Application of (R)-HTS-3 in preparation of medicine for treating hepatitis B

(R)-HTS-3 addresses the problem of existing drugs' inability to clear cccDNA by inhibiting HBV replication-related markers, thus achieving effective treatment for hepatitis B.

CN121868273APending Publication Date: 2026-04-17CHONGQING MEDICAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
CHONGQING MEDICAL UNIVERSITY
Filing Date
2026-02-11
Publication Date
2026-04-17

AI Technical Summary

Technical Problem

Existing HBV treatments, such as nucleoside (acid) analogs and interferon drugs, are unable to completely eliminate HBV cccDNA, leading to easy relapse after drug withdrawal. They also have drug resistance and adverse reactions, and cannot completely eradicate hepatitis B.

Method used

(R)-HTS-3, as a specific enzyme activity inhibitor of LPCAT3, can inhibit the levels of HBsAg, HBeAg, HBc, 3.5kb HBV RNA, HBV core-associated DNA, and HBV cccDNA in HBV replicating cells, and has low hepatotoxicity.

Benefits of technology

It effectively inhibits HBV replication, reduces the copy number of cccDNA and its transcriptional activity, providing a new drug option for the treatment of hepatitis B and showing good clinical application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121868273A_ABST
    Figure CN121868273A_ABST
Patent Text Reader

Abstract

The invention discloses an application of (R)-HTS-3 in preparation of a medicine for treating hepatitis B. The (R)-HTS-3 can inhibit the levels of HBsAg, HBeAg, HBc, 3.5 kb HBV RNA, HBV core-associated DNA and HBV cccDNA in HBV replication cells, namely can inhibit HBV replication, has low toxicity to hepatocytes, can be used for preparing the medicine for treating hepatitis B, and has a good clinical application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of pharmaceutical technology and relates to the application of compound (R)-HTS-3 in pharmaceuticals. Background Technology

[0002] Hepatitis B virus (HBV) infection is a major global public health issue. HBV infection can lead to chronic hepatitis B (CHB), liver cirrhosis (LC), and hepatocellular carcinoma (HCC), among other related diseases. According to the World Health Organization, approximately 254 million people worldwide are infected with HBV, and about 1.1 million people die annually from HBV-related diseases.

[0003] Currently, the main drugs for treating HBV include nucleoside (acid) analogs (such as entecavir and tenofovir disoproxil fumarate) and interferons (such as pegylated interferon-alpha). Nucleoside (acid) analogs can effectively inhibit viral replication by inhibiting HBV polymerase activity, but long-term or even lifelong medication is required, drug resistance is easily developed, and they are difficult to clear covalently closed circular DNA (cccDNA) in the liver, leading to a high relapse rate after discontinuation. Interferons have both antiviral and immunomodulatory effects, and some patients can achieve HBsAg clearance or seroconversion, but the response rate is only about 30%, resulting in limited therapeutic efficacy and adverse reactions such as fever, bone marrow suppression, and thyroid dysfunction. Neither of these two types of drugs can completely eradicate HBV. Therefore, developing new drugs for treating hepatitis B remains a problem that needs to be solved.

[0004] Lysophosphatidylcholine acyltransferase 3 (LPCAT3) is an acyltransferase primarily responsible for transferring polyunsaturated fatty acid acyl groups to phospholipid membranes, participating in phospholipid acyl chain remodeling, altering the fatty acid composition of phosphatidylcholine, and thereby regulating cell membrane fluidity, lipid droplet dynamics, and lipid metabolism homeostasis. Abnormal expression of LPCAT3 is associated with various diseases; for example, LPCAT3 can delay the progression of non-alcoholic fatty liver disease; in ovarian cancer, patients with high LPCAT3 expression show better prognosis and longer survival; furthermore, patients with high LPCAT3 expression are more prone to glucose intolerance and insulin resistance. (R)-HTS-3 is a specific enzyme activity inhibitor of LPCAT3. Summary of the Invention

[0005] The purpose of this invention is to explore the anti-HBV effect of (R)-HTS-3 in order to develop a new drug that is highly effective in treating hepatitis B.

[0006] Based on research, the present invention provides the following technical solution:

[0007] Use of (R)-HTS-3 in the preparation of drugs for the treatment of hepatitis B.

[0008] Furthermore, the hepatitis B treatment drug is a drug that inhibits HBV replication.

[0009] HBV biomarkers include serological biomarkers such as hepatitis B surface antigen (HBsAg) and its antibody (anti-HBs), hepatitis B e antigen (HBeAg) and its antibody (anti-HBe), and hepatitis B core antibody (anti-HBc), as well as molecular biological biomarkers such as HBV DNA, genotype, and mutation detection.

[0010] HBV core-associated DNA refers to HBV core-associated DNA, typically the relaxed circular DNA (rcDNA) within the HBV nucleocapsid. It is a key intermediate product in the HBV replication cycle and an important marker reflecting the HBV replication status. In the early stages of viral infection, rcDNA is converted into cccDNA within host hepatocytes. cccDNA serves as the HBV transcription template and replicates persistently within the hepatocyte nucleus, leading to chronic HBV infection. Current antiviral treatments struggle to completely eliminate cccDNA, resulting in a high relapse rate after drug withdrawal. HBV RNA is primarily transcribed from the cccDNA template within the hepatocyte nucleus; therefore, it can be used to reflect the copy number and transcriptional activity of cccDNA.

[0011] This invention has found that (R)-HTS-3 can inhibit the levels of HBsAg, HBeAg, HBc, 3.5kb HBV RNA, HBV core-associated DNA, and HBV cccDNA in HBV-replicating cells, thus inhibiting HBV replication. It also has low toxicity to hepatocytes and can be used to prepare drugs for the treatment of hepatitis B.

[0012] The beneficial effects of this invention are as follows: This invention provides the use of (R)-HTS-3 in the preparation of drugs for the treatment of hepatitis B, which has good prospects for clinical application. Attached Figure Description

[0013] Figure 1 For the hepatotoxicity assay of (R)-HTS-3.

[0014] Figure 2 The effect of (R)-HTS-3 on HBsAg levels.

[0015] Figure 3The effect of (R)-HTS-3 on HBeAg levels.

[0016] Figure 4 The effect of (R)-HTS-3 on HBc levels.

[0017] Figure 5 The effect of (R)-HTS-3 on 3.5kb HBV RNA levels.

[0018] Figure 6 The effect of (R)-HTS-3 on HBV core-associated DNA levels.

[0019] Figure 7 The effect of (R)-HTS-3 on HBV cccDNA levels.

[0020] In the above figures, * indicates p < 0.05, ** indicates p < 0.01, and p < 0.05 indicates a significant difference between groups. Detailed Implementation

[0021] To make the objectives, technical solutions, and beneficial effects of this invention clearer, the anti-HBV activity of (R)-HTS-3 is described in detail below through experimental examples. Experimental methods not specified in the examples are generally performed under standard conditions or as recommended by the reagent (kit) manufacturer.

[0022] The compound (R)-HTS-3 used in the experimental example was purchased from Shanghai Taoshu Biotechnology Co., Ltd. (catalog number: T84370), and HepAD38 cells and HepG2.2.15 cells were purchased from ATCC.

[0023] The human hepatocellular carcinoma cell line HepAD38 is derived from the human hepatocellular carcinoma cell line HepG2. This cell line maintains its HBV replication capacity through stable transfection with the HBV genome (genotype D, 1.1 times longer HBV DNA) and under the tetracycline regulatory system (Tet-off). Compared to ordinary HepG2 cells, HepAD38 cells can stably and controllably secrete HBV viral particles and antigens, and are therefore widely used as an in vitro HBV infection and replication model.

[0024] HepG2.2.15 cells are a stable cell line that integrates two copies of the HBV genome into HepG2 cells. They can stably express viral gene-related products and ensure continuous HBV replication. They are widely used in the study of basic biological issues of HBV and have provided a tool for the development of early antiviral drugs.

[0025] Experimental Example 1. Hepatotoxicity detection of (R)-HTS-3

[0026] HBV-replicated HepAD38 and HepG2.2.15 cells were seeded in 96-well plates and cultured for 24 h. Then, DMEM medium containing 1.6, 3.2, 6.25, 12.5, 25, 50, 100, and 200 µM (R)-HTS-3 was added for 72 h. The hepatotoxicity of (R)-HTS-3 was detected using the CCK-8 assay kit (Shanghai Taoshu Biotechnology Co., Ltd.).

[0027] The results showed that the half-maximal toxic concentration (CMC) of (R)-HTS-3 in HepAD38 and HepG2.2.15 cells was [missing information]. 50 All are greater than 200 µM ( Figure 1 This indicates that (R)-HTS-3 has low toxicity to both types of hepatocytes.

[0028] Experimental Example 2. Effects of (R)-HTS-3 on HBsAg and HBeAg levels

[0029] HepAD38 and HepG2.2.15 cells with HBV replication were seeded in 96-well plates and cultured for 24 h. They were then treated with DMEM medium containing 1 µM and 10 µM (R)-HTS-3, respectively, for 72 h. A blank control group (using dimethyl sulfoxide instead of (R)-HTS-3) was also set up. The culture supernatant was collected, and the levels of HBsAg and HBeAg were detected using an ELISA kit (Shanghai Kehua Bioengineering Co., Ltd.).

[0030] The results showed that (R)-HTS-3 inhibited HBsAg (HBsAg) in both HepAD38 and HepG2.215 cells. Figure 2 ) and HBeAg ( Figure 3 ) level.

[0031] Experimental Example 3. Effect of (R)-HTS-3 on HBc Levels

[0032] HBV-replicated HepAD38 and HepG2.2.15 cells were seeded in 96-well plates and cultured for 24 h. Then, DMEM medium containing 1 µM and 10 µM (R)-HTS-3, respectively, was added for 48 h. Total cell protein was extracted, and protein concentration was determined by BCA method. The effect of (R)-HTS-3 on HBc level was detected by Western blot.

[0033] The results showed that (R)-HTS-3 inhibited HBc levels in both HepAD38 and HepG2.2.15 cells. Figure 4 ).

[0034] Experimental Example 4. Effect of (R)-HTS-3 on 3.5kb HBV RNA levels

[0035] HepAD38 and HepG2.2.15 cells with HBV replication were seeded in 96-well plates and cultured for 24 h. Then, DMEM medium containing 1 µM and 10 µM (R)-HTS-3, respectively, was added for 48 h. RNA was extracted from the cells using the Trizol method, and the RNA was reverse transcribed into cDNA using a reverse transcription kit (TaKaRa Biotechnology Co., Ltd., Japan). The effect of (R)-HTS-3 on 3.5 kb HBV RNA was detected by qPCR. The upstream primer sequence was CCTAGTAGTCAGTTATGTCAAC, and the downstream primer sequence was TCTATAGCTGGAGGAGTGCGA.

[0036] The results showed that (R)-HTS-3 could inhibit the level of 3.5kb HBV RNA in HepAD38 and HepG2.2.15 cells. Figure 5 ).

[0037] Experimental Example 5. Effect of (R)-HTS-3 on HBV core-associated DNA levels

[0038] HBV-replicated HepAD38 and HepG2.2.15 cells were seeded in 96-well plates and cultured for 24 h. They were then treated with DMEM medium containing 1 µM and 10 µM (R)-HTS-3, respectively, for 72–96 h. After discarding the medium, the cells were lysed with cell lysis buffer (10 mM Tris-HCl pH 8.0, 1 mM EDTA, 1% NP-40, and 2% sucrose). After adding PEG 8000 and incubating on ice for 1 h, the cells were centrifuged at 13000 g for 10 min at 4°C. The supernatant was discarded, and the cells were digested overnight with a proteinase K buffer (10 mM Tris-HCl pH 7.8, 10 mM EDTA, and 0.5% SDS) to a final concentration of 20 mg / mL. The DNA was extracted with a phenol-chloroform-isoamyl alcohol mixture (25:24:1 v / v), precipitated with ethanol, and dissolved in RNase-free water. The effect of (R)-HTS-3 on HBV core-associated DNA levels was detected by qPCR. The upstream primer sequence was TGCGGCGTTTTATCATATTCC, and the downstream primer sequence was ATACCTTGGTAGTCCAGAAGAACCA.

[0039] The results showed that (R)-HTS-3 could inhibit the level of HBV core-associated DNA in HepAD38 cells and HepG2.2.15 cells. Figure 6 ).

[0040] Experimental Example 6. Effect of (R)-HTS-3 on HBV cccDNA Levels

[0041] HBV-replicated HepAD38 and HepG2.2.15 cells were seeded in 96-well plates and cultured for 24 h. They were then treated with DMEM medium containing 1 µM and 10 µM (R)-HTS-3, respectively, for 96 h. The medium was discarded, and cells were lysed with Hirt Solution (50 mM Tris-HCl pH 8.0, 10 mM EDTA, 1% SDS, 150 mM NaCl) and KCl to a final concentration of 2.5 M. The cell lysate was incubated overnight at 4°C by rotation. Cells were extracted with phenol-chloroform-isoamyl alcohol (25:24:1 v / v), precipitated with ethanol, and cccDNA was dissolved in RNase-free water. The cccDNA was then extracted with ATP-dependent DNase (Plasmid-Safe). TM The cccDNA content was detected by qPCR after ATP-Dependent DNase digestion. The upstream primer sequence was CTCCCCGTCTGTGCCTTCT, and the downstream primer sequence was GCCCCAAAGCCACCCAAG.

[0042] The results showed that (R)-HTS-3 could inhibit the level of HBV cccDNA in HepAD38 cells and HepG2.2.15 cells. Figure 7 ).

[0043] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made to it in form and detail without departing from the scope defined by the claims of the present invention.

Claims

1. Use of (R)-HTS-3 in the preparation of drugs for the treatment of hepatitis B.

2. The use of (R)-HTS-3 as described in claim 1 in the preparation of a hepatitis B treatment drug, characterized in that: The hepatitis B treatment drug mentioned is a drug that inhibits HBV replication.