Dual-nucleic acid library co-construction method for synchronous detection of plasma ecDNA and related RNA markers

Abstract

The invention provides a dual-nucleic acid library co-construction method for synchronous detection of plasma ecDNA and related RNA markers. The method comprises the following steps: firstly, extracting total free nucleic acid from the same plasma sample; then carrying out linear DNA digestion treatment; then removing ribosome RNA (Ribose Nucleic Acid); then carrying out reverse transcription reaction by using a chimeric primer with 6-9 random basic groups at the 3'end and a template conversion oligonucleotide sequence at the 5 'end to obtain single-stranded cDNA with universal joints at the two ends; next, the single-stranded cDNA is subjected to cyclization, and annular cDNA is formed; then carrying out rolling circle amplification on the ecDNA and the annular cDNA; and carrying out fragmentation, terminal repair, linker connection and PCR enrichment on the amplification product to obtain the dual-nucleic acid library for high-throughput sequencing. By adopting the method, the collaborative analysis of the DNA level and the RNA level of the trace sample is realized.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology and relates to a library construction method for next-generation sequencing (NGS). Specifically, it relates to a method that can simultaneously detect sequencing libraries such as extrachromosomal circular DNA (ecDNA), linear RNA (long non-coding RNA, new fusion transcripts) and circular RNA (such as circRNA) associated with ecDNA from the same plasma free total nucleic acid sample. Background Technology

[0002] Extrachromosomal circular DNA (ecDNA) is a circular DNA molecule that detaches from chromosomes. It is not related to circular mitochondrial DNA or certain circular viral DNA. ecDNA lacks centromeres and telomeres, therefore it does not follow Mendelian inheritance and is distributed unequally and randomly to daughter cells during cell division. ecDNA is a key driver of tumorigenesis, development, heterogeneity, and drug resistance, and its presence in plasma provides a promising new target for liquid biopsy of tumors.

[0003] ecDNA significantly accelerates tumor evolution through several unique mechanisms, especially in advanced and drug-resistant stages. First, regarding the efficient amplification and overexpression of oncogenes, ecDNA can carry multiple copies of oncogenes (usually linked head-to-head, forming a chimera), creating an independent "transcription factory." More importantly, ecDNA is a circular, open chromatin structure, making it easier for genes to access transcription machinery and enhancers. This leads to a geometric increase in oncogene expression levels, far exceeding amplification on chromosomes. This "super enhancer" effect allows tumor cells to gain a strong proliferative and survival advantage in a short period, driving rapid tumor development. Second, ecDNA drives tumor heterogeneity and rapid evolution. During cell division, it is randomly distributed; some daughter cells may acquire large amounts of ecDNA, while others may lose it. When faced with selective pressures from chemotherapy, targeted therapy, etc., those ecDNA cells carrying drug-resistant genes quickly gain dominance, leading to treatment failure. Furthermore, ecDNA can directly mediate treatment resistance and is highly malleable. Under drug stress, cells can acquire drug resistance immediately by generating new fusion genes or mutations "de novo" on ecDNA through complex recombination mechanisms. Additionally, ecDNA can also promote tumor metastasis.

[0004] When ecDNA in tumor cells functions, it is often accompanied by the production of a large number of abnormal transcripts (such as specific gene combinations or new fusion transcripts). This is a strong signal of the active presence of ecDNA in the tumor and highly predicts that the patient may face a worse prognosis and a higher risk of treatment resistance. Abnormal transcriptional signals captured by RNA sequencing can serve as strong indirect evidence of its active presence, associated with the following biological characteristics of ecDNA: First, open chromatin and highly efficient transcriptional properties. Compared to chromosomal DNA, the circular structure of ecDNA places its chromatin in a more open state. This open chromatin environment provides more efficient access opportunities for the transcription machinery, resulting in abnormally high transcription levels of the oncogenes it carries. Even after considering DNA copy number, its transcriptional activity is significantly higher than that of the same genes on chromosomes. Second, ecDNA readily produces novel fusion transcripts. The formation of ecDNA involves the breakage and reconnection of genomic DNA, and this rearrangement readily produces novel fusion transcripts. Novel fusion genes not present at the origin chromosome position, and a significantly increased frequency of transcript fusion on ecDNA compared to linear DNA amplification, indicate the presence of ecDNA. The detection of numerous "new" or "rare" fusion transcripts, particularly those involving known oncogenes, in RNA sequencing data suggests the existence of ecDNA. Furthermore, ecDNA exhibits "enhancer hijacking" and aberrant regulatory characteristics. It can carry and aggregate multiple distal regulatory elements such as enhancers. These potent enhancers may "hijack" oncogene promoters or engage in new interactions with promoters of different genes (i.e., "enhancer-promoter" relinking), driving abnormally high gene expression and potentially generating complex transcriptional signals, including non-coding RNA and antisense transcripts. Therefore, observing transcriptional features of ecDNA at the RNA level (i.e., abnormally high expression of oncogenes, numerous novel fusion transcripts, and non-coding or antisense transcript markers) essentially signifies the capture of key biological markers of high-risk tumor subgroups, highlighting the necessity of RNA-level transcript detection.

[0005] Currently, the detection of ecDNA mainly relies on three independent library preparation methods: The first method involves extracting total DNA from the sample and performing WGS (whole genome sequencing). Bioinformatics algorithms are used to statistically identify high copy number regions and trans-splicing sites to specifically label circular DNA, and then a database is used for annotation and analysis of tumor-associated ecDNA. This method is simple in its experimental aspects, but requires higher sequencing depth to improve the detection rate of specific sites. It is more suitable for tissue samples and is incompatible with samples containing trace amounts of DNA, such as plasma. The second method is Circle-seq, which is suitable for trace samples. It involves linearly digesting cell-free nucleic acids extracted from plasma, then amplifying and enriching the circular DNA using rolling circle amplification enzyme, followed by high-throughput sequencing library construction. The third method involves linearly digesting total DNA extracted from plasma and then constructing a library using Tn5 transposase (reference PMID: 31900366). In practical applications, this method is more suitable for standardized scenarios such as prenatal checkups for pregnant women due to the limitations of Tn5 enzyme on substrate quantity. For applications with significant individual differences, such as precision oncology testing, it is necessary to adjust the optimal reaction system for different samples. All three methods are independent library construction methods for detecting ecDNA.

[0006] Recent studies have shown that the main oncogene transcripts in tumors come from ecDNA, and transcripts with fusion mutations are directly associated with ecDNA. Therefore, dual nucleic acid detection of ecDNA and its associated RNA transcripts can not only determine the development process and activity level of ecDNA, but also match the medical significance of dual nucleic acid detection for precise drug use in commercial tumor tissues. As a result, dual nucleic acid (DNA and RNA) detection for guiding drug use in commercial tumor tissues has been widely used, and there are enough samples for surgical tissues to perform DNA and RNA detection separately. However, when this concept is applied to plasma liquid biopsy or dynamic monitoring, there are two main problems: (1) Sample quantity contradiction: The nucleic acid in plasma samples is extremely limited. If the limited samples are further divided for detection, there is a risk of missed detection even when using micro-library construction technology; (2) Technological interference contradiction: Although nucleic acid co-extraction technology can obtain DNA and RNA in one reaction tube at the same time, if the library is constructed separately, the residual RNA during the DNA library construction process will affect the efficiency of high-fidelity polymerase amplification, and the residual genomic DNA during the RNA library construction process will seriously interfere with the effective data of the RNA library, resulting in a decrease in the detection rate of fusion mutations.

[0007] In summary, ecDNA is a key driver of tumorigenesis, development, heterogeneity, and drug resistance. Its presence in plasma provides a promising new target for tumor liquid biopsy and dynamic monitoring after intervention. However, the levels of ecDNA and associated RNA in plasma are extremely low, and they coexist with a large number of linear cell-free genomic DNA fragments. Traditional library construction methods can only obtain partial information, requiring more complex procedures and higher costs to obtain ecDNA and associated RNA libraries, or relying on bioinformatics algorithms to infer information using common commercial DNA library construction methods. Currently, there is also no commercially available method for detecting ecDNA and its associated transcript RNA in plasma samples. Therefore, there is an urgent need for a novel library construction technology that is efficient, cost-effective, allows for parallel operation in a single tube, and accurately detects ecDNA and specifically associated RNA markers in plasma samples through multi-omics sequencing analysis. Summary of the Invention

[0008] The purpose of this invention is to provide a method for constructing a dual-nucleic acid library suitable for the simultaneous detection of ecDNA and related RNA biomarkers in trace plasma samples, overcoming the problems of high sample consumption, complex procedures, and inability to simultaneously detect ecDNA and associated RNA in existing technologies. To this end, this invention first performs total nucleic acid co-extraction on plasma samples, and then simultaneously constructs sequencing libraries of ecDNA and RNA (especially linear non-coding RNA and novel fusion transcripts) through processes such as removing linear DNA and ribosomal RNA. This enables synergistic analysis of the DNA level (ecDNA structure) and RNA level (transcriptional activity) of the tumor genome, significantly improving the information dimension and sensitivity of the detection, and providing a more powerful tool for the precise diagnosis and monitoring of tumors.

[0009] After co-extraction of total nucleic acids from plasma samples, specific enzymatic treatment and adapter design were used to simultaneously capture, enrich, and construct libraries for circular ecDNA and linear RNA molecules in the same reaction system. This method avoids nucleic acid loss and mutual interference in stepwise library construction, significantly improving detection sensitivity and the efficiency of multidimensional information acquisition.

[0010] Therefore, the present invention is achieved through the following technical solution:

[0011] As a first aspect of the present invention, a method for constructing a dual-nucleic acid library for simultaneous detection of ecDNA and related RNA biomarkers in plasma samples includes the following steps:

[0012] S1. Extract total free nucleic acid from the same plasma sample to obtain a mixed sample containing total free DNA and total free RNA;

[0013] S2. Perform linear DNA digestion on the mixed sample in S1 to degrade linear genomic DNA, thereby enriching ecDNA with digestion resistance.

[0014] S3. Remove ribosomal RNA from the system treated in S2 to obtain the reaction product;

[0015] S4. In the system treated in S3, reverse transcription was performed using chimeric primers with 6-9 random bases at the 3' end and template-converting oligonucleotide sequences at the 5' end to obtain single-stranded cDNA with universal adapters at both ends;

[0016] S5. The single-stranded cDNA obtained in S4 is circularized to form circular cDNA;

[0017] S6. Perform rolling circle amplification on the ecDNA in S2 and the circular cDNA in S5 to obtain amplification products.

[0018] S7. The amplification products from S6 are fragmented, end-repaired, adapter-ligated, and enriched by PCR to obtain a dual nucleic acid library that can be used for high-throughput sequencing.

[0019] According to the present invention, the reaction system is further purified between S5 and S6 to purify the ecDNA in S2 and the circular cDNA in S5 to remove residual enzymes, primers, salt ions and other impurities, so as to ensure the high efficiency of the downstream amplification reaction.

[0020] According to the present invention, the ribosomal RNA removal in S3 is performed using a probe repression method, wherein the probe is a DNA oligonucleotide probe complementary to human 18S ribosomal RNA and human 28S ribosomal RNA, wherein the 5' end of the DNA oligonucleotide probe is unmodified and the 3' end is deoxygenated; or, the ribosomal RNA removal in S3 is performed using a commercially available probe kit with ribosomal RNA blocking function.

[0021] Furthermore, the concentration of the DNA oligonucleotide probe is preferably 10 μM.

[0022] According to the present invention, the reverse transcription reaction system in S4 comprises:

[0023] 30 μL of the reaction product in S3;

[0024] 40 μM 3'N6 primer, 2.5 μL;

[0025] 40 μM 5'TSO primer, 2.5 μL;

[0026] 5 mM dNTPs, 2.5 μL;

[0027] Reverse transcriptase, 2.5 μL;

[0028] 20 U / μL RNase inhibitor, 3 μL;

[0029] Enzyme-free water, 2 μL;

[0030] The nucleotide sequence of the 3'N6 primer is shown in SEQ ID No. 1; the nucleotide sequence of the 5'TSO primer is shown in SEQ ID No. 2.

[0031] According to the present invention, the 5' end of the template-converting oligonucleotide sequence in S4 is phosphorylated.

[0032] According to the present invention, the circularization of the single-stranded cDNA in S5 is performed in any of the following ways:

[0033] (1) Denature and anneal the single-stranded cDNA with universal adapters, add a "bridging" oligonucleotide that is partially complementary to the adapter sequences at both ends of the cDNA, and then use T4 DNA ligase to achieve intramolecular circularization; or,

[0034] (2) The method uses the heat-stable CircLigase II single-stranded DNA ligase for direct cyclization.

[0035] According to the present invention, the rolling circle amplification in S6 is performed using Phi29 DNA polymerase at a temperature of 30℃-42℃.

[0036] Furthermore, the rolling circle amplification temperature is 42°C, which can improve amplification efficiency and specificity.

[0037] As a second aspect of the present invention, a dual nucleic acid library is characterized in that it is constructed using the method for co-construction of dual nucleic acid libraries for simultaneous detection of plasma ecDNA and related RNA markers as described in any of the preceding claims.

[0038] As a third aspect of the present invention, a kit for the simultaneous detection of plasma ecDNA and related RNA markers using a dual-nucleic acid library co-construction method is provided, comprising a primer combination for reverse transcription reaction, wherein the primer combination comprises a 3'N6 primer with 6-9 random bases at the 3' end and a 5'TSO primer with a template-converting oligonucleotide sequence at the 5' end, the nucleotide sequence of the 3'N6 primer being shown in SEQ ID No. 1; and the nucleotide sequence of the 5'TSO primer being shown in SEQ ID No. 2.

[0039] According to the present invention, the kit further includes one or more of the following components:

[0040] Linear DNA digestive enzymes;

[0041] Ribosomal RNA removal probe;

[0042] Reagents used for single-stranded DNA circularization;

[0043] DNA polymerase used for rolling circle amplification;

[0044] Reverse transcriptase, dNTP, and RNase inhibitors used in reverse transcription reactions;

[0045] Bridging oligonucleotides used for cyclization.

[0046] Further, the linear DNA digesting enzyme is a single-stranded exonuclease I and a double-stranded exonuclease (such as λ exonuclease); or, the linear DNA digesting enzyme is an ATP-dependent DNA enzyme Plasmid-Safe™ DNase.

[0047] Furthermore, the ribosomal RNA removal probe is a DNA oligonucleotide probe complementary to human 18S rRNA and 28S rRNA.

[0048] According to the present invention, the DNA polymerase used for rolling circle amplification is Phi29 DNA polymerase.

[0049] The present invention provides a method for co-constructing a dual-nucleic acid library for the simultaneous detection of plasma ecDNA and related RNA biomarkers. This method simultaneously enriches the target nucleic acid molecules, avoiding the interference problems mentioned in the background techniques (which ultimately result in circular DNA amplification) and meeting the requirements for valuable clinical samples. Specifically, the beneficial effects of the present invention include:

[0050] 1. This invention is the first to propose a technical process for constructing an ecDNA library from plasma samples.

[0051] 2. Multi-purpose and information-multiplying: For the first time, it has been realized to simultaneously prepare sequencing libraries of ecDNA and multiple associated RNA markers (circRNA, lncRNA, new fusion transcripts, etc.) from the same trace plasma sample, which greatly enriches the available molecular information dimensions, meets the application of precious clinical samples, and facilitates DNA-RNA synergistic biological analysis.

[0052] 3. Creative integration: The linear DNA digestion, template conversion reverse transcription, single-stranded cDNA circularization and rolling circle amplification technology are creatively integrated into a single process. Among them, the design of directly circularizing cDNA using bridging primers + T4 ligase or CircLigase II is the core innovation of the RNA information import RCA library construction pathway, which is not obvious.

[0053] 4. High sensitivity and efficiency: The exponential amplification of circular templates via RCA makes it particularly suitable for the detection of trace plasma samples, effectively improving the detection rate of ecDNA and low-abundance transcripts.

[0054] 5. Reduced costs and sample consumption: It avoids the double experimental costs, doubled throughput, and sample consumption associated with separate DNA and RNA library construction, making it particularly suitable for the efficient use of valuable clinical samples. Attached Figure Description

[0055] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0056] Figure 1 This describes the process for constructing a co-library of ecDNA and associated RNA.

[0057] Figure 2 The Qsep100 bioanalyzer was used to detect cDNA distribution at different dilution ratios of the repression probe. The 20bp and 1000bp peaks are markers, the middle peak represents DNA distribution, different colored peaks represent the results under different dilution conditions, and the integrated area under each peak represents the concentration of cDNA obtained.

[0058] Figure 3 Different rolling circle amplification temperature conditions were set for reaction components with different ribosome desaturation and repression probe ratios. After the same amount of nucleic acid underwent ribosome desaturation, cDNA synthesis, circularization, magnetic bead purification, and rolling circle amplification, the concentration of the amplification products was measured using a Qubit fluorometer.

[0059] Figure 4 This is a structural diagram of the pUC57 plasmid element. Detailed Implementation

[0060] The present invention will be described in detail below with reference to specific embodiments and examples, thereby making the advantages and various effects of the present invention more clearly apparent. Those skilled in the art should understand that these specific embodiments and examples are for illustrative purposes only and are not intended to limit the present invention.

[0061] Throughout this specification, unless otherwise specified, the terminology used herein should be understood as having the meaning commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In the event of any conflict, this specification shall prevail.

[0062] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.

[0063] The specific meanings of the terms used in this invention are as follows:

[0064] 1. The ecDNA mentioned in this invention is not limited by sequence length, including both larger ecDNAs (>1Mb) and ecDNAs with shorter sequences.

[0065] 2. The primer sequences (5' to 3') of this invention are shown in the figure.

[0066] 3'N6 primer: pTCAACGCAGAGTACVNNNNNN, where "p" indicates 5' phosphorylation modification;

[0067] 5' TSO primer: TGGTATCAACGCAGAGTACATrGrGrG, SEQ ID No. 2, "r" represents ribonucleotide;

[0068] Circulating primer: GTACTCTGCGTTGATGGTATCAACGCAGAGTAC, SEQ ID No. 3;

[0069] Exonuclease tolerance random primers: N*NNNN*N, SEQ ID No. 4, * indicates inter-base backbone thiolation modification;

[0070] ALK-EML4 fusion transcript RNA:

[0071] AGAGUCGGCGGUAUGUGAUAGGAAGAGCAGUGAAUGGGGAAUAACUGUGUUUAGUGGUUGGUCCUGGCUCUUAUGCAUAAUAGCCUUAUGACCUAGGCUGAAUGACAAUGUCUCUGAGUGGUUUUCUACUCUAAAUAUAGUAACUAGUAUCCUCCUGGCUGA UCAGGGGGUGGGGAGCUCCUUCAGUGUCCAUCACGAUGGUGAAAGCUCGCCCCCACCCCUAGACGUCACUUCUAGCUCCCACAUGCUUCCACCGGCGCAGCUCCUGUUUGGCUCCCACCCUAUGUAAUGCACUAGCCCACUCUUCCCCAAACCAGCCC,SEQ ID No.5;

[0072] pUC57 plasmid DNA sequence:

[0073]

[0074] Figure 1 This describes the construction process of the ecDNA and associated RNA co-library according to an embodiment of the present invention.

[0075] The method for constructing the ecDNA and associated RNA co-library of the present invention includes the following steps:

[0076] Step S1: Total Nucleic Acid Extraction from Plasma Samples. Total cell-free nucleic acid (cfNA) was extracted from plasma using a commercially available magnetic bead-based total nucleic acid extraction kit for plasma (Guangzhou Meiji Biotechnology Co., Ltd., catalog number R4316). Total cell-free DNA (cfDNA) and total cell-free RNA (cfRNA) were extracted from the plasma. This step ensured that both DNA and RNA originated from the same sample, laying the foundation for subsequent multi-omics association analysis.

[0077] Step S2: Digestion of linear DNA and enrichment of ecDNA

[0078] Add a mixture of exonucleases that specifically digest linear DNA to the extracted total nucleic acids. Specifically, a combination of single-stranded exonuclease I and double-stranded exonuclease (such as λ exonuclease) can be used, or the ATP-dependent DNA enzyme Plasmid-Safe™ DNase (Lucigen brand, LGC) can be used. This step is designed to efficiently degrade linear genome-derived DNA fragments, thereby enriching circular ecDNA with digestibility while preserving intact RNA molecules.

[0079] Step S3: Ribosomal RNA Removal. To meet the requirements of micro-starting amounts of nucleic acid RNA, rRNA probe repression is used here (other methods such as enzymatic digestion, biotin-modified probes, and streptavidin magnetic bead capture may not achieve the sensitivity required for micro-samples). A 60-65 nt DNA oligonucleotide sequence complementary to human 18S and 28S ribosomal RNA is designed using a folded design. The deoxyribothymine base (dTTP) near approximately 20 nt is replaced with a deoxyribouracil base (dUTP). The 5' end of the oligonucleotide is left unmodified, while the 3' end is deoxygenated. Alternatively, the probe components of the commercially available QIAseq FastSelect-rRNA HMR Kit (Qiagen, catalog number 334386) can be used for ribosomal RNA blocking.

[0080] Step S4: cDNA Synthesis. Reverse transcription and template conversion of RNA occur directly in the system after digestion of linear DNA. Primers with template-converting oligonucleotide (TSO) sequences and 6-9 random bases (N6-N9) added to the 3' end ensure broad binding to various RNAs (including mRNA, lncRNA, and circRNA). The 5' end of the TSO is phosphorylated to prepare for subsequent circularization ligation. When the first strand of cDNA reaches the 5' end of the RNA template, a reverse transcriptase with strong template displacement activity (such as the reverse transcriptase used in SMART-Seq technology) adds several (usually 3) non-template cytidines (C) to the 3' end of the cDNA. Template conversion is then achieved through the complementary guanosine (G) sequence on the TSO linker, introducing universal linker sequences at both ends of the cDNA. This step provides a universal tag for the subsequent circularization and rolling circle amplification of all RNA-derived cDNAs.

[0081] Step S5: Circularization of single-stranded cDNA. After purification with magnetic beads, the reverse transcription product is circularized using one of two methods to mimic the circular structure of ecDNA for subsequent rolling circle amplification:

[0082] Scheme A (T4 DNA ligase-mediated circularization): The single-stranded cDNA with universal adapters described above is denatured and annealed. A "bridging" oligonucleotide complementary to the adapter sequences at both ends of the cDNA is added. This oligonucleotide brings the cDNA molecule closer together, spatially forming a structure similar to the ends of DNA after enzyme digestion. T4 DNA ligase is then used to achieve intramolecular circularization. An optimization step involving RNase H to digest the RNA in the DNA-RNA hybrid strand during the circularization reaction is not excluded.

[0083] Option B (Direct CircLigase II Circulation): This option utilizes the thermostable CircLigase II ssDNA Ligase (Lucigen brand, LGC). This enzyme directly catalyzes the intramolecular circularization of single-stranded DNA (or cDNA) with 5'-phosphate and 3'-hydroxyl ends, without the need for complementary sequence guidance. This option is more direct, requiring only that the 5' end of the cDNA is phosphorylated. The circulation process may include an optimization step of digesting the RNA from the DNA-RNA hybrid strand using RNase H.

[0084] Step S6: Reaction system purification. Magnetic bead purification is used to purify the circularized ecDNA and cDNA products to remove residual enzymes, primers, salt ions, and other impurities, ensuring the high efficiency of downstream amplification reactions.

[0085] Step S7: Circular DNA (including circular cDNA) Rolling Circle Amplification (RCA). Add primers specifically complementary to the gene's preferred sequence characteristics, or random primers of 6-9 random bases (N6-N9), to the purified circular ecDNA and circularized cDNA system, and perform rolling circle amplification using Phi29 DNA polymerase. Phi29 DNA polymerase has strong strand displacement activity and continuous synthesis capability, enabling the generation of long-chain DNA products containing numerous repeating units from circular templates, greatly amplifying trace amounts of template and improving sequencing success rate and data volume. Preferably, Phi29 DNA polymerase (ABclonal) that operates at higher temperatures (e.g., 42°C) can be used to improve efficiency and specificity.

[0086] Step S8: Sequencing Library Construction. Standard NGS library construction is performed on the RCA products, including: sonication fragmentation to the target length; end repair and dA tail addition; ligation of sequencing adapters; magnetic bead purification to screen for fragments of specific lengths; and finally, PCR amplification with a limited number of cycles to enrich fragments with intact adapters, followed by further magnetic bead purification to complete the final sequencing library preparation.

[0087] The constructed library can be linked with targeted capture enrichment probe combinations (panels) for different cancer types or subtypes to target and enrich tumor driver genes or tumor prognosis-related genes (using commercially available targeted capture reagents, such as Agitech Biotechnology (Beijing) Co., Ltd., Shanghai Diwin Biotechnology Co., Ltd., etc.), which facilitates more accurate and cost-effective sequencing solutions and data volumes for research or detection work for different purposes.

[0088] The following will provide a detailed description of a method for constructing an ecDNA and associated RNA co-construction library according to this application, in conjunction with embodiments and experimental data.

[0089] Example 1

[0090] S1. Total nucleic acid extraction from plasma samples

[0091] Collect 1-3 mL of plasma from patients with advanced lung cancer and extract cell-free total nucleic acid from the plasma using the Guangzhou Meiji reagent kit R4316. For the operation of plasma cell-free total nucleic acid extraction, refer to the reference PMID: 33083467.

[0092] S2. Digestion of linear DNA and enrichment of ecDNA

[0093] Add Plasmid-Safe™ ATP-Dependent DNase (LGC Lucigen brand, catalog number E3101K) reaction system (as shown in Table 1 below) to 40 μL of extracted total free nucleic acid and incubate at 37°C for 30 minutes to digest linear DNA. Alternatively, use commercial DNase I DNAase and reaction buffer and incubate at 37°C for 30 minutes. For linear DNA digestion techniques, refer to PMID: 31900366.

[0094] Table 1 Linear DNA Digestion Reaction System

[0095] Purification of total free nucleic acids 40 μL 10X Reaction Buffer 5 μL ATP solution 2 μL ATP-dependent DNase 1 μL Enzyme-free water 2 μL Total volume 50 μL

[0096] S3. Magnetic bead purification

[0097] S3.1 Add 1.8X volume (90μL) of commercially available nucleic acid purification magnetic beads (such as EC501 from Beijing TransGen Biotech Co., Ltd.) that have undergone RNase removal treatment to the above reaction system. After thoroughly mixing by pipetting, let it stand at room temperature for 5 minutes, place it on a magnetic rack, and remove the supernatant.

[0098] S3.2 Add 200 μL of 80% ethanol, let stand for 30 seconds, and then aspirate the supernatant.

[0099] S3.3 Repeat step 3.2 once. Remove the magnetic rack from the reaction tube, centrifuge briefly, and then place it back into the magnetic rack to remove the residual liquid.

[0100] S3.4 Dry the magnetic beads for 2-3 minutes. After the ethanol has evaporated, add 21 μL of enzyme-free water. Remove the magnetic rack from the reaction tube, mix by blowing and then put it back into the magnetic rack. Transfer 20 μL of supernatant to a new reaction tube.

[0101] S4. Ribosomal RNA Removal

[0102] Add 9 μL of commercially available high-Mg content reagent to the new reaction tube containing 20 μL of nucleic acid solution. 2+ 5X reaction buffer (e.g., Abclonal, catalog number RM21005) and 1 μL of a folded-type ribosomal RNA-binding repression probe modified with dUTP (commercial reagents such as Qiagen, catalog number 334386) were placed in a PCR instrument and the reaction procedure shown in Table 2 below was performed (heated cap 105°C). After that, the reaction tube was removed and centrifuged briefly before proceeding to the next step. For the ribosomal RNA removal technique using probe repression, refer to PMID: 30348636.

[0103] Table 2. Restriction probe binding reaction procedure

[0104] 1 85°C 1 minute 2 75°C 2 minutes 3 70°C 2 minutes 4 65°C 2 minutes 5 60°C 2 minutes 6 55°C 2 minutes 7 72°C 2 minutes 8 Place it on ice immediately Maintain temperature

[0105] S5. cDNA synthesis: Operate on crushed ice, add the components listed in Table 3 below to the above reaction solution, centrifuge briefly, and then place in a PCR instrument to perform the reaction program in Table 4 (heated lid 105°C). Then prepare to proceed to the circularization step. Template substitution reverse transcription technology reference PMID: 41275816.

[0106] Table 3 Components of cDNA Synthesis Reaction

[0107] reagents volume S4 step reaction products 30 μL <![CDATA[3’N6 primer * (40 μM)]]> 2.5 μL <![CDATA[5’ TSO primer * (40 μM)]]> 2.5 μL dNTP (5 mM) 2.5 μL Reverse transcriptase (ABclonal, product number RM21003) 2.5 μL RNase inhibitor (20 U / μL) 3 μL Enzyme-free water 2 μL Total volume 45 μL

[0108] Table 4 cDNA synthesis reaction procedure

[0109] temperature time 42°C 90 minutes 70°C 10 minutes 95°C 2 minutes Quickly remove and place on crushed ice Maintain temperature

[0110] S6. Circularization of single-stranded cDNA

[0111] The reaction tube was briefly centrifuged, and the components listed in Table 5 were added on crushed ice. The tube was then placed in a PCR instrument and the reaction was performed at 22°C for 15 minutes (with the heat cap closed) to circularize cDNA. The reaction buffer and enzyme were purchased from NEB (product number M0202).

[0112] Table 5. cDNA cyclization reaction procedure

[0113] reagents volume S5 step reaction products 45 μL T4 DNA Ligase Buffer (10X) 6 μL <![CDATA[Circularization primer * (15 μM)]]> 3 μL T4 DNA Ligase 3 μL Enzyme-free water 3 μL Total volume 60 μL

[0114] S7. Magnetic bead purification, operation reference PMID: 35313066:

[0115] S7.1 Add 1.0X volume (60μL) of commercial DNA purification magnetic beads (Beckman AMPure XP magnetic beads) to the above reaction system, mix thoroughly by pipetting, let stand at room temperature for 5 minutes, place on a magnetic rack, and remove the supernatant.

[0116] S7.2 Add 200 μL of 80% ethanol, let stand for 30 seconds, and then aspirate the supernatant.

[0117] S7.3 Repeat 7.2 once. Remove the magnetic rack from the reaction tube, centrifuge briefly, and then place it back into the magnetic rack to remove the residual liquid.

[0118] S7.4 Dry the magnetic beads for 2-3 minutes. After the ethanol has evaporated, add 21 μL of enzyme-free water. Remove the magnetic rack from the reaction tube, mix by blowing and then put it back into the magnetic rack. Transfer 20 μL of supernatant to a new reaction tube.

[0119] S8. Rolling circle amplification, operation reference PMID: 36764566:

[0120] S8.1 Add terminally thiolated 6-base random primers, dNTPs, and commercial rolling circle amplification reaction buffer (ABclonal, catalog number RM20573) to the above reaction tubes, as shown in Table 6 below. After mixing and briefly centrifuging, place the tubes in a PCR instrument and react at 95°C for 3 minutes, then heat-cover at 105°C.

[0121] Table 6. Rolling circle amplification preparation system

[0122] reagents volume Product purified in step S7 20 μL phi29 DNA Polymerase Reaction Buffer V2 (10X) 5 μL <![CDATA[Exonuclease Tolerant Random Primer * (500 μM)]]> 3 μL dNTP Mix (25 mM) 2 μL Enzyme-free water 19 μL Total volume 49 μL

[0123] After the reaction in S8.2 is complete, quickly place the mixture on crushed ice to cool to 2-8°C.

[0124] S8.3 Add 1 μL of Pilot phi29 DNA Polymerase (ABclonal product number RM20573) to the above system.

[0125] S8.4 After mixing, centrifuge briefly, place in a PCR instrument and react at 30°C for 2 hours, then heat at 75°C.

[0126] After the S8.5 reaction is complete, heat at 65°C for 10 minutes to inactivate the enzyme reaction.

[0127] S9. Sequencing Library Construction

[0128] Sonication fragmentation (DNA library construction operation reference PMID: 35416148) was performed. The nucleic acid of the S8 product was quantified, and the product concentration was diluted to 5 ng / μL for non-contact sonication fragmentation. The length of the fragmented nucleic acid product was 200-400 bp. 50 ng of the fragmented product was used for library construction.

[0129] S10. End repair: Refer to a commercial DNA library construction kit, add the end repair enzyme composition and reaction buffer, and perform the end repair reaction at 20°C for 30 minutes and then at 65°C for 30 minutes to achieve DNA double-strand alignment, addition of an A base at the 3' end, and phosphorylation at the 5' end.

[0130] S11. Short adapter ligation: Refer to a commercial DNA library construction kit, add Y-type Illumina sequencing short adapter, ligase and ligase reaction buffer, mix well, and perform ligation reaction at 22°C for 15 minutes.

[0131] S12. Using a commercially available DNA library construction kit, purify the DNA using 0.65X magnetic beads to remove unligated adapters and enzyme reaction mixtures.

[0132] S13. Library amplification: Referencing commercially available DNA library construction kits, perform PCR amplification using high-fidelity enzymes and primers containing unique dual indexes (UDI) to achieve the concentration required for sequencing.

[0133] S14. Purify the DNA using 0.9X magnetic beads to remove unused UDI primers and enzyme reaction mixture, and then perform quality control on the constructed library for concentration and fragment length distribution (e.g., using Qubit). TM 4.0, such as Agilent 2100 Bioanalyzer, etc.

[0134] S15. Subsequent bioinformatics analysis will simultaneously identify ecDNA circular structures and differentially expressed biomarkers such as circRNA and lncRNA.

[0135] Example 2: Optimization of Key Steps and Library Quality Verification

[0136] The inventors discovered a potential mutual interference between the ribosomal RNA removal step and the cDNA synthesis step in the library construction process of Example 1, mainly due to the non-specific binding of residual repression probes to random primers. To ensure optimal process performance, this example systematically optimized key conditions in the library construction process and verified the quality of the final library.

[0137] 1. Optimization of the ratio of repressive probe to random primer

[0138] To determine the optimal ratio of repression probes in the ribosomal RNA removal step to random primers in the cDNA synthesis step, this embodiment sets up cDNA production rates under different ratios of repression probes and reverse transcription random primers for the same sample concentration of RNA.

[0139] Specifically, with fixed random primer concentrations, repression probes were tested at different dilution ratios: undiluted (original concentration 100 μM), 5-fold dilution (20 μM), and 10-fold dilution (10 μM). The results are as follows: Figure 2 As shown (Qsep100 bioanalyzer test results).

[0140] The results showed that the highest cDNA yield was achieved at a 10-fold dilution.

[0141] Conclusion: While ensuring effective ribosome removal, appropriately reducing the concentration of the repression probe can significantly increase cDNA synthesis yield, thus improving the overall performance of the library. Furthermore, it also reduces the residue of the repression probe and primers.

[0142] 2. Optimization of the reaction temperature for rolling circle amplification (RCA)

[0143] This example further compares the rolling circle amplification efficiency of Phi29 DNA polymerase at different temperatures. Under the same starting nucleic acid and the same sample concentration of RNA, RCA reactions were performed at 30°C and 42°C with different ratios of repressor probes to random reverse transcription primers. The results are as follows: Figure 3 As shown.

[0144] The results showed that, at the same dilution concentration and under 42°C conditions, higher concentrations of DNA amplification products could be obtained. Furthermore, the highest concentrations of DNA amplification products were obtained with a 10-fold dilution of the repression probe and at 42°C.

[0145] 3. Sequencing quality control analysis of the co-constructed library

[0146] To verify the actual sequencing quality of the optimized library constructed above, this embodiment performed high-throughput sequencing (BGI-T7 platform) on the library constructed using the method in Example 1 (with optimized conditions). Sequencing data quality control was performed using bioinformatics software, and the results are shown in Table 7. In the table, Reads No. represents the number of sequencing reads, Bases No. represents the total number of sequencing bases, Q3 (%) represents the value of the formula (1 - probability of misreading per 1000 bases), Clean Reads (%) represents the percentage of values ​​after removing adapter sequences and unidentified signal sequences, Total Mapped (%) represents the percentage of Clean Reads data aligned to the reference genome, Uniquely Mapped (%) represents the percentage of Clean Reads data that uniquely aligned to a non-overlapping position in the reference genome, Mapped to Exons (%) represents the percentage of Clean Reads data aligned to exon regions of the reference genome, and rRNA Rate (%) represents the ribosome residual rate.

[0147] The results showed that adding the ribosome removal step significantly reduced ribosome residues in the data, ensuring more effective data.

[0148] Table 7 Quality Control Data Table for Co-constructed Library

[0149] Probe processing Reads No. Base No. Q30 (%) Clean Reads (%) Total Mapped (%) Uniquely Mapped (%) Mapped to Exon (%) rRNA Rate (%) Undiluted 37382490 5607373528 94.53 95.19 95.14 90.10 40.48 1.79 5x dilution 33683636 5052545409 94.08 94.64 93.50 87.49 38.72 1.53 10-fold dilution 40954246 6143136900 94.87 95.68 94.75 85.68 37.53 4.94 No probe 39030602 5854590300 94.41 94.79 95.47 37.53 29.46 62.63

[0150] The results show:

[0151] rRNA residual rate: The rRNA residual rate of the library after the ribosome removal step (adding an optimized proportion of probes) was less than 5%, while the residual rate of the control library without this step was as high as 62.63%, showing a significant reduction in rRNA residual rate.

[0152] Data validity: The optimized library's "Uniquely Mapped" and "Mapped to Exons" ratios were both at good levels, significantly higher than the control group without rRNA removal, demonstrating that the library contained a high proportion of valid sequences derived from the target genome.

[0153] Basic quality: The Q30 value (>94%) and Clean Reads ratio (>94%) of all libraries met the requirements for high-throughput sequencing analysis. The above quality control data fully demonstrate that the ecDNA and RNA co-sequencing libraries constructed using the method of this invention are suitable for the synergistic analysis of DNA (ecDNA structure) and RNA (transcriptional activity) at the microparticle plasma level.

[0154] Example 3: Case Verification

[0155] To verify whether the library constructed by the method of the present invention can simultaneously and effectively capture extrachromosomal circular DNA (ecDNA) and related RNA markers in plasma samples, this embodiment uses an internal standard with a known sequence for simulated detection.

[0156] Two known internal standards, a circular DNA internal standard (pUC57 plasmid sequence) and an RNA fusion transcript internal standard (artificially synthesized ALK-EML4 fusion gene sequence), were added to total nucleic acids extracted from plasma samples from healthy individuals to simulate a complex sample containing the target molecule.

[0157] Dual nucleic acid libraries were constructed according to the method in Example 1 (including the application of the optimized repression probe dilution ratio in Example 2). The constructed libraries were stabilized and subjected to high-throughput sequencing on the Illumina Novaseq X plus sequencing platform. Bioinformatics analysis of the sequencing results yielded reads that could be aligned to the internal standard pUC57 plasmid sequence and reads of the internal standard synthesized ALK-EML4 fusion gene sequence, as well as coverage reads. The results are shown in Table 8.

[0158] The key indicators and their meanings are as follows:

[0159] pUC57 Cov Reads Rate (%) represents the percentage of reads aligned to the pUC57 plasmid sequence; Fusion Junction Reads Rate (%) represents the percentage of reads aligned to the fusion breakpoint; Cov ALK Reads Rate (%) represents the percentage of all reads aligned to the ALK gene (including partial alignments); Cov EML4 Reads Rate (%) represents the percentage of all reads aligned to the EML4 gene (including partial alignments); and Circ Loci Reads Rate (%) represents the percentage of reads aligned to the circularization point of the linear transcript.

[0160] Table 8. Statistics on Standard Product Coverage in Library Products

[0161] Probe processing pUC57 Cov ReadsRate (%) Fusion JunctionReads Rate (%) Cov ALK ReadsRate (%) Cov EML4 ReadsRate (%) Circ Loci ReadsRate(%) Undiluted 18.22 1.35 6.03 5.92 1.94 5x dilution 11.39 2.65 5.19 5.64 2.05 10-fold dilution 15.47 1.17 4.38 4.06 0.83

[0162] The results showed that significant pUC57 plasmid sequence signals (DNA internal standard) and ALK-EML4 fusion breakpoint sequence signals (RNA internal standard) were detected simultaneously in the sequencing data of the same library.

[0163] Conclusion: The library constructed using the method in Example 1 can simultaneously detect DNA (pUC57) and RNA (ALK fusion gene) in the same trace amount of plasma.

[0164] In summary, the construction method of this invention successfully enabled the simultaneous construction of a co-sequencing library containing ecDNA and related RNA biomarkers in the same plasma sample. Therefore, in practical applications, it can save samples, improve data consistency, and is suitable for micro-volume plasma detection. Furthermore, this method provides reliable support for the detection of tumor-related biomarkers and multi-omics collaborative analysis.

[0165] Finally, it should be noted that the terms “comprising,” “including,” or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0166] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of the invention.

[0167] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A method for co-constructing a dual-nucleic acid library for simultaneous detection of plasma ecDNA and related RNA biomarkers, characterized in that, Includes the following steps: S1. Extract total free nucleic acid from the same plasma sample to obtain a mixed sample containing total free DNA and total free RNA; S2. Perform linear DNA digestion on the mixed sample in S1 to obtain ecDNA; S3. Remove ribosomal RNA from the system treated in S2 to obtain the reaction product; S4. In the system treated in S3, reverse transcription was performed using chimeric primers with 6-9 random bases at the 3' end and template-converting oligonucleotide sequences at the 5' end to obtain single-stranded cDNA with universal adapters at both ends; S5. The single-stranded cDNA obtained in S4 is circularized to form circular cDNA; S6. Perform rolling circle amplification on the ecDNA in S2 and the circular cDNA in S5 to obtain amplification products. S7. The amplification products from S6 are fragmented, end-repaired, adapter-ligated, and enriched by PCR to obtain a dual nucleic acid library that can be used for high-throughput sequencing.

2. The method for co-constructing a dual-nucleic acid library for simultaneous detection of plasma ecDNA and related RNA markers according to claim 1, characterized in that, The process between S5 and S6 also includes reaction system purification, which purifies the ecDNA in S2 and the circular cDNA in S5.

3. The method for co-constructing a dual-nucleic acid library for simultaneous detection of plasma ecDNA and related RNA markers according to claim 1, characterized in that, The ribosomal RNA removal described in S3 employs a probe repression method, wherein the probe is a DNA oligonucleotide probe complementary to human 18S ribosomal RNA and human 28S ribosomal RNA, wherein the 5' end of the DNA oligonucleotide probe is unmodified and the 3' end is deoxygenated; or, the ribosomal RNA removal described in S3 employs a commercially available probe kit with ribosomal RNA blocking function.

4. The method for co-constructing a dual-nucleic acid library for simultaneous detection of plasma ecDNA and related RNA markers according to claim 3, characterized in that, The concentration of the DNA oligonucleotide probe is 10 μM.

5. The method for co-constructing a dual-nucleic acid library for simultaneous detection of plasma ecDNA and related RNA markers according to claim 1, characterized in that, The reverse transcription reaction system in S4 includes: 30 μL of the reaction product in S3; 40 μM 3'N6 primer, 2.5 μL; 40 μM 5'TSO primer, 2.5 μL; 5 mM dNTPs, 2.5 μL; Reverse transcriptase, 2.5 μL; 20 U / μL RNase inhibitor, 3 μL; Enzyme-free water, 2 μL; The nucleotide sequence of the 3'N6 primer is shown in SEQ ID No. 1; the nucleotide sequence of the 5'TSO primer is shown in SEQ ID No.

2.

6. The method for co-constructing a dual-nucleic acid library for simultaneous detection of plasma ecDNA and related RNA markers according to claim 1, characterized in that, The template-converting oligonucleotide sequence described in S4 has a phosphorylation modification at its 5' end.

7. The method for co-constructing a dual-nucleic acid library for simultaneous detection of plasma ecDNA and related RNA markers according to claim 1, characterized in that, Circularization of the single-stranded cDNA in S5 is performed in any of the following ways: (1) Denature and anneal the single-stranded cDNA with universal adapters, add a "bridging" oligonucleotide that is partially complementary to the adapter sequences at both ends of the cDNA, and then use T4 DNA ligase to achieve intramolecular circularization; or, (2) The method uses the heat-stable CircLigase II single-stranded DNA ligase for direct cyclization.

8. The method for co-constructing a dual-nucleic acid library for simultaneous detection of plasma ecDNA and related RNA biomarkers according to claim 1, characterized in that, Rolling circle amplification in S6 was performed using Phi29 DNA polymerase at a temperature of 30℃-42℃.

9. A dual-nucleic acid library, characterized in that, It was constructed using the method described in any one of claims 1-9 for the co-construction of a dual nucleic acid library for the simultaneous detection of plasma ecDNA and related RNA markers.

10. A kit for the simultaneous detection of plasma ecDNA and related RNA biomarkers using a dual-nucleic acid library co-construction method, characterized in that, The primer set includes a primer combination for reverse transcription reaction, the primer combination comprising a 3'N6 primer with 6-9 random bases at the 3' end and a 5'TSO primer with a template conversion oligonucleotide sequence at the 5' end, the nucleotide sequence of the 3'N6 primer is shown in SEQ ID No. 1; the nucleotide sequence of the 5'TSO primer is shown in SEQ ID No. 2.

Images