Primer probe combination for detecting CD36 gene polymorphism and application

Abstract

The invention discloses a primer probe combination for detecting CD36 gene polymorphism and application, and relates to the field of biological gene detection. The ARMS is combined with the fluorescent PCR technology, so that the kit has the advantages of high specificity, high sensitivity, short detection time consumption, low cost and visual and easy result interpretation, and the typing of the SNP locus rs3211938 of the CD36 gene in a human whole blood sample is realized.

Description

Technical Field

[0001] This invention relates to the field of gene detection, and in particular to a primer-probe combination for detecting CD36 gene polymorphism and its application. Background Technology

[0002] Over the past thirty years, the global average healthy life expectancy has steadily increased, but in 198 out of 204 countries and regions, the growth rate of healthy life expectancy is lower than the growth rate of total life expectancy, which means that more people are in a state of sub-health for a long time. Although the average life expectancy has increased, chronic diseases have become a major problem that endangers global public health, and also indicate that the global disease burden will become heavier and heavier. These major burdens are partly due to the increase in global metabolic diseases[1]. The rise in metabolic diseases is the main cause of the global sub-health state. The greatest risk to health comes from the rise in the incidence of metabolic diseases. Overall, hyperlipidemia, hypertension, hyperglycemia and hypercholesterolemia caused a 20% loss of global total health in 2019, nearly double that of 20 years ago, and are also the main cause of death of a large number of people worldwide[2].

[0003] Fatty acid translocase CD36 is a widely expressed membrane glycoprotein, expressed in various cells, including adipocytes, myocytes, hepatocytes, cardiomyocytes and immune cells[3]. As a long-chain fatty acid transporter, CD36 plays a key role in the uptake of fatty acids by cells and is deeply involved in fat storage and energy metabolism[4]. Under the metabolic disorders induced by obesity and high-fat diet, CD36-mediated fatty acid uptake increases significantly, leading to excessive accumulation of lipids in tissues and thus causing lipotoxicity. Especially in adipocytes, the expression level of CD36 is closely related to fat storage. If its function is disordered, the ability of adipocytes to uptake and store fatty acids will decrease significantly, seriously affecting the normal physiological function of adipose tissue. In a hyperglycemic and hyperfat environment, the increase in CD36-mediated fatty acid uptake will cause pancreatic β-cell dysfunction, interfere with insulin secretion, and further aggravate insulin resistance[5].

[0004] Moreover, CD36, as a scavenger receptor, can recognize and bind ligands such as oxidized lipids and modified low-density lipoproteins, activating inflammatory signaling pathways and promoting the release of large amounts of inflammatory factors. In metabolic diseases, this inflammatory response can exacerbate tissue damage and dysfunction [6]. Furthermore, CD36-mediated fatty acid uptake and metabolism generate a large amount of reactive oxygen species (ROS), leading to oxidative stress [5].

[0005] In macrophages, CD36 is involved in modifying the uptake of low-density lipoprotein and the formation of foam cells, and is an important factor in the development of atherosclerosis[4]. In cardiomyocytes, CD36 regulates the uptake and oxidation of fatty acids and maintains the energy metabolism of the myocardium. In the course of metabolic diseases, CD36 dysfunction can also cause myocardial fatty acid metabolism disorders and affect myocardial contractile function[7]. In the liver, CD36 promotes fatty acid uptake and lipid accumulation, which is an important mechanism for the development of non-alcoholic fatty liver disease (NAFLD). In the kidneys, abnormal expression of CD36 is closely related to pathological processes such as glomerular sclerosis and renal fibrosis[6].

[0006] CD36 plays a key role in the occurrence and development of metabolic diseases. Its effects on lipid metabolism, insulin resistance, inflammation and oxidative stress make it an important target for research and treatment of metabolic diseases. Studies have shown that the G allele of the CD36 gene SNP site rs3211938 is associated with higher HDL levels [8]. Carriers of the G allele have enhanced glucose disposal capacity stimulated by insulin, but reduced microvascular responsiveness to insulin [9]. After a high-fat meal, the response of early insulin, C-peptide, glucagon-like peptide-1 (GLP-1), gastric inhibitory peptide (GIP) and pancreatic peptide (PP) is weakened

[10] . Furthermore, the G allele of the CD36 gene SNP site rs3211938 affects the level of inflammatory markers and is associated with the risk of coronary artery disease and stroke [8].

[0007] The SNP rs3211938 of the CD36 gene in the human genome is a single nucleotide polymorphism (SNP). Single nucleotide polymorphisms (SNPs) refer to variations in a single nucleotide on an allele in the genome, including substitutions, transversions, deletions, and insertions, forming genetic markers. They are numerous and exhibit rich polymorphism. Commonly used SNP analysis methods include PCR sequencing, Sanger sequencing, high-throughput sequencing, PCR-microarray hybridization, and amplification refractory mutation systems (ARMS). Among these methods, direct sequencing has a long processing time, which cannot provide timely guidance to doctors; microarray methods are costly, limiting their application. Therefore, this invention is proposed.

[0008] References: [1] Chew NWS, Ng CH, Tan DJH, et al (2023) The global burden ofmetabolic disease: Data from 2000 to 2019. Cell Metab 35:414-428.e3. [2] Institute for Health Metrics and Evaluation(2020)The Lancet:Latest global disease estimates reveal perfect storm of rising chronicdiseases and public health failures fuelling COVID-19 pandemic. [3] Zhao L, Zhang C, Luo X, Wang P, Zhou W, Zhong S, et al. CD36palmitoylation disrupts free fatty acid metabolism and promotes tissueinflammation in non-alcoholic steatohepatitis. J Hepatol. 2018;69:705–17. [4] Silverstein RL, Febbraio M. CD36, a scavenger receptor involvedin immunity, metabolism, angiogenesis, and behavior. Sci Signal. 2009;2:re3. [5] Karunakaran U, Elumalai S, Moon J-S, Won K-C. CD36 SignalTransduction in Metabolic Diseases: Novel Insights and Therapeutic Targeting.Cells. 2021;10:1833. [6] Puchałowicz K, Rać ME. The Multifunctionality of CD36 in DiabetesMellitus and Its Complications-Update in Pathogenesis, Treatment andMonitoring. Cells. 2020 Aug 11;9(8):1877. [7] Glatz JFC, Nabben M, Luiken JJFP. CD36 (SR-B2) as masterregulator of cellular fatty acid homeostasis. Curr Opin Lipidol. 2022 Apr 1;33(2):103-111. [8] Love-Gregory L, Sherva R, Schappe T, Qi JS, McCrea J, Klein S,Connelly MA, Abumrad NA. Common CD36 SNPs reduce protein expression and maycontribute to a protective atherogenic profile. Hum Mol Genet. 2011 Jan 1;20(1):193-201. [9] Shibao CA, Peche VS, Pietka TA, Samovski D, Williams IM, AbumradNN, Gamazon ER, Goldberg IJ, Wasserman DH, Abumrad NA. Microvascular insulinresistance with enhanced muscle glucose disposal in CD36 deficiency.Diabetologia. 2025 Mar;68(3):662-675.

[10] Shibao CA, Celedonio JE, Tamboli R, Sidani R, Love-Gregory L,Pietka T, Xiong Y, Wei Y, Abumrad NN, Abumrad NA, Flynn CR. CD36 ModulatesFasting and Preabsorptive Hormone and Bile Acid Levels. J Clin EndocrinolMetab. 2018 May 1;103(5):1856-1866. Summary of the Invention

[0009] In order to overcome the shortcomings and deficiencies of the existing technology, the purpose of this invention is to provide a CD36 gene detection primer and probe combination, kit and application.

[0010] Currently, there are no commercially available kits for detecting human CD36 gene polymorphism. This product is based on real-time fluorescence PCR technology and uses an amplification refractory mutation system (ARMS) to genotype the CD36 gene SNP site rs3211938 in whole blood samples.

[0011] This invention designs specific detection primers for the rs3211938 locus of the CD36 gene. For the CD36 gene T locus, during PCR amplification, because the 3' end of the CD36 gene TT primer perfectly pairs with the template at the CD36 gene T locus, the primer extends and amplifies the template at the CD36 gene T locus. However, because it does not perfectly pair with the template at the CD36 gene G locus, primer extension is blocked, and amplification of the CD36 gene G locus template is inhibited. The opposite is true for amplification of the CD36 gene G locus. This allows for CD36 gene genotyping.

[0012] A first aspect of the present invention provides a primer-probe combination, wherein the primers comprise: an upstream primer selected from the nucleotide sequence shown in SEQ ID NO: 12 and a downstream primer selected from the nucleotide sequence shown in SEQ ID NO: 13, for detecting the T site at the rs3211938 site of the CD36 gene; an upstream primer selected from the nucleotide sequence shown in SEQ ID NO: 15 and a downstream primer selected from the nucleotide sequence shown in SEQ ID NO: 16, for detecting the G site at the rs3211938 site of the CD36 gene; and a detection probe as shown in SEQ ID NO: 14; both the T site and the G site at the rs3211938 site of the CD36 gene are detected by SEQ ID NO: 14.

[0013] It should be noted that, in one respect, useful primers and probes include nucleotide sequences having greater than 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the primers or probes shown in SEQ ID NO: 12-16. Modifications to such primers and probes are also considered, and they can be prepared according to standard techniques.

[0014] Primer and probe modifications can be performed using well-known methods. Modified versions of these primer and / or probe sequences may include, by non-limiting examples, adding one or more nucleotides to the 5' end, adding one or more nucleotides to the 3' end, adding one or more nucleotides to both the 5' and 3' ends, adding a tail, shortening the sequence, lengthening the sequence, shifting the sequence upstream or downstream by several bases, or any combination thereof.

[0015] In some embodiments, the probe is a self-quenching probe with a Fam marker at the 5' end and a Tamra marker at the 3' end.

[0016] A second aspect of the present invention provides a reagent / kit containing the above-described primer-probe combination.

[0017] In one embodiment, the kit is suitable for detection using the ARMS-qPCR method.

[0018] A third aspect of the present invention provides the application of the above-mentioned primer-probe combination in a kit for preparing the rs3211938 genotype of the CD36 gene SNP site.

[0019] The nucleic acid samples in the combination products and / or kits disclosed in this invention may be derived from, but are not limited to, one or more of anticoagulated blood and serum samples. The DNA may be genomic DNA, plasmid DNA, or DNA in other vectors. This invention is used to detect mutations in genomic DNA, and may be from primates (especially humans) or any other known or unknown animal or organism with a mutation at the CD36 gene rs3211938 site (T>G).

[0020] Compared with the prior art, the present invention has the following advantages and effects: the present invention uses ARMS combined with fluorescent PCR technology, which has high specificity and high sensitivity, short detection time, low cost, and intuitive and convenient results interpretation. Attached Figure Description

[0021] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the invention and, together with the description, serve to explain the principles of the invention. To more clearly illustrate the technical solutions in the embodiments of the invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. In the drawings: Figure 1 This is a standard curve diagram of wild-type primers; Figure 2 This is a standard curve of mutant primers. Detailed Implementation

[0022] The present invention will now be described in further detail with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto. Unless otherwise specified, the reagents, equipment, or methods used in the present invention are well known to those skilled in the art and will not be described in detail here.

[0023] Unless otherwise stated, all terms used to disclose this invention (including technical and scientific terms) have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Further guidance is provided below for a better understanding of the teachings of this invention. The terminology used herein in the specification of this invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0024] The terms “containing,” “comprising,” and “including” as used in this invention are synonyms and are inclusive or open-ended, not excluding additional, uncited members, elements, or method steps.

[0025] Example 1: Primer and probe screening

[0026] Locate the sequence near the CD36 gene rs3211938 site: Search for the CD36 gene rs3211938 site sequence information (NG_008192.1) on NCBI. Extract the sequence 300-500 bp upstream and downstream of the rs3211938 site (sequence SEQ ID NO: 1) for primer and probe design. The underlined [T / G] indicates the CD36 gene rs3211938 site (T>G). Sequence SEQ ID NO: 1 is as follows: TTGAGTTTTAGTATGTGTTAAAATTTCCCAATCACTTTTTTTCTAAGAATGAAACAAGAATTTAAAAGAGTATATGATGTTTCTAAGTTAAAACAAGAATAAGAAAAAATGAATCTCCAGAATGTAAGTTCAGGTTCCTGGAATGCAGCTCTTTTTTCTCTG TATTTAGGTCAATCTATGCTGTATTTGAATCCGACGTTAATCTGAAAGGAATCCCTGTGTATAGATTTGTTCTTCCATCCAAGGCCTTTGCCTCTCCAGTTGAAAACCCAGACAACTATTGTTTCTGCACAGAAAAAATTATCTCAAAAAATTGTACATCATA [T / G] GGTGTGCTAGACATCAGCAAATGCAAAGAAGGTGAGTAAATAACCTCAGTAGCACAGTCCATACCATAATTTGTGATATTCTTTAAGATGAGAA

[0027] Primers and probe sequences were designed with the assistance of oligo 7 and Primer Premier 5.0 software. Using the base at rs3211938 of the CD36 gene as the last base at the 3' end of the downstream primer, two sets of upstream / downstream primers and probes were designed, as shown in Table 1. The TT site represents the wild type, the GG site represents the homozygous mutant, and the TG site represents the heterozygous mutant.

[0028] After combining the designed upstream and downstream primers and probes, the primer and probe sequences for the target sites were screened using blank control (NTC), wild-type sample DNA, and mutant sample DNA. The optimal combination was determined by evaluating the amplification efficiency and specificity of different combinations (see Table 2). A plasmid was constructed based on the optimal sequence as a standard, and a standard curve was established after serial dilution (see Table 2). Figure 1 , Figure 2 .

[0029] Table 1. Primer and probe sequence information for the CD36 gene rs3211938 site. gene locus Primer type Primer name Primer sequence (5' to 3') 5' Modification 3' Modification CD36TT upstream primer CD36-F TGCTGTATTTGAATCCGACGTT / / Downstream primer CD36-WT-R1 TTGCTGATGTCTAGCACACCA / / CD36-WT-R2 TTGCTGATGTCTAGCACAgCA / / probe CD36-P1 TCCAAGGCCTTTGCCTCTCCAGT 5'Tamra 3'Fam CD36-P2 ACTGGAGAGGCAAAGGCCTTGGA 5'Fam 3'Tamra CD36GG upstream primer CD36-F TGCTGTATTTGAATCCGACGTT / / Downstream primer CD36-MUT-R1 TTGCTGATGTCTAGCACACCC / / CD36-MUT-R2 TTGCTGATGTCTAGCACAgCC / / probe CD36-P1 TCCAAGGCCTTTGCCTCTCCAGT 5'Tamra 3'Fam CD36-P2 ACTGGAGAGGCAAAGGCCTTGGA 5'Fam 3'Tamra

[0030] Table 2. Optimal site primer and probe sequence information after screening. gene locus Primer type Primer name Primer sequence (5' to 3') 5' Modification 3' Modification CD36TT upstream primer CD36-F TGCTGTATTTGAATCCGACGTT / / Downstream primer CD36-WT-R2 TTGCTGATGTCTAGCACAgCA / / probe CD36-P2 ACTGGAGAGGCAAAGGCCTTGGA 5'Fam 3'Tamra CD36GG upstream primer CD36-F TGCTGTATTTGAATCCGACGTT / / Downstream primer CD36-MUT-R2 TTGCTGATGTCTAGCACAgCC / / probe CD36-P2 ACTGGAGAGGCAAAGGCCTTGGA 5'Fam 3'Tamra

[0031] Example 2: Optimization of the reaction system and reaction procedure

[0032] By studying different amounts of Mix, primers, probe concentrations and amounts, and DNA templates, an optimal reaction system was established. Furthermore, by studying different annealing temperatures, times, and cycle numbers, an optimal reaction procedure was established. The reaction system and procedure are shown in Tables 3 to 8.

[0033] Specifically, the human CD36 gene polymorphism detection kit (fluorescent PCR method) includes the following steps: S1: nucleic acid extraction; S2: reaction solution preparation; S3: sample addition; S4: qPCR amplification; S5: data analysis.

[0034] Step S1 specifically involves: Whole blood samples: Genome samples from peripheral blood of clinical patients are obtained using common and established peripheral blood genomic DNA extraction methods or commercial nucleic acid extraction kits as DNA templates for qPCR detection. 2 μL (10 ng / μL) of the extracted genome is added to a PCR reaction tube as a template for each sample. One PCR reaction tube is used for each sample to perform the PCR amplification reaction.

[0035] Step S2 specifically involves aliquoting the PCR reaction solution according to the number of samples n to be tested (including negative and positive controls), dispensing 18 μl / tube into PCR reaction tubes / plates. Step S2 includes three PCR reaction solutions: a mixture of CD36TT and CD36 GG primers and probes, prepared as shown in Tables 3 and 4, and a PCR reaction buffer, prepared as shown in Table 5. The primer and probe sequences used in the PCR reaction solution preparation are shown in Table 2 (unless otherwise specified, this detection system is used throughout this invention).

[0036] Table 3. Preparation of CD36 TT primer and probe mixture (single serving) raw material Sample loading volume (μL / person) CD36-F (10μM) 0.4 CD36-WT-R2 (10μM) 0.4 CD36-P2 (10μM) 1.2 DEPC water 6.0 total 8.0

[0037] Table 4. Preparation of CD36 GG primer and probe mixture (single serving) raw material Sample loading volume (μL / person) CD36-F (10μM) 0.4 CD36-MUT-R2 (10μM) 0.4 CD36-P2 (10μM) 1.2 DEPC water 6.0 Total 8.0

[0038] Table 5 Preparation of PCR reaction buffer raw material Sample loading volume (μL / person) Go Taq® Probe qPCR Master Mix 10 Total 10

[0039] Step S3 is as follows: Add the extracted nucleic acid, negative control, and positive control from the sample to be tested to the PCR reaction solution, tighten the tube cap or seal the membrane, centrifuge briefly for a few seconds to concentrate the liquid at the bottom of the tube, and then transfer it to the nucleic acid amplification area. The reaction system is prepared as shown in Tables 6 and 7 below.

[0040] Table 6 CD36 TT PCR reaction system CD36 TT primer and probe mixture dosage PCR reaction buffer Template usage Overall system 8μL 10μL 2μL 20μL

[0041] Table 7 CD36 GG PCR Reaction System CD36 TT primer and probe mixture dosage PCR reaction buffer Template usage Overall system 8μL 10μL 2μL 20μL

[0042] Step S4 is as follows: ① Place the PCR reaction tube / plate into the sample slot of the real-time quantitative PCR instrument, set the positive control, negative control, and unknown sample according to their corresponding names, and set the sample name and detection target name; ② Select the fluorescence detection channel: CD36:FAM; select "none" for the quencher group; select "none" for the Passive Reference dye; ③ Set the reaction program; ④ Select a reaction system of 20 μL; ⑤ After setting, save the file and run the reaction program. The reaction program used in step S4 is shown in Table 8.

[0043] Table 8 Reaction Procedure step Cycle number Temperature (°C) time Data collection 1 1 95.0 00：05：00 2 40 95.0 00：00：30 58.0 00：00：30 72.0 00：00：30 3 1 72.0 00：05：00 √

[0044] Step S5 specifically includes: ① Quality control sample determination; ③ Judgment of test results. The CT value for each amplified site in the TT reaction solution and GG reaction solution is CT. T CT G For each site, ΔCT = CT T -CT G The genotyping of the sample is determined based on the ΔC value at each locus, and the specific determination rules are shown in Table 9.

[0045] Table 9 Result Judgment Table

[0046] Example 3: Clinical Sample Testing

[0047] The kit was used to test 238 clinical samples, and the results are shown in Table 10.

[0048] Table 10

[0049] The above description is merely an embodiment of this application and is not intended to limit the scope of this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the scope of the claims of this application.

Claims

1. A primer-probe combination, characterized in that: The primers include: an upstream primer selected from the nucleotide sequence shown in SEQ ID NO: 1 and a downstream primer selected from the nucleotide sequence shown in SEQ ID NO: 2, for detecting the T site at the rs3211938 site of the CD36 gene; an upstream primer selected from the nucleotide sequence shown in SEQ ID NO: 1 and a downstream primer selected from the nucleotide sequence shown in SEQ ID NO: 3, for detecting the G site at the rs3211938 site of the CD36 gene; the probe is the detection probe shown in SEQ ID NO: 4; both the T site and the G site at the rs3211938 site of the CD36 gene are detected by SEQ ID NO:

4.

2. The primer-probe combination according to claim 1, characterized in that: The probe is a self-quenching probe, with a Fam marker at the 5' end and a Tamra marker at the 3' end.

3. The use of the primer-probe combination according to any one of claims 1 to 2 in a kit for preparing the rs3211938 genotype of the CD36 gene SNP site.

Images