]-[single-stranded RNA]-[CH3(CH2)] n-1 ].

[0122] The preparation and ligation of the various groups in the probe according to the present invention can be performed as needed based on known procedures. For example, either the hydrophilic or hydrophobic group can be ligated to the nucleic acid of the switching switch via a phosphodiester bond. For example, when binding to the 5' end of the switching switch, the hydrophilic or hydrophobic group can be ligated to the switching switch via a phosphate group on the first nucleotide molecule of the switching switch; when binding to the 3' end of the switching switch, the hydrophilic or hydrophobic group can be ligated to the switching switch via another phosphate group. For example, when binding to the 3' end of the switching switch, the other phosphate group can form an ester bond with the 3'-hydroxyl group on the last nucleotide molecule of the switching switch. For ligation, the ends of the hydrophilic or hydrophobic groups can be modified as needed using known procedures, including but not limited to modifications with functionalized groups.

[0123] hydrophilic linking groups

[0124] The hydrophilic linker group is used to fix the probe to the chip surface and provide a spatial flexible arm, and may be composed of one or more of the following combinations:

[0125] Polyethylene glycol (PEG) or its derivatives;

[0126] Single-stranded DNA or RNA strands (e.g., composed of T or U);

[0127] Hydrophobic / hydrophilic polymer segments containing functional groups.

[0128] In a preferred embodiment, the hydrophilic linking group is NH2-(CH2)6-(PEG6)2, where PEG6 represents a polyethylene glycol repeating unit with a degree of polymerization of 6. This structure provides both good water solubility and flexibility, making it an ideal forearm structure for constructing molecular dams.

[0129] In some alternative implementations, the hydrophilic group may also be composed of a single-stranded T-DNA (such as polyT) chain of 20-40 bases, for example: 5′-TTTTTTTTTTTTTTTTTTTT-3′ (20T) or 5′-TTTT...TTTT-3′ (40T), but this is not suitable for scenarios using the Cas12a system.

[0130] Hydrophilic groups can be connected to the switching region through 5′-amino modification or phosphorylation sites to form phosphodiester bonds, ester bonds, or amide bonds.

[0131] hydrophobic groups

[0132] In this invention, the hydrophobic group is the core component for regulating the hydrophilicity and hydrophobicity of the interface, and is used to maintain the hydrophobic state of the dam body before the probe breaks.

[0133] The hydrophobic group is preferably a straight-chain saturated alkyl group with the structural form: -(CH2). n-1 CH3, where n is an integer between 10 and 20, more preferably 12 (i.e., dodecyl).

[0134] In a preferred embodiment, the hydrophobic end is a dodecyl chain, which can be linked to single-stranded nucleic acid via phosphate modification or 3′-base coupling. It can also be designed with special labeling groups, such as haloalkyl groups, fluorophores, or dyes, to enhance color development or response signals.

[0135] In some embodiments, the hydrophobic group may also be replaced by halogens such as fluorine and chlorine to enhance its hydrophobicity and surface shielding effect.

[0136] In this invention, the connection between the hydrophilic linking group and the switching switch, and between the switching switch and the hydrophobic group, can all be accomplished by known synthetic methods, including:

[0137] Phosphodiester bond;

[0138] The ester bond between the 3′ hydroxyl group and the phosphate group;

[0139] Amide linkages formed by amidation reactions.

[0140] The order of connection of each group can be adjusted according to actual design needs. For example, hydrophilic PEG can be fixed on the chip surface by 5′ amino modification, and hydrophobic alkyl groups can be connected to the end of the switching device by 3′ end modification.

[0141] Through the above structural combination, the probe forms a hydrophobic molecular dam through dense arrangement. When the target nucleic acid is present and recognized, the single-stranded nucleic acid in the middle of the probe is cut. After the structure breaks, the hydrophobic group falls off, thereby changing the dam area from a hydrophobic state to a hydrophilic state, completing the signal transduction process.

[0142] probe-substrate connection

[0143] To achieve the hydrophobic-to-hydrophilic transition behavior of the interface, this invention employs a functional probe with a specific structure, which is covalently immobilized on a designated reaction region of the chip substrate through multi-step chemical modification. Amino and aldehyde groups are gradually introduced by functionalizing hydroxyl groups on the glass surface, achieving stable immobilization with the amino-modified probe. A common approach is to hydrophilically or functionalize the substrate surface, followed by functional group modification of the substrate surface and / or probe ends using bridging reagents. Groups that can be used for modification include, but are not limited to, amino, carboxyl, hydroxyl, mercapto, sulfonic acid, biotin, and streptavidin, which are then linked via aldehyde-amine reactions, amide bonds, or biotin-streptavidin interactions. Methods known in the art can also be applied to control the density of probe modification, for example, by adjusting parameters such as probe concentration and reaction time to control its density distribution.

[0144] In a preferred embodiment, the substrate is a glass substrate.

[0145] In the fabrication of dual-detection chips, the main surface treatment process is the same as that of single-detection chips. However, dual-detection chips achieve specific modification of two crRNAs targeting different nucleic acids (e.g., influenza A virus RNA and influenza B virus RNA) by constructing hydrophobic isolation regions. This crRNA, together with the previously modified probes, forms a response interface, endowing each dam with an independent response function. This eliminates the need to add crRNA separately to the sample solution in subsequent dual detection, simplifying the operation process.

[0146] For crRNA immobilization, the crRNA can first be amino-modified, for example, to prepare crRNA with an NH2+C6 chain. Then, similar to the method used for probe immobilization, the crRNA can be immobilized onto the isolation structure. The concentration of crRNA used for immobilization can be 10-100 nM, preferably 20-50 nM, for example 40 nM.

[0147] The fabrication of the chip may include the following: etching functional regions on the substrate surface, fixing probes to a composite isolation structure, optionally fixing crRNA to the composite isolation structure; optionally performing hydrophobic modification to construct a hydrophobic signal enhancement region.

[0148] In some embodiments, the chip fabrication steps are as follows: patterning the structure on the substrate surface by etching; treating the substrate with FAS-17 to make it superhydrophobic; patterning the functional areas by etching; amylating the substrate surface by APTES treatment; treating the substrate surface with glutaraldehyde to introduce aldehyde groups; fixing probes; and removing all fixed probes from the substrate surface except for the isolation structure region by laser.

[0149] In some embodiments, the chip fabrication steps are as follows: structural patterning by etching the substrate surface, and further patterning of functional regions; superhydrophobic treatment of the substrate by FAS-17 treatment; introduction of hydrophobic isolation regions by laser etching; amylation of the substrate surface by APTES treatment; introduction of aldehyde groups by glutaraldehyde treatment on the substrate surface; probe immobilization; immobilization of specific crRNAs; removal of all immobilized probes and crRNAs from the substrate surface except for the isolation structural regions by laser; optionally, etching of an automated replenishment system.

[0150] In a preferred embodiment, the crRNA immobilized in the dam region incorporates a self-cleavage site for the Cas13a protein response group (6U). Upon activation, the Cas13a protein can degrade the response group to form a locally free state, expanding the degradation range of the three-segment probe. This results in the degradation of a large number of surrounding three-segment probes, efficiently triggering the hydrophobic-to-hydrophilic transition of the molecular dam surface. This design effectively solves the spatial limitation problem of crRNA, allowing it to migrate to a wider area after recognizing and activating the target nucleic acid, mediating efficient cleavage and amplification of downstream probes. Without this self-cleavage release mechanism, crRNA only functions near its fixed location, limiting the probe cleavage range and reducing signal amplification efficiency. Therefore, by pre-modifying crRNA with a self-cleavage site in the dam region, not only is specific spatial localization modification achieved, but the subsequent automatic release mechanism also significantly improves probe cleavage capability and overall system sensitivity, ensuring the response effect and detection throughput of the dual detection platform.

[0151] In this invention, the probe is preferably a functional probe with a primary amine group, the structure of which includes a hydrophilic group, a switching element (such as a single-stranded nucleic acid), and a hydrophobic alkyl chain. For example, a suitable probe structure for RNA targets is NH2-(CH2)6-(PEG6)2-6U-(CH2). 12 The probe structure suitable for DNA targets can be NH2-(CH2)6-(PEG6)2-15T-(CH2). 12 The probe modification solvent can be RNase-free ethanol or purified water, preferably at a concentration of 0.5-10 μM, more preferably 0.5-5 μM, for example 1 μM. The reaction time is usually 60 minutes, but the specific time is optimized based on the probe sequence and substrate condition.

[0152] Through the above steps, the present invention provides a chip modification method with high connection efficiency, good surface uniformity and accurate spatial positioning, which is suitable for the stable construction of single and dual nucleic acid detection platforms, and further improves the consistency of interface functions and multi-target response capability.

[0153] In a specific implementation, the RNA probe used is shown below:

[0154]

[0155] The DNA probes used are shown below:

[0156]

[0157] In this invention, the term "hydrophilic" refers to a substance having a strong affinity for water and being able to attract water molecules. In this invention, "exhibiting hydrophilicity" at the substrate surface / reaction region interface means that the substrate surface / reaction region interface is easily wetted by water and exhibits an affinity for water.

[0158] In this invention, the term "hydrophobic" refers to the mutual repulsion between a substance and water. In this invention, "hydrophobicity" of the substrate surface / reaction region interface means that the substrate surface / reaction region interface exhibits a repulsive effect on water.

[0159] Identification reagents

[0160] The recognition reagent described in this invention is the CRISPR / Cas system, present in most bacteria. The CRISPR / Cas system is an immune system used to recognize and destroy invading pathogenic bacteria. In the CRISPR / Cas system, CRISPR (clustered regularly spaced short palindromic repeats) contains DNA segments with short, repeating base sequences from the bacterial genome, as well as stored pathogen DNA segments to allow the cell to recognize any pathogens attempting to re-invade. The RNA sequence (crRNA) transcribed from CRISPR is also present.

[0161] In this paper, the term "CRISPR / Cas system" refers to two types of CRISPR / Cas systems that utilize a single effector protein to defend against the invasion of exogenous nucleic acids, enabling simple and efficient gene editing and nucleic acid detection. The two most typical CRISPR / Cas systems are CRISPR / Cas12a (Cpf1) and CRISPR / Cas13a (C2C2). In this paper, Cas (CRISPR-associated protein) is a nuclease guided by crRNA. crRNA is a specific nucleic acid sequence that guides CRISPR / Cas proteins to recognize and cleave target nucleic acid molecules; it can be synthesized through in vitro transcription or artificial chemical synthesis.

[0162] CRISPR / Cas12a not only efficiently recognizes and cleaves specific DNA double-stranded sequences (dsDNA, which contains a sequence complementary to crRNA and recognized by crRNA) in a prototypical spacer region-adjacent motif (PAM) dependent manner, but also cleaves any single-stranded DNA (ssDNA) when activated by specific DNA double-stranded sequences (such as the target nucleic acid sequence described herein) to form a CRISPR / Cas / dsDNA ternary complex. These properties enable CRISPR / Cas12a to improve detection sensitivity, specificity, and speed. Therefore, in some embodiments, the CRISPR / Cas12a system is preferred.

[0163] In a specific implementation, the Cas12a may be LbuCas12a.

[0164] In CRISPR / Cas13a, the CRISPR / Cas13 system functions as an "adaptive" immune system in archaea and bacteria to defend against invading RNA. The CRISPR-Cas13a system consists of two parts: the Cas13a protein and gRNA. Mechanistically, the Cas13a protein forms a complex with a specific gRNA. This complex interacts with intracellular RNA molecules, and once a target RNA sequence complementary to the gRNA is found, Cas13a performs a double-strand cut within that region. More importantly, once this cleavage activity of Cas13a is activated, it degrades cellular RNA in a more widespread manner, a phenomenon known as RNA damage diffusion.

[0165] Mechanism of action of Cas13a protein. The CRISPR / Cas13a system cleaves the sequence complementary to the single-stranded RNA and crRNA spacer after recognizing the target sequence. The target sequence has a protospacer flanking site (PFS) at the 3' end, which is usually adenosine (A), uracil (U), and cytosine (C).

[0166] Another special feature of Cas13a is that once Cas13a recognizes and cleaves the RNA target specified by the crRNA sequence, it enters an enzymatic "activated" state. At this point, it will bind to and cleave other RNAs, regardless of whether they are homologous to the crRNA or whether PFS exists.

[0167] In this application, commercially available Cas12a and Cas13a, along with their reaction solutions, can be used as recognition reagents or recognition elements. For example, LbuCas12a and LwaCas13a, purchased from Shanghai Huicheng Biotechnology Co., Ltd., can be used.

[0168] The recognition reagent works synergistically with the molecular dam to form a signal conversion interface driven by the CRISPR / Cas system. In the presence of the target nucleic acid, the target nucleic acid binds to crRNA and activates the Cas protein, which non-specifically cleaves a large number of probes, causing the probes with originally stable structures to break. This leads to a mutation in the wettability of the substrate surface, thereby triggering a mutation in the liquid distribution state (e.g., dam collapse, liquid drainage). This is then detected and identified through visual signals, enabling visual detection of nucleic acids without instruments.

[0169] In practical implementation, the crRNA can be designed according to detection requirements. As an example, for detecting RNA-related diseases, the N gene of SARS-CoV-2, the PB2 gene of influenza A virus, and the PB1 gene of influenza B virus can be selected as preferred examples.

[0170] For example, the N gene sequence of the novel coronavirus can be NCBI: NC_045512.2; the PB2 gene sequence of influenza A virus can be NCBI: NC_002023.1; and the PB1 gene sequence of influenza B virus can be NCBI: NC_002204.1.

[0171] The available gRNAs for the above genes are as follows:

[0172] crRNA used to detect the N gene of the novel coronavirus:

[0173] GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACUCUGAGGGUCCACCAAACGUAAUGCGGG (SEQID NO: 1)

[0174] crRNA used to detect the PB2 gene of influenza A virus:

[0175] GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACUCCUAUUCCACCAUGUCACAGCCAGAGG (SEQID NO: 2)

[0176] NH2C6 / UUUUUU GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACUCCUAUUCCACCAUGUCACAGCCAGAGG (SEQ ID NO: 3)

[0177] crRNA used to detect the PB1 gene of influenza B virus:

[0178] GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACUCCAAUGUUUUUGAUGCCUAGUGCCUGCU (SEQ ID NO: 4)

[0179] NH2C6 / UUUUUU GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACUCCAAUGUUUUUGAUGCCUAGUGCCUGCU (SEQ ID NO: 5)

[0180] Additional reagents or components

[0181] In a preferred embodiment, the composition may also contain pigments (such as phenol red) for displaying detection results.

[0182] biological samples

[0183] The chip-based nucleic acid sensor, composition, reagent kit, and accompanying usage method described in this invention can be applied to both diagnostic and non-diagnostic purposes, and can also be used in clinical testing or non-clinical analysis scenarios, covering multiple fields such as medical testing, food safety, biological product quality control, environmental pollution monitoring, and animal and plant disease screening. In this invention, the nucleic acid to be tested can be derived from naturally occurring biological systems, or obtained through artificial biosynthesis or chemical synthesis. In a preferred embodiment, the nucleic acid to be tested is a natural nucleic acid derived from a biological sample.

[0184] In this invention, the nucleic acid target may be present in a liquid sample, or it may be extracted from a solid or semi-solid sample and converted into a liquid sample through a simple pretreatment operation. Suitable liquid samples for this invention may be selected from, but are not limited to: environmental samples (such as groundwater, surface water, seawater, sewage and their derivatives), food testing samples (such as fruit and vegetable extracts, meat juices, dairy product extracts), extracts from cosmetics or pharmaceuticals, etc. More preferably, the sample is a bodily fluid sample derived from a living organism, particularly a bodily fluid sample derived from a human or animal subject. The bodily fluid sample may include, but is not limited to: blood, plasma, serum, saliva, sputum, nasopharyngeal swab wash, urine, cerebrospinal fluid, tears, tissue exudate, bronchoalveolar lavage fluid, pleural effusion, ascites, etc.

[0185] In a preferred embodiment, the chip sensing platform is suitable for biological samples that have undergone simple pretreatment, for direct loading and nucleic acid detection. For example, for pharyngeal or nasal swab samples from patients with upper respiratory tract infections, the samples can be lysed with lysis buffer and then directly added to the reaction dam area for detection; for blood or tissue homogenates from animal disease samples (such as avian influenza), the samples can be homogenized, centrifuged, and nucleic acid extracted before being loaded into the chip.

[0186] In some implementations, to improve detection accuracy and sensitivity, samples may be pretreated to enrich nucleic acids, release target molecules, or remove components that may interfere with detection. Sample pretreatment methods may include, but are not limited to, mechanical disruption, ultrasonication, heat-freeze cycling, enzymatic lysis, centrifugation, and microfiltration. Depending on the sample type, appropriate pretreatment reagents may also be added, such as surfactants (e.g., Triton X-100), proteases (e.g., Proteinase K), helicases, RNA stabilizers, and anti-nucleases. Those skilled in the art can select appropriate pretreatment methods based on the type of sample and downstream detection requirements to ensure sufficient release of target nucleic acids without affecting the performance of the subsequent CRISPR reaction system.

[0187] In a preferred embodiment of the present invention, the sample pretreatment process can be simplified into a convenient "one-step lysis + quantitative sample loading" procedure, which is particularly suitable for scenarios requiring ease of operation, such as home self-testing, primary healthcare sites, or rapid field screening. This design further enhances the practicality and promotional value of the chip-based nucleic acid sensor of the present invention in portable, rapid-response POCT applications.

[0188] Reagent test kit

[0189] This application also provides a kit for detecting nucleic acids, the kit comprising the aforementioned chip and CRISPR / Cas recognition reagents.

[0190] In some implementations, the CRISPR recognition reagent is provided in lyophilized form and contains a Cas protein (such as Cas12a, Cas13a, etc.) with sequence-specific targeting cleavage activity and a crRNA complementary to the target nucleic acid sequence.

[0191] In some embodiments, the kit also includes auxiliary reagents, including lysis buffer (preferably in solution form).

[0192] In some embodiments, the kit further includes a sampling device, including a sampling swab for collecting liquid or swab samples, and a sample preservation solution for preserving and transporting the samples.

[0193] Detection methods

[0194] In embodiments of the present invention, the chip-type nucleic acid sensor or its composition described herein can be used to perform rapid, sensitive, and visualized detection of target nucleic acids in the sample to be tested. The present invention further provides a nucleic acid detection method based on changes in liquid motion state. This method does not rely on precision instruments; results can be determined solely by visual observation, making it suitable for applications such as point-of-care testing (POCT).

[0195] The detection method includes the following steps:

[0196] The test sample is mixed with the recognition reagent to obtain a reaction system. This reaction system contains the test sample, the CRISPR / Cas system recognition complex, and a buffer system. Note that in the single detection chip, crRNA is added as a solution component, while in the dual detection chip, crRNA is pre-modified in the dam region. The reaction solution is then dropped into the sample loading area of ​​the chip of this invention, allowing it to interact with the pre-modified reagents (e.g., functional probes) on the chip.

[0197] During the reaction, if the target nucleic acid is present in the sample, the CRISPR / Cas system will be specifically activated, triggering its non-specific cleavage activity to continuously cleave the probe molecules modified on the surface of the dam area. Probe breakage will cause the dam interface to change from hydrophobic to hydrophilic, causing the dam to "disintegrate," thereby inducing visible changes in the liquid state, such as spontaneous diffusion and drainage.

[0198] This method determines the presence of target nucleic acid by observing changes in the liquid's movement. This change manifests as the liquid rapidly flowing from a static state in the sample loading chamber to a state of rapid movement towards the flow channel. In practice, a blank control (a reaction system without nucleic acid) can be used as a reference to clarify the results.

[0199] In a preferred embodiment, mixing and incubation can be carried out at room temperature, and the reaction time is preferably 1-15 minutes, more preferably 5-10 minutes. The specific time can be adjusted appropriately according to the type of target nucleic acid, probe density, reaction dam design, and reaction system concentration.

[0200] In some implementations, the sample to be tested may undergo necessary pretreatment before use, such as viral lysis or nucleic acid release, to improve detection sensitivity and reaction efficiency. Commonly used pretreatment methods include enzyme lysis, thermal lysis, and chemical lysis.

[0201] In the method of this invention, the recognition complex is composed of a CRISPR / Cas13a system, with a crRNA concentration of 10 nM to 1 μM; preferably 40 nM. The ratio of crRNA to Cas protein ranges from 0.25 to 4:1; the optimal ratio is 1:2.

[0202] This method does not rely on optical, fluorescent, or electrochemical readout devices and features fast response, high sensitivity, ease of operation, and strong adaptability. In specific implementations, for chip platforms using glass slides as substrates, the movement change can be manifested as a significant change in the state of the reaction solution flowing from the sample application area to the flow channel, allowing users to directly visually determine the presence or absence of the target nucleic acid. It is particularly suitable for on-site testing in resource-constrained environments, home self-testing, or mobile healthcare scenarios.

[0203] Example

[0204] The present invention has been further illustrated by the following embodiments, which should not be considered as further limitations on the invention. Unless otherwise stated, the reagents involved in the following embodiments are all commercially available and conventionally permitted in the art.

[0205] Example 1: Preparation of nucleic acid samples

[0206] Regarding sample pretreatment and extraction: The N gene of the novel coronavirus was prepared using the pUC57-2019-nCoV-N plasmid from GenScript through amplification and transcription. The specific amplification and transcription process is as follows:

[0207] For the amplification reaction, the reaction system (50 μL) consisted of 100 ng plasmid DNA, 500 nM forward primer, 500 nM reverse primer, 750 μM dNTP, 5 U Taq DNA polymerase, and 1× PCR buffer. PCR conditions were: a 95°C hot start for 4 minutes, followed by cycles of 95°C for 20 seconds, 55°C for 30 seconds, and 72°C for 60 seconds, for a total of 40 cycles. The forward primer contained the T7 promoter, and the amplification product served as a transcription template, generating the corresponding RNA transcript via T7 transcription. For the transcription reaction, the reaction system (50 μL) consisted of 8 μL PCR product, 1 mM NTP, 250 U T7 RNA polymerase, and 1× RNA Pol reaction buffer (40 mM Tris-HCl, 2 mM spermidine, 1 mM DTT, 6 mM MgCl2, pH 7.9). Reaction conditions were: the mixture was incubated at 37°C for 5 hours, followed by the addition of 5 U DNTase I to the mixture to digest the DNA template. Finally, transcripts were purified using an RNA purification kit (from Hunan Aikerui Biotechnology Co., Ltd.) and quantified using a Nanodrop 2000 (Thermo Fisher Scientific).

[0208] The PB2 gene of influenza A virus is derived from the PR8 strain (A / Puerto Rico / 8 / 1934(H1N1)). RNA extraction, subsequent amplification, and in vitro transcription steps are as follows:

[0209] First, viral RNA was extracted from the supernatant of PR8 virus culture in MDCK cells, purified using the QIAamp Viral RNA Mini Kit (Qiagen) according to the manufacturer's instructions. To obtain the PB2 gene fragment, reverse transcription polymerase chain reaction (RT-PCR) was used for amplification. The RT-PCR reaction mixture (25 μL) consisted of 12.5 μL 2×ExBuffer, 0.5 μL RT enzyme, 0.5 μL ExTaq enzyme, 1 μL forward primer, 1 μL reverse primer, 2 μL viral RNA template, and 7.5 μL RNase-free water. The amplification program was as follows: reverse transcription at 37°C for 15 minutes; denaturation at 85°C for 5 minutes; pre-denaturation at 95°C for 30 seconds; then 40 cycles: 95°C for 10 seconds, 55°C for 30 seconds, extension at 72°C for 30 seconds; and a final extension at 72°C for 10 minutes. The forward primer used for amplification was pre-conjugated with the T7 promoter sequence for subsequent in vitro transcription. After confirming the size of the PCR product by agarose gel electrophoresis, it was used as a template for T7 RNA polymerase transcription. In vitro transcription was performed using the HiScribe T7 Fast High-Yield RNA Synthesis Kit (NEB), with a reaction volume of 50 μL: 1× transcription buffer, 1 mM of each NTP, T7 RNA polymerase, and 8 μL of amplification product; the transcription reaction was incubated overnight at 37°C (approximately 16 hours). After transcription, DNase I (5 U) was added and incubated at 37°C for 30 minutes to degrade the DNA template. The resulting RNA product was purified using Beckman Coulter RNAClean XP magnetic beads (at a 1:1.8 volume ratio), and RNA concentration and quality were measured and evaluated using a Nanodrop 2000 spectrophotometer (ThermoFisher Scientific). The purified PB2 RNA was used as a detection target in the downstream CRISPR / Cas13a system.

[0210] For the PB1 gene of influenza B virus, the PB1 gene template is a 500 bp double-stranded DNA fragment synthesized by Integrated DNA Technologies (IDT). This DNA fragment is amplified by PCR and transcribed in vitro. The specific amplification and transcription process is as follows:

[0211] In the amplification reaction, the reaction system consisted of 50 μL: 100 ng PB1 plasmid DNA, 500 nM forward primer (containing the T7 promoter sequence), 500 nM reverse primer, 750 μM dNTPs, 5 U Taq DNA polymerase, and 1× PCR buffer. The PCR conditions were: 95°C pre-denaturation for 4 minutes, followed by 40 cycles, each cycle consisting of 95°C denaturation for 20 seconds, 55°C annealing for 30 seconds, and 72°C extension for 60 seconds. The PCR amplification product contained the T7 promoter sequence and could be directly used as a template for in vitro transcription. The transcription reaction system consisted of 50 μL: 8 μL PCR product, 1 mM of each NTP, 250 U T7 RNA polymerase, and 1× T7 RNA polymerase buffer (40 mM Tris-HCl, pH 7.9, 6 mM MgCl2, 2 mM spermidine, 1 mM DTT). After incubating the reaction system at 37°C for 5 hours, 5 UD Nase I was added to digest the DNA template. The RNA product was then purified using an RNA Clean Kit, and its concentration and quality were determined using a Nanodrop 2000 (Thermo Fisher Scientific).

[0212] The primers used are shown below:

[0213] Regarding the N gene of the novel coronavirus:

[0214] Forward primer sequence: AATTTCTAATACGACTCACTATAGGGCCAAATTGGCTACTACCGAAGAGCTAC (SEQ ID NO: 6)

[0215] Reverse primer sequence:

[0216] CACAGTTTGCTGTTTCTTCTGTCTCTGCGG (SEQ ID NO: 7)

[0217] For the PB2 gene of influenza A virus:

[0218] Forward primer sequence:

[0219] TAATACGACTCACTATAGGACAGGAGAAGAACCCAGCA (SEQ ID NO: 8)

[0220] Reverse primer sequence:

[0221] GAGATCTGCATGACCAGGAT (SEQ ID NO: 9)

[0222] For the PB1 gene of influenza B virus:

[0223] Forward primer sequence:

[0224] GAAATTAATACGACTCACTATAGGGTTGATGAGCTGGAGCCA (SEQ ID NO: 10)

[0225] Reverse primer sequence:

[0226] TGCAGTCCATCCCATAAGTAT (SEQ ID NO: 11)

[0227] Example 2: Preparation and Application Method of Nucleic Acid Detection Chip Based on Hydrophobic-to-Hydrophilic Interface Change

[0228] This embodiment fabricates a glass chip that, in response to the activation reaction of a target nucleic acid via a CRISPR / Cas system, drives the chip surface to change from hydrophobic to hydrophilic, thereby altering droplet motion behavior. This method, based on the change in interfacial wettability after probe cutting, enables rapid amplification and visual interpretation of nucleic acid signals, making it suitable for home-based detection of nucleic acid targets such as respiratory viruses in point-of-care testing (POCT) scenarios.

[0229] The chip fabrication steps are as follows:

[0230] For single-chip (its fabrication process diagram is shown below) Figure 1 As shown in A), specifically including:

[0231] Step 1. Patterning of chip surface structure: A UV laser marking machine (purchased from Wuhan Harmony Tianyu Laser Marking Co., Ltd., product model: HT-UV-10) was used to pattern microstructures on the surface of a glass slide (76.2 mm × 25.4 mm) to expose the hydroxyl groups on the glass surface; the pattern is 22 mm wide and 43 mm long (rectangular), which serves as the chip substrate (laser parameter settings are shown in Table 1).

[0232] Table 1. Laser parameter settings

[0233]

[0234] Step 2. FAS-17 (1H,1H,2H,2H-perfluorodecyltrimethoxysilane) treatment: Immerse the laser-treated glass slide in a 0.1% (v / v) FAS-17 / toluene solution and react at room temperature for 60 minutes; then wash the modified glass slide with deionized water and ethanol; finally, dry the obtained glass slide at 60°C for 5 minutes to perform superhydrophobic treatment.

[0235] Step 3. Functional Area Patterning: Using the laser patterning system from Step 1, four functional areas are patterned on the chip substrate. These four functional areas are: a sample loading cell (18 mm diameter, 0.3 mm depth), a flow channel (3 mm width, 20 mm length, 0.3 mm depth), a composite dam (0.09 mm thickness, 3 mm width, 0.27 mm height), and a collection area (6 mm diameter, 0.3 mm depth). (Specific parameters and locations are as follows...) Figure 1 As shown in B).

[0236] Step 4. APTES (3-aminopropyltriethoxysilane, as a silane coupling agent) treatment: Immerse the glass slide treated in Step 3 in a 60% (v / v) APTES / ethanol solution and react at room temperature for 60 minutes; then wash the glass slide with ethanol and dry it at 60°C for 5 minutes to amination the surface of the functional area.

[0237] Step 5. Glutaraldehyde treatment: The glass slide was reacted with a glutaraldehyde solution (final glutaraldehyde concentration 41.7%, in sodium bicarbonate buffer, pH 7.5) at room temperature for 60 minutes to further modify the surface of the chip functional area to introduce aldehyde groups; then, the glass slide was washed with deionized water and ethanol in sequence; finally, the glass slide was dried at 60°C for 5 minutes.

[0238] Step 6. Probe Immobilization: The 5'-terminal amino-terminated triblock probe is immobilized on the chip surface via an aldehyde-amine condensation reaction. In short, 600 µL of an ethanol solution of the 1 µM probe is dropped onto the surface of the chip's functional region and reacted at room temperature for 60 minutes; subsequently, the chip is rinsed with ethanol and dried at room temperature for 30 minutes.

[0239] Step 7. Laser Replicating: Using the laser patterning system from Step 1, the three-segment probes fixed on the surface, excluding the dam area, are removed to form a composite dam.

[0240] For dual-chip (its fabrication process diagram is shown below) Figure 2 As shown in A), specifically including:

[0241] Step 1. Chip surface structure patterning: Microstructures are patterned on the surface of a 50 mm × 50 mm glass slide using the laser patterning system described above for subsequent chemical modification (laser parameter settings are shown in Table 1).

[0242] Step 2. Patterning the ribbon: Follow Figure 2The structure shown in B uses a laser patterning system to pattern the surface of a glass slide, forming functional areas, including a sample loading cell (18 mm in diameter, 0.3 mm in depth), composite dam 1 (0.09 mm thick, 3 mm wide, 0.27 mm high), composite dam 2 (0.09 mm thick, 3 mm wide, 0.27 mm high), flow channel 1 (3 mm wide, 10 mm long, 0.3 mm deep), and flow channel 2 (3 mm wide, 10 mm long, 0.3 mm deep) (see...). Figure 2 B of II).

[0243] Step 3. FAS-17 treatment: Immerse the laser-treated glass slide in a 0.1% (v / v) FAS-17 / toluene solution and react at room temperature for 60 minutes; then wash the modified glass slide with deionized water and ethanol; finally, dry the obtained glass slide at 60°C for 5 minutes to perform superhydrophobic treatment.

[0244] Step 4. Formation of hydrophobic isolation region: In order to construct a specific molecular dam in the dual chip, a hydrophobic isolation region (i.e., retaining the hydrophobicity of the middle position of the sample loading cell to achieve the purpose of dividing it into upper and lower regions, 18 mm long and 2 mm wide) was introduced into the sample loading cell by laser etching. This effectively divided the chip into two structurally independent parts (A and B) for immobilizing different crRNAs respectively.

[0245] Step 5. APTES treatment: Immerse the glass slide in a 50% (v / v) APTES / ethanol solution and incubate at room temperature for 60 minutes; then rinse the slide with ethanol and dry it at 60°C for 5 minutes to amination the upper and lower parts of the chip functional area.

[0246] Step 6. Glutaraldehyde treatment: To immobilize the amino-modified triblock probe and crRNA on the chip surface to construct a specific dam structure, 200 µL of glutaraldehyde solution (final glutaraldehyde concentration 41.7%, in sodium bicarbonate buffer, pH 7.5) was added to two separate portions of the chip surface; then, the glass slides were incubated at room temperature for 60 minutes to achieve aldehyde modification; after the reaction, the glass slides were rinsed sequentially with deionized water and ethanol; finally, the glass slides were dried at 60°C for 5 minutes.

[0247] Step 7. Probe Fixation: Since the solvent for the three-segment probe is ethanol, the hydrophobic isolation region prepared with FAS-17 in step 4 will not affect the probe solution; therefore, dropping the triblock probe solution onto the chip surface will effectively achieve uniform fixation of all chip functional areas. The detailed fixation procedure follows step 6 of the "Single Chip Fabrication Scheme".

[0248] Step 8. Position-Specific crRNA Immobilization: To construct different molecular dams, a hydrophobic isolation region (blocking the flow of aqueous crRNA) was introduced into the loading chamber in Step 4, allowing crRNA1 (targeting influenza A virus, IAV) and crRNA2 (targeting influenza B virus, IBV) to be individually loaded into fractions A and B, respectively. This strategy ensured the formation of crRNA-specific regions (fractions A and B) without cross-interference. Specifically, 200 µL of a 40 nM NH2C6-modified crRNA solution with self-cleavage sites (prepared with 1×PBS) was added to each designated fraction and reacted at room temperature for 60 minutes; then the surface was rinsed with ethanol and air-dried at room temperature for 30 minutes.

[0249] Step 9. Dam Construction: Except for the triblock probes and crRNAs retained on dams 1 and 2, all other immobilized triblock probes and crRNAs on the chip surface are removed using a laser patterning system to construct specific molecular dams. Furthermore, the hydrophobic isolation region within the sample loading chamber is etched using the same laser patterning process, transforming the sample loading chamber into a single, unified chamber for subsequent sample loading.

[0250] Step 10. Construction of the automated replenishment system: A laser patterning system is used to construct the directional transport structure within the dual-chip on the surface of the glass slide. The replenishment cell is fabricated on the left side of the sample loading cell and connected to the sample loading cell via a channel. The replenishment cell (12 mm in diameter, 0.3 mm in depth) and channel 3 (2 mm wide, 9 mm long, 0.3 mm deep) are also included.

[0251] In subsequent testing, the test solution is added dropwise to the sample application area. When a matching nucleic acid is present, the CRISPR / Cas system is activated, and the probe on the dam is specifically cleaved. As the probe breaks, the interface of the dam structure rapidly changes from hydrophobic to hydrophilic, causing the liquid to "break the dam and flow" automatically from the sample application pool to the flow channel area. Obvious liquid movement can be observed with the naked eye, indicating a positive result. If no target nucleic acid is present, the liquid remains still due to the hydrophobicity of the dam, indicating a negative result. Schematic diagrams of single and dual detection are shown below. Figure 3 As shown.

[0252] In a single-detection system, taking the detection of the N gene of the novel coronavirus as an example, the probe is selected from NH2-(CH2)6-(PEG6)2-6U-(CH2). 12The crRNA (SEQ ID NO: 1) was not pre-fixed to the dam region (but could also be fixed), but was added to the reaction solution along with the Cas13a protein, sample nucleic acid, etc. The reaction solution includes the components shown in Table 2 below. 600 μL of the reaction solution was added to the sample application area of ​​the prepared single-layer chip, reacted at room temperature, and observed. The observation was completed within 5 minutes (preferably within 2 minutes). The SARS-CoV-2 N gene RNA contained in the sample specifically binds to the crRNA and activates the Cas13a protein. The activated Cas13a can laterally cleave the functional probe fixed to the dam region, causing the dam region to change from hydrophobic to hydrophilic. Droplets break, collapse, or leak in the dam region, thus achieving a visually visible positive result. In this detection, the results of various concentrations of target nucleic acid in the detection embodiment of this application were tested (see...). Figure 4 This demonstrates that rapid detection is possible even when the target nucleic acid concentration is only about 10 aM (even within less than 2 minutes). The process requires no external instrument signal reading, is simple to operate, and has a rapid response.

[0253] In the dual detection system, taking the presence of influenza A virus RNA or influenza B virus RNA in the sample as an example, the probe is selected from: NH2-(CH2)6-(PEG6)2-6U-(CH2) 12 The crRNAs were pre-fixed, specifically crRNA (SEQ ID NO: 3) and crRNA (SEQ ID NO: 5). The reaction solution contained the components shown in Table 2. 1000 μL of the reaction solution was added to the sample loading and replenishment chambers of the prepared dual-chip array. The reaction was carried out at room temperature and observed within 5 minutes. In the corresponding dam region, the crRNA specifically recognized the target nucleic acid in the reaction solution, activating the lateral cleavage activity of Cas13a to cleave the probe on the dam surface. The dam lost its liquid-blocking ability, and the droplets exhibited significant dam-breaking behavior, flowing towards the drainage area. This achieved highly sensitive and visual dual detection of the target nucleic acid (see example of result interpretation). Figure 6 In this test, the results of various concentrations of the target nucleic acid in the detection embodiment of this application were tested (see...). Figure 7 This demonstrates that rapid detection is possible when the target nucleic acid concentration is approximately 100 aM, even when two target nucleic acids are present. By pre-immobilizing specific crRNA in two dam regions, the dual detection chip can simultaneously interpret two different target RNAs in the same detection process, eliminating the need to add crRNA to the reaction solution. This significantly improves operational simplicity and detection efficiency, making it suitable for the development of portable multi-channel POCT nucleic acid diagnostic platforms.

[0254] Specifically, to achieve signal amplification and automatic release mechanisms, the immobilized crRNA is artificially synthesized and contains autocleavage sites. This design allows the activated Cas13a to cleave the target RNA in the sample after the Cas13a-crRNA complex binds to the target, simultaneously releasing the crRNA-Cas protein-target complex through autocleavage. This releases the crRNA from its immobilized state on the dam, enabling it to further cleave more probes on the dam. This design solves the problem of traditional immobilized crRNA's inability to diffuse, limiting the probe's cleavage range, and greatly improves detection sensitivity and response speed.

[0255] The chip described in this embodiment is suitable for a pure physical observation platform without an external power supply or external force field. Combining the programmability of the CRISPR / Cas system, probe self-cutting design, and dam structure design, it demonstrates a new strategy for low-cost, high-sensitivity, and easy-to-operate home nucleic acid testing.

[0256] Table 2. Chip Sample Components

[0257]

[0258] Example 3: Actual Sample Detection

[0259] This embodiment uses the chip-type biosensor described in this invention to perform nucleic acid detection on real clinical samples. The chip structure is shown in Embodiment 2. Specifically, it includes single-target detection of the SARS-CoV-2 N gene using a single-detection chip, and simultaneous dual detection of the influenza A virus PB2 gene and the influenza B virus PB1 gene using a dual-detection chip. This embodiment further verifies the ease of operation, response sensitivity, and detection specificity of the described chip sensing platform under actual biological sample conditions.

[0260] First, all samples were pretreated using the HUDSON method to release nucleic acids and inactivate nucleases. Specifically, tris(2-carboxyethyl)phosphonate (TCEP) was added to the sample to be tested (e.g., nasopharyngeal swab preservation solution) to a final concentration of 100 mM, and ethylenediaminetetraacetic acid (EDTA) to a final concentration of 1 mM. The sample was heated at 50°C for 20 minutes, followed by heating at 95°C for 5 minutes to complete viral lysis and nucleic acid release.

[0261] In the single-chip detection, the probes were modified only in the dam region during chip fabrication, without pre-fixing crRNA. The target nucleic acid was the SARS-CoV-2 N gene RNA.

[0262] The detection steps are as follows: Mix the HUDSON-treated sample lysis buffer with the CRISPR / Cas reaction system (the composition is shown in Table 2. When detecting real samples, the sample to be tested is the HUDSON-treated sample lysis buffer), and then add 600 μL of the reaction solution to the chip sample cell for detection.

[0263] If the target nucleic acid is present in the sample, crRNA will guide the Cas protein to recognize the target and activate its side-cleavage activity, thereby cleaving the probe modified on the dam surface and inducing the dam surface to change from hydrophobic to hydrophilic. In this embodiment, different real samples were used for detection, and it can be seen that the chip of this application can display the detection results quickly and efficiently, and the results are consistent with the "gold standard" RT-PCR detection results (see...). Figure 5 The liquid thus breaks through the dam boundary, creating a visible flow, enabling rapid and highly sensitive detection response. In positive samples, the liquid exhibits obvious flow, while in negative samples, the liquid remains stationary, making the results clearly distinguishable.

[0264] In the dual-chip detection, the chips used were modified with two different crRNAs in two pre-defined dam regions during the fabrication process. These crRNAs target specific target sites of influenza A virus RNA and influenza B virus RNA, respectively, resulting in the dual-chip fabricated in Example 2. The crRNAs used were artificially synthesized and all contained self-cleavage sites. After binding to Cas13a, they could release themselves from the chip surface through self-cleavage, allowing the activated Cas13a to diffuse and cleave a larger probe region, thereby significantly enhancing signal amplification efficiency.

[0265] The detection steps are as follows: add the pretreated sample lysis buffer to the CRISPR / Cas reaction system (containing Cas protein and buffer, etc.) (the composition is shown in Table 2. When detecting real samples, the sample to be tested is the sample lysis buffer treated by HUDSON). Then, 1000 μL of the mixture is added to the sample loading cell and the replenishment cell of the chip for detection.

[0266] If the sample contains influenza A or B virus RNA, the crRNA modified in the corresponding dam region can bind to it and activate the Cas13a protein, triggering the hydrophobicity of the target dam surface to become hydrophilic, thereby causing a dam breach and flow diversion effect. In this embodiment, different real samples were used for detection, and it can be seen that the chip of this application can quickly and efficiently display the detection results, and the results are consistent with the "gold standard" RT-PCR detection results (see...). Figure 8 The detection results can be determined by observing whether the liquid has breached the dam boundary. Each dam serves as an independent detection unit, responding to a different viral nucleic acid target. If both influenza A and influenza B viral RNA are present simultaneously, liquid infiltration and flow will occur in both dams, providing clear and intuitive results.

[0267] In summary, this embodiment demonstrates that the chip-type biosensor platform described in this invention can perform highly sensitive detection of different targets in real samples, and is suitable for single and dual detection modes without the need for professional instruments, facilitating visual judgment and on-site application.

Claims

1. A chip for detecting nucleic acids based on a CRISPR / Cas system, the chip comprising one or more composite isolation structures, a sample loading cell, and a display area disposed on a substrate, wherein the sample loading cell and the display area are separated by the composite isolation structures, the composite isolation structures comprising physical isolation structures and molecular isolation structures, wherein the molecular isolation structures are probes disposed on the surface of the physical isolation structures, and the probes have the following structure: [hydrophilic linker]-[switch]-[hydrophobic group] or [switch]-[hydrophobic group], wherein the [switch] is a single-stranded nucleic acid chain.

2. The chip as described in claim 1, wherein, The CRISPR / Cas system is selected from the CRISPR / Cas12a system and the CRISPR / Cas13a system; Alternatively, the chip can be used to detect DNA or RNA; Alternatively, the substrate may be selected from glass substrates, silicon substrates, silicon dioxide substrates, indium tin oxide substrates, gold substrates, silver substrates, copper substrates, polydimethylsiloxane substrates, polymethyl methacrylate substrates, polycarbonate substrates, polyamide fiber substrates, polyvinyl chloride substrates, and polyethylene terephthalate substrates, preferably glass substrates.

3. The chip as described in claim 1 or 2, wherein, The physical isolation structure is a raised dam, and its height H1 is less than the depth H2 of the sample addition pool; Preferably, the height difference between the two is ΔH = H2 - H1, and the height difference ΔH ranges from 0.01 mm to 0.5 mm; More preferably, ΔH is between 0.01 mm and 0.05 mm, and more preferably 0.03 mm; Alternatively, the length L of the physical isolation structure perpendicular to the flow direction is preferably the same as or less than the width W of the display area; Alternatively, the thickness of the physical isolation structure in its liquid flow direction is T, where T is 10 μm ≤ T ≤ 500 μm; preferably, the thickness T is 50 μm ≤ T ≤ 200 μm; more preferably, the thickness T is 80-110 μm.

4. The chip according to any one of claims 1-3, wherein, The sample addition cell is circular with a diameter of 1-50 mm, preferably 15-25 mm; Alternatively, the depth H2 of the sample addition cell is 0.1-10 mm, preferably 0.2-0.5 mm; Alternatively, the length of the display area is 10-50mm, and the width W is equal to or greater than the length L of the composite isolation structure, preferably 1L≤W≤3L; Alternatively, the display area may be a flow channel, the depth H3 of which is equal to or greater than the depth H2 of the sample loading chamber, and the depth of the flow channel is between H2 and 1.5H2.

5. The chip according to any one of claims 1-4, wherein, The surface of the display area is hydrophilic; Alternatively, the surface of the sample addition cell may be hydrophilic; Alternatively, the crRNA in the CRISPR / Cas system is immobilized on the composite isolation structure; Alternatively, a liquid collection chamber may be provided at one end of the display area to receive liquid in the display area.

6. The chip according to any one of claims 1-5, wherein, The probe is selected from: [single-stranded RNA]-[CH3(CH2)] n-1 [Single-stranded DNA]-[CH3(CH2)] n-1 ]、[HO(CH2CH2O) m H or its derivatives]-[single-stranded RNA]-[CH3(CH2)] n-1 ] and [HO(CH2CH2O) m H or its derivatives]-[single-stranded DNA]-[CH3(CH2)] n-1 ], where m is an integer between 5 and 13, and n is an integer between 10 and 15; Optionally, when the nucleic acid being tested is RNA, use [single-stranded RNA]-[CH3(CH2)]. n-1 [] or [HO(CH2CH2O)] m H or its derivatives]-[single-stranded RNA]-[CH3(CH2)] n-1 [[Single-stranded DNA]-[CH3(CH2]] is used as a probe; when the nucleic acid being detected is DNA, [single-stranded DNA]-[CH3(CH2)] is used. n-1 [] or [HO(CH2CH2O)] m H or its derivatives]-[single-stranded DNA]-[CH3(CH2)] n-1 [Used as a probe.] 7. The chip according to any one of claims 1-6, wherein, The CRISPR / Cas13a system uses LwaCas13a; The CRISPR / Cas13a comprises crRNA and Cas13a protein, with the crRNA concentration ranging from 10 nM to 1 μM, and the ratio of crRNA to Cas13a protein ranging from 0.25 to 4:1, preferably 1:

2.

8. The chip according to any one of claims 1-7, wherein, The chip is a single detection chip with a set of composite isolation structures for detecting a target nucleic acid; The chip is a multiplex detection chip with multiple sets of composite isolation structures, and different crRNAs are fixed on the surface of each isolation structure for the simultaneous detection of multiple target nucleic acids.

9. The chip according to any one of claims 1-8, wherein, When crRNA is fixed to the composite isolation structure, the crRNA contains an autocleavage site; Alternatively, when the chip is a multi-detection chip, it also has an automatic liquid replenishment system; Alternatively, the chip may have a hydrophobic signal enhancement region. Preferably, the region other than the composite isolation structure, the sample cell, and the display area is a hydrophobic signal enhancement region.

10. A method for detecting nucleic acids using a chip as described in any one of claims 1-9, the method comprising: Add the reaction solution containing the sample to be tested into the sample loading cell and observe whether the reaction solution flows from the sample loading cell to the display area; If the sample contains the target nucleic acid, the CRISPR / Cas13 system binds to the target nucleic acid and activates its ability to cleave single-stranded RNA, thereby modifying the hydrophobicity of the surface of the composite isolation structure to hydrophilicity, allowing the reaction solution to flow from the sample loading chamber to the display area.

Images