Application of Zdhhc1 gene in preparation of product for regulating and controlling atherosclerosis

Abstract

The invention belongs to the technical field of atherosclerosis, and particularly relates to application of a Zdhhc1 gene in preparation of a product for regulating and controlling atherosclerosis, a Zdhhc1- / -mouse is successfully constructed through a CRISPR / Cas9 technology, and an ApoE- / - / Zdhhc1- / -mouse is obtained through a method of hybridization and then selfing; it is verified that knockout of the Zdhhc1 gene under the background of ApoE deletion can affect related indexes of atherosclerosis formed by high-fat feed feeding, the protein molecule Zdhhc1 affecting the atherosclerosis process is determined for the first time, and it is verified for the first time that Zdhhc1 plays an important role in occurrence and development of atherosclerosis.

Description

Technical Field

[0001] This invention relates to the field of atherosclerosis technology, specifically to the application of the Zdhhc1 gene in the preparation of products that regulate atherosclerosis. Background Technology

[0002] Cardiovascular and cerebrovascular diseases are among the most common diseases worldwide, including coronary heart disease, stroke, hypertension, and heart failure. Their incidence and mortality rates have been steadily rising. Atherosclerosis is one of the leading causes of cardiovascular and cerebrovascular diseases. It is a chronic, progressive arterial disease that typically involves the formation of cholesterol plaques on the inner walls of arteries, leading to narrowing and blockage of blood vessels. This weakens blood flow and causes thrombosis, ultimately resulting in cardiovascular and cerebrovascular diseases such as angina, myocardial infarction, and stroke.

[0003] S-palmitoylation is an important form of post-translational protein modification that covalently binds 16-carbon palmitic acid (a long-chain fatty acid) to a cysteine ​​residue of a substrate protein via a thioester bond. It is dynamically regulated by 23 palmitoyltransferases and 5 depalmitoylation enzymes. These enzymes can add or remove palmitoyl groups from substrate proteins, thereby regulating the level of palmitoylation. Previous studies have shown that S-palmitoylation plays a crucial role in the development and progression of inflammatory diseases. Zdhhc1, a member of the palmitoyltransferase family, has been shown to play an important role in encephalitis and cancer, but its role in regulating the progression of atherosclerosis has not yet been reported. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention provides the application of the Zdhhc1 gene in the preparation of products that regulate atherosclerosis.

[0005] Application of reagents for knocking out the Zdhhc1 gene in the preparation of products that regulate atherosclerosis.

[0006] Preferably, the product includes specific primers for the Zdhhc1 gene, wherein the specific primers for the Zdhhc1 gene are m-Zdhhc1-F and m-Zdhhc1-R, the sequence of m-Zdhhc1-F is shown in SEQ ID NO.3, and the sequence of m-Zdhhc1-R is shown in SEQ ID NO.4.

[0007] Preferably, the product includes sgRNA, which targets exon 2 of the Zdhhc1 gene.

[0008] Preferably, the sgRNA is sgRNA1 and sgRNA2;

[0009] The sequence of sgRNA1 is shown in SEQ ID NO.1, and the sequence of sgRNA2 is shown in SEQ ID NO.2.

[0010] Preferably, the product also includes Cas9 mRNA.

[0011] Preferably, the concentration ratio of Cas9 mRNA, sgRNA1, and sgRNA2 in the product is 1-2:1-2:1-2.

[0012] Preferably, the product also includes a reagent for knocking out the ApoE gene.

[0013] Preferably, when detecting Zdhhc1, the primers are m-Zdhhc1-F and m-Zdhhc1-R, the sequence of m-Zdhhc1-F is shown in SEQ ID NO.5, and the sequence of m-Zdhhc1-R is shown in SEQ ID NO.6.

[0014] Preferably, when detecting ApoE, the primers are m-ApoE-F and m-ApoE-R, the sequence of m-ApoE-F is shown in SEQ ID NO.7, and the sequence of m-ApoE-R is shown in SEQ ID NO.8.

[0015] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0016] To gain a deeper understanding of the impact of Zdhhc1 gene knockout in the ApoE-deficient background on the progression of atherosclerosis in mice, the inventors used gene editing technology to knock out the Zdhhc1 gene in wild-type mice. They then obtained Zdhhc1 mice through a breeding method involving hybridization followed by self-pollination. - / - Model mice. Then Zdhhc1 - / - Mice and ApoE - / - Zdhhc1 was obtained by crossbreeding mice. + / - / ApoE + / - Zdhhc1 can be obtained by self-crossing heterozygous progeny mice. - / - / ApoE - / - Homozygous mice. Finally, ApoE... - / - Mice (control group) and Zdhhc1 - / - / ApoE - / - Homozygous mice (experimental group) were fed a high-fat diet for 12 weeks. The size of plaques in the aorta and aortic valve of the heart of the control group and the experimental group were observed and compared through gross anatomical experiments in order to clarify the mechanism of Zdhhc1 in regulating the process of atherosclerosis.

[0017] Zdhhc1 was successfully constructed using CRISPR / Cas9 technology. - / - ApoE mice were obtained through hybridization followed by self-crossing. - / - / Zdhhc1 - / - Mouse model;

[0018] This study verified that knocking out the Zdhhc1 gene in the ApoE-deficient background affects relevant indicators of atherosclerosis induced by high-fat diets. It also identified Zdhhc1, a protein molecule that influences the progression of atherosclerosis, for the first time, and confirmed for the first time that Zdhhc1 plays an important role in the occurrence and development of atherosclerosis. Attached Figure Description

[0019] Figure 1 A schematic diagram of Zdhhc1 gene targeting in mice;

[0020] Figure 2 Zdhhc1 - / - Verification of PCR products in mice by agarose gel electrophoresis;

[0021] Figure 3 Zdhhc1 - / - Sequencing validation in mice;

[0022] Figure 4 Zdhhc1 - / - qRT-PCR validation in mice;

[0023] Figure 5 For ApoE - / - / Zdhhc1 - / - Schematic diagram of mouse breeding strategies;

[0024] Figure 6 The absence of Zdhhc1 affects ApoE - / - Effects of Atherosclerosis on Mice: A represents ApoE levels after 12 weeks of high-fat diet feeding. - / - and ApoE - / - / Zdhhc1 - / - Oil Red staining of mouse aorta (n=8), scale bar = 1 cm, B is the statistical analysis of A, C is the ApoE of mice fed a high-fat diet for 12 weeks. - / - and ApoE - / - / Zdhhc1 - / - HE staining of mouse aortic root sections (n=8), scale bar=200μm, DE represents statistical analysis of lesion area and percentage of necrotic core in C, F represents ApoE in mice fed a high-fat diet for 12 weeks. - / - and ApoE - / - / Zdhhc1 - / -Oil Red staining of mouse aortic root sections (n=8), scale bar=200μm, G represents statistical analysis of F, H represents analysis of ApoE in mice fed a high-fat diet for 0 and 12 weeks. - / - and ApoE - / - / Zdhhc1 - / - Mouse body weight (n=8), I represents the comparative analysis of ApoE mice fed a high-fat diet for 12 weeks. - / - and ApoE - / - / Zdhhc1 - / - There were no significant differences in plasma cholesterol (CHO), triglycerides (TG), high-density lipoprotein cholesterol (HDL-c), and low-density lipoprotein cholesterol (LDL-c) in mice (n=8), *p<0.05, **p<0.01, ns= Detailed Implementation

[0025] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods.

[0026] ApoE - / - Mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd., Zdhhc1 - / - The mice were constructed by the Immunomodulatory Gene Laboratory of Xinxiang Medical College.

[0027] Example 1

[0028] Zdhhc1 constructed using genetic engineering technology - / - mouse model

[0029] (1) Design and synthesize sgRNA for Zdhhc1 gene knockout.

[0030] The mouse Zdhhc1 gene sequence (Transcript: ENSMUST00000044286.6Zdhhc1-201) was searched on Ensembl and copied and pasted into the online website CRISPOR (http: / / crispor.tefor.net / ) for sgRNA design. The two highest-scoring sgRNAs were selected. They target exon 2 of the Zdhhc1 gene. The sequences of the two sgRNAs are as follows:

[0031] sgRNA1: TGTCCACACACTCTTCTCGG GGG, denoted as SEQ ID NO.1,

[0032] sgRNA2: TACCTCTTCTTCGCGGTGAT TGG, denoted as SEQ ID NO.2.

[0033] Using the two sgRNAs described above in this invention, the Cas9 protein can precisely target and cleave the Zdhhc1 gene in mice.

[0034] (2) Cas9 mRNA, sgRNA1, and sgRNA2 were obtained using in vitro transcription.

[0035] sgRNA1 and sgRNA2 were generated using the NEB T7 Quick High Yield RNA Synthesis Kit (E2050S). Cas9 mRNA was then generated using the Ambion T7 Ultra Kit (AM1345). Experimental procedures were performed according to the instructions of each kit.

[0036] (3) Obtain Zdhhc1 - / - mice

[0037] Cas9 mRNA was mixed with sgRNA1 and sgRNA2 to a final concentration of 50 ng / μL for Cas9 mRNA, 50 ng / μL for sgRNA1, and 50 ng / μL for sgRNA2. The mixture was then injected into mouse zygotes using a microinjection system manufactured by Eppendorf. The surviving zygotes were then transplanted into the oviducts of pseudopregnant ICR female mice, and newborn mice were obtained 20 days later.

[0038] (4) Genotyping of Zdhhc1 knockout mice and acquisition of Zdhhc1 knockout homozygous mice

[0039] Approximately 5 mm of tail tissue was excised from newborn mice and placed in 1.5 mL centrifuge tubes. 500 μL of tissue lysis buffer was added, and the tubes were then placed in a shaker at 56°C and 650 rpm for 3 hours to fully lyse the tissue. After centrifugation at 13000 rpm for 5 min, 350 μL of the supernatant was collected. Two volumes of salting-out buffer (50 mL anhydrous ethanol + 714 μL 5M NaCl solution) were added and the mixture was shaken until a white flocculent precipitate was visible. The mixture was then centrifuged at 13000 rpm for 15 min, and the supernatant was discarded. 500 μL of 70% ethanol (for washing) was added to the precipitate in the tube, and the mixture was shaken and centrifuged at 13000 rpm for 5 min. The supernatant was then removed, and the tubes were placed in a 45°C oven to dry the precipitate at the bottom. Finally, 500 μL of deionized water was added and the mixture was shaken thoroughly to dissolve the precipitate, yielding the genomic DNA solution.

[0040] Using the obtained mouse genomic DNA as a template, PCR amplification was performed using Zdhhc1 gene-specific primers. The amplification products were detected by 1.5% agarose gel electrophoresis. Newborn mice with significantly smaller PCR product lengths were screened, namely Zdhhc1 gene knockout homozygous mice. The specific steps are as follows:

[0041] PCR amplification was performed using Zdhhc1 gene-specific primers to screen and confirm that the target gene had been knocked out in the genome.

[0042] The Zdhhc1 gene-specific primers are m-Zdhhc1-F and m-Zdhhc1-R, with the following sequences:

[0043] m-Zdhhc1-F:TCCTGCTAAATCCTGGCTGT, denoted as SEQ ID NO.3,

[0044] m-Zdhhc1-R: AATGGAGAGGAAGGGTCACGT, denoted as SEQ ID NO.4.

[0045] The PCR amplification product size was 504 bp for wild-type mice and 274 bp for knockout mice.

[0046] The PCR system is as follows: 0.6 μL each of m-Zdhhc1-F and m-Zdhhc1-R primers, 7.5 μL of 2×TaqMaster Mix (VazymeP112-01), 2 μL of genomic DNA, and H2O added to a total volume of 15 μL.

[0047] The PCR reaction program was as follows: 94℃ for 3 min; 94℃ for 30 sec, 60℃ for 35 sec, 72℃ for 30 sec, 35 cycles; 72℃ for 10 min. The PCR products were detected by 1.5% gel electrophoresis.

[0048] Test results as follows Figure 2 As shown, the Zdhhc1 gene knockout mouse sample had a 274 bp amplification band, while the wild-type mouse sample had a 504 bp amplification band. Additionally, as... Figure 3 As shown, sequencing results of the PCR products also confirmed that a 274 bp nucleotide sequence deletion was found in exon 2 of the Zdhhc1 gene. Further transcriptional expression analysis of the Zdhhc1 gene in mice using qRT-PCR yielded the following results: Figure 4 As shown, Zdhhc1 - / - The expression level of the Zdhhc1 gene in mice was significantly lower than that in wild-type mice. These results indicate that Zdhhc1... - / - The mouse has been successfully constructed.

[0049] Example 2

[0050] ApoE - / - and Zdhhc1 - / - ApoE was obtained by crossbreeding mice and then self-pollinating the offspring. - / - / Zdhhc1 - / - Mice.

[0051] First, ApoE - / - and Zdhhc1 - / - Mice were crossbred, and the offspring mice had the ApoE genotype. + / - / Zdhhc1 + / - Then, the male and female offspring mice were self-crossed, and ApoE mice were obtained by screening using PCR detection. - / - / Zdhhc1 - / - homozygous mice, such as Figure 5 As shown.

[0052] The PCR screening steps are as follows:

[0053] (1) The method for extracting genomic DNA from the tail of offspring mice is as shown above. The extracted genomic DNA is used as a PCR template.

[0054] (2) The primer sequences used for PCR are:

[0055] m-Zdhhc1-F: TCCTGCTAAATCCTGGCTGT, denoted as SEQ ID NO.5,

[0056] m-Zdhhc1-R: AATGGAGAGGAAGGGTCACGT, denoted as SEQ ID NO.6;

[0057] m-ApoE-F: GCCTAGCCGAGGGAGAGCCG, recorded as SEQ ID NO.7,

[0058] m-ApoE-R: TGTGACTTGGGAGCTCTGCAGC, denoted as SEQ ID NO.8.

[0059] The PCR system was as follows: 0.3 μL each of the F and R primers, 7.5 μL of 2×Taq Master Mix (Vazyme P112-01), 2 μL of genomic DNA, and H2O to a total volume of 15 μL. Specifically, for detecting Zdhhc1, the F primer was m-Zdhhc1-F and the R primer was m-Zdhhc1-R; for detecting ApoE, the F primer was m-ApoE-F and the R primer was m-ApoE-R.

[0060] Zdhhc1 PCR reaction program: 94℃ for 5 min; 94℃ for 30 sec, 60℃ for 35 sec, 72℃ for 30 sec, 35 cycles; 72℃ for 10 min.

[0061] ApoE PCR reaction program: 94℃ for 5 min; 94℃ for 30 sec, 59℃ for 30 sec, 72℃ for 30 sec, 35 cycles; 72℃ for 10 min.

[0062] The PCR products were detected by 1.5% gel electrophoresis to screen offspring mice with double knockout of Zdhhc1 and ApoE.

[0063] Example 3

[0064] Effects of ApoE and Zdhhc1 gene knockout on the progression of atherosclerosis in mice

[0065] ApoE - / - and ApoE - / - / Zdhhc1 - / - The mice were fed with sterile, ordinary feed and water in an SPF-grade hygienic environment until they were 8 weeks old.

[0066] When the baby is 8 weeks old, select an ApoE with a similar weight. - / - and ApoE - / - / Zdhhc1 - / - Mice were fed a diet consisting entirely of high-fat food, with each mouse receiving 8 grams of the high-fat diet per day for 12 weeks. All mice were weighed weekly.

[0067] The standard feed was purchased from Jiangsu Xietong Pharmaceutical Biotechnology Co., Ltd. as irradiated sterilized laboratory mouse growth and reproduction feed (CRO), with main ingredients including Northeast corn, puffed corn, wheat bran, imported milk powder, and soybean meal. The high-fat feed was purchased from Jiangsu Xietong Pharmaceutical Biotechnology Co., Ltd. as atherosclerosis feed, containing 1.25% cholesterol, with main components including cocoa butter, maltodextrin, cellulose BW200, and sucrose.

[0068] After 12 weeks of feeding with a high-fat diet, the mice in both groups were grossly dissected. Then, the weekly body weight, oil red staining of the aorta, HE and oil red staining of the aortic valve, and blood lipid levels and other atherosclerosis-related disease indicators were statistically analyzed to compare the differences between the two groups.

[0069] The results are as follows Figure 6 As shown, compared with knocking out ApoE, knocking out both ApoE and Zdhhc1 genes did not affect the four indicators of mouse weight and blood lipids, but it significantly inhibited plaque accumulation in the aorta and aortic valve, thus alleviating the progression of atherosclerosis.

[0070] It should be noted that when numerical ranges are mentioned in the claims of this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.

[0071] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of the invention.

[0072] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. Application of reagents for knocking out the Zdhhc1 gene in the preparation of products that regulate atherosclerosis.

2. Use according to claim 1, characterized in that, The product includes specific primers for the Zdhhc1 gene, namely m-Zdhhc1-F and m-Zdhhc1-R. The sequence of m-Zdhhc1-F is shown in SEQ ID NO.3, and the sequence of m-Zdhhc1-R is shown in SEQ ID NO.

4.

3. Use according to claim 1, characterized in that, The product includes sgRNA, which targets exon 2 of the Zdhhc1 gene.

4. Use according to claim 3, characterized in that, The sgRNAs are sgRNA1 and sgRNA2; The sequence of sgRNA1 is shown in SEQ ID NO.1, and the sequence of sgRNA2 is shown in SEQ ID NO.

2.

5. The application according to claim 4, characterized in that, The product also includes Cas9 mRNA.

6. The application according to claim 5, characterized in that, The concentration ratio of Cas9 mRNA, sgRNA1, and sgRNA2 in the product is 1-2:1-2:1-2.

7. Use according to claim 1, characterized in that, The product also includes a reagent for knocking out the ApoE gene.

8. Use according to claim 7, characterized in that, When detecting Zdhhc1, the primers are m-Zdhhc1-F and m-Zdhhc1-R. The sequence of m-Zdhhc1-F is shown in SEQ ID NO.5, and the sequence of m-Zdhhc1-R is shown in SEQ ID NO.

6.

9. Use according to claim 3, characterized in that, When detecting ApoE, the primers are m-ApoE-F and m-ApoE-R. The sequence of m-ApoE-F is shown in SEQ ID NO.7, and the sequence of m-ApoE-R is shown in SEQ ID NO.8.

Images