Annular single-stranded DNA (deoxyribonucleic acid) molecule containing inverted repeat terminal sequence and application of annular single-stranded DNA molecule
By simplifying the AAV triple plasmid system using circular single-stranded DNA molecules with inverted repeat terminal sequences, the problems of high error packaging rate, complex operation, and low yield in traditional systems are solved, achieving efficient and safe AAV vector production and gene expression.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- HANGZHOU INSTITUTE OF MEDICAL SCIENCES CHINESE ACADEMY OF SCIENCES
- Filing Date
- 2024-10-17
- Publication Date
- 2026-04-17
AI Technical Summary
Traditional AAV triple plasmid systems suffer from high error packaging rates, complex operation, low yields, and cytotoxicity, which limit the widespread application and safety of AAV vectors.
By using circular single-stranded DNA molecules containing inverted repeat terminal sequences, the plasmid system is simplified, the error packaging rate is reduced, and circular single-stranded DNA carrying two gene expression cassettes is obtained through phage synthesis, achieving efficient expression.
This improved AAV drug yield, avoided non-target gene contamination, reduced cytotoxicity, and enabled the simultaneous expression of two genes, thus promoting the application of AAV vectors in the field of gene therapy.
Smart Images

Figure CN121874185A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to a circular single-stranded DNA molecule containing inverted repeat terminal sequences and its applications. Background Technology
[0002] In the fields of biotechnology and gene therapy, adeno-associated virus (AAV) vectors are increasingly important as a highly efficient and safe gene transfer tool. AAVs, with their low immunogenicity, high infectivity, and stable integration into the host cell genome, have become a hot topic for scientists in research and application. Particularly in areas such as genetic diseases, cancer treatment, and vaccine development, AAV vectors have demonstrated enormous therapeutic potential. However, despite significant progress in clinical trials, the production and application of AAV vectors still face many challenges that urgently need to be addressed through technological innovation and optimization.
[0003] The traditional AAV triple plasmid system, as one of the mainstream methods for AAV vector production, has provided a valuable research tool for the field of gene therapy, but its limitations cannot be ignored. Firstly, the problem of incorrect packaging is a key challenge that urgently needs to be addressed. Because the AAV packaging mechanism relies on the specific recognition of inverted terminal repeat (ITR) sequences with packaging proteins, non-target gene sequences (such as resistance genes) present between ITRs are easily incorrectly packaged into viral particles. This not only reduces the effective payload of the target gene but may also introduce unnecessary immunogenicity, affecting therapeutic efficacy.
[0004] Secondly, the complexity of the system increases the difficulty and cost of operation. The three-plasmid co-transfection procedure is cumbersome and requires precise control of transfection conditions to ensure efficient co-expression of each plasmid, which is a particular challenge for industrial production. In addition, the coexistence of multiple plasmids may also cause mutual interference between plasmids, affecting the yield and quality of AAV particles.
[0005] Furthermore, low yield is a significant factor limiting the large-scale application of AAV vectors. Although yields have been improved to some extent in recent years through optimizing culture conditions and enhancing expression elements, the efficiency of existing production systems still needs improvement compared to clinical needs. Low yields not only increase production costs but also limit the rapid response capability of AAV vectors in emergency medical situations.
[0006] Finally, potential cytotoxicity is a safety concern that must be considered when applying AAV vectors clinically. Viral replication-related proteins and other cytotoxic components in helper and packaging plasmids may damage host cells, affecting the safety and efficacy of treatment. Therefore, developing low-toxicity or non-toxic AAV production systems is crucial for advancing gene therapy technologies.
[0007] In light of the aforementioned challenges, researchers are dedicated to developing more efficient, safe, and convenient AAV vector production systems. For example, they are modifying AAV vector plasmids using genetic engineering techniques to reduce or eliminate non-target gene sequences between ITRs, thereby lowering the error packaging rate; introducing novel expression regulatory elements to optimize the AAV replication and packaging process and increase yield; exploring novel packaging cell lines to reduce cytotoxicity and improve production efficiency; and developing automated and intelligent production processes to achieve large-scale, standardized production of AAV vectors.
[0008] Furthermore, the continuous development of cutting-edge technologies such as synthetic biology and CRISPR-Cas gene editing provides broader opportunities for innovation in AAV vector production systems. By comprehensively utilizing these technologies, it is hoped that the shortcomings of existing systems can be addressed, promoting the widespread application of AAV vectors in gene therapy and making a greater contribution to human health. Summary of the Invention
[0009] To address the shortcomings of existing technologies, this invention provides a circular single-stranded DNA molecule containing inverted repeat terminal sequences and its applications. This invention yields a circular single-stranded DNA containing an ITR and two gene expression cassettes, which simplifies the traditional AAV triple plasmid system, reduces the error packaging rate of the traditional AAV triple plasmid system, and thus improves AAV drug yield. Simultaneously, it effectively avoids contamination by non-target genes, eliminating the potential virality of the AAV triple plasmid system; it can also simultaneously carry two exogenous genes for gene expression, promoting the widespread application of AAV vectors in gene therapy.
[0010] The specific technical solution of the present invention is as follows:
[0011] A circular single-stranded DNA molecule containing inverted terminal repeat sequences, wherein the circular single-stranded DNA molecule comprises, in sequence, a spacer sequence, an inverted terminal repeat sequence, a gene expression cassette a, an inverted terminal repeat sequence, and a gene expression cassette b;
[0012] Among them, the gene expression cassette can be selected arbitrarily, that is, gene expression cassette a and gene expression cassette b can be the same or different gene expression cassettes.
[0013] The pScaf vector is a plasmid backbone containing two M13 origin of replication (ori) sites. The gene expression cassette, along with flanking inverted terminal repeat (ITR) sequences, is inserted into the pScaf vector, and a circular single-stranded DNA with ITRs at both ends is obtained via phage synthesis. Due to the complex secondary structure of the ITR, a spacer sequence must be inserted between the M13 ori and the ITR during plasmid construction to obtain a single-stranded vector via phage synthesis. Subsequently, this single-stranded vector is packaged and delivered to cells or tissues for expression.
[0014] Preferably, the length of the interval sequence is at least 100 bp.
[0015] Specifically, in this embodiment of the invention, the interval sequence shown in SEQ ID No. 2 is selected as an example.
[0016] The inverted terminal repeat sequence described in this invention is derived from any serotype of adeno-associated virus. Further, the inverted terminal repeat sequence may be derived from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9.
[0017] Preferably, the sequence of the circular single-stranded DNA molecule is shown in SEQ ID No. 1.
[0018] The circular single-stranded DNA molecule containing inverted repeat terminal sequences also includes a replication initiation site before the spacer sequence. In this embodiment of the invention, the vector selected is the pScaf vector, wherein the replication initiation site is the M13 replication initiation site.
[0019] The present invention also provides cells / tissues / organs containing the circular single-stranded DNA molecule containing the inverted repeat end sequence.
[0020] The present invention also provides the application of the circular single-stranded DNA molecule containing the inverted repeat terminal sequence in the preparation of adeno-associated virus vectors or gene drugs.
[0021] In this embodiment of the invention, transfecting the circular single-stranded DNA molecule into cells allows for the detection of luciferase gene expression, and injecting it into animals allows for long-term maintenance of high expression.
[0022] The beneficial effects of this invention are:
[0023] 1. Compared with ordinary plasmids, the circular single-stranded DNA of the present invention can contain two gene expression cassettes, which can be the same or different genes.
[0024] 2. When inserting two identical genes, there will be no problem of incorrect or empty packaging, regardless of whether the capsid is packaged in the forward or reverse direction.
[0025] 3. When inserting two different genes, the two genes can be packaged in the same capsid, thereby achieving the effect of expressing two proteins with one drug. Attached Figure Description
[0026] Figure 1 Plasmid map of the single-stranded circular single-stranded DNA of ITR-CMV-Luci-polyA-ITR-polyA-Luci-CMV inserted into the pScaf vector.
[0027] Figure 2 This is a plasmid map of a circular single-stranded DNA molecule, ITR-CMV-Luci-polyA-ITR-polyA-Luci-CMV-M13.
[0028] Figure 3 This is a diagram for validation of expression at the cellular level.
[0029] Figure 4 This is a validation diagram for expression at the animal level. Detailed Implementation
[0030] Example 1: Extraction and purification of circular single strands of luciferase reporter gene
[0031] 1. Obtain the recombinant pScaf plasmid
[0032] The sequences of two luciferase reporter genes (Promega, catalog number: E1320) were inserted into the pScaf vector using homologous recombination, along with an ITR sequence derived from AAV2. The specific steps are as follows:
[0033] The target gene sequence (containing two ITR sequences and two gene expression cassettes, spacer-ITR-CMV-Luci-polyA-ITR-polyA-Luci-CMV, sequence shown in SEQ ID No. 1) was inserted into the pScaf vector (Addgene, Plasmid #111401) using homologous recombination, and named pScaf-ITR-luci-itr-luci plasmid (abbreviated as pScaf-Luci plasmid). The diagram is shown below. Figure 1 As shown in Table 1, the pScaf-Luci plasmid was first digested at its NsiI (ATGCAT) and BamHI (GGATCC) restriction sites. The solution was mixed by pipetting, briefly centrifuged, and then placed in a PCR instrument. After reacting at 37°C for 1 hour, the enzymes were inactivated by heating at 65°C for 10 minutes.
[0034] Table 1. Double enzyme digestion reaction system (40 μL system)
[0035] reagents Dosage pScaf-Luci plasmid 2μg 10x rCutsmart Buffer 4μL BamHI-HF endonuclease 1μL NsiI-HF endonuclease 1μL Add water to make up to 40μL
[0036] Weigh 0.3g of agarose into an Erlenmeyer flask. Add 30mL of electrophoresis buffer (1xTAE) to the flask, gently shake, and microwave on medium heat until the liquid gently boils. Remove the flask, gently shake, and microwave again until the agarose is completely dissolved. Let stand at room temperature for about 2 minutes. Pour the agarose solution into the gel tank and insert the gel comb, allowing it to solidify. Mix 40μL of the double enzyme digestion sample with 5μL of 10×gelRed, and bring the volume to 50μL with water. Add the mixture to the gel wells, incubate at 80V for 5 minutes, then adjust to 120V and incubate for 30 minutes. Finally, analyze the position of the target band using a gel imaging analyzer. Then, remove the gel and place it on a blue light gel cutter to cut the target band. Weigh the cut gel pieces into 2mL centrifuge tubes (record the weight of the centrifuge tubes beforehand). Add an equal volume of Buffer PG (0.1g of gel piece is equivalent to 100μL of solution) to the centrifuge tubes. Then place the centrifuge tubes in a 55℃ water bath to dissolve the gel, gently inverting the centrifuge tubes every 2-3 minutes until the sol turns yellow. After the gel pieces are completely dissolved in the solution and cooled to room temperature, transfer the entire solution to a pre-equilibrated adsorption column. Incubate at room temperature for 2 minutes, then centrifuge at 13000rpm (~16200×g) for 1 minute. Discard the waste liquid in the collection tube (Note: The maximum volume of the adsorption column is 750μL; if the solution is large, this step needs to be repeated, i.e., multiple loadings and centrifugations). Add 450μL of Buffer PW (pre-added with anhydrous ethanol) to the adsorption column, let stand for 5 minutes, then centrifuge at 13000rpm (~16200×g) for 1 minute. Discard the waste liquid in the collection tube, and then repeat this step once. The empty adsorption column was centrifuged at 13000 rpm (~16200×g) for 1 min. The waste liquid in the collection tube was discarded. The adsorption column was placed in a new 1.5 mL container, and 40 μL of preheated 55℃ pure water was added dropwise to the center of the adsorption membrane. The container was incubated at room temperature for 2 min, then centrifuged at 13000 rpm (~16200×g) for 1 min to elute the DNA. The resulting liquid was added back to the adsorption column for a second elution. The final DNA fragment, i.e., the pScaf vector fragment, was collected and its concentration was determined using nanodrop. Forward and reverse PCR primers were designed based on the plasmid map of the target protein. The sequences are as follows:
[0037] Forward PCR primer F: gatttcggggtaccatgcatccatgcataataaaatatc,
[0038] Reverse PCR primer R: gggcgcgtggatccatggagttccgcgttacataac.
[0039] Furthermore, linearized vector terminal homologous sequences “TTTGCCGATTTCGGGGTACC” and “TGCGCCGCTACAGGGCGCGT” were introduced into the 5' ends of the forward and reverse PCR primers, respectively. Then, the raw materials required for the PCR reaction were added according to Table 2.
[0040] Table 2 PCR reaction solution (40 μL system)
[0041]
[0042] PCR amplification was performed according to Table 3. The denaturation, annealing, and extension procedures were cycled 34 times. The PCR amplification products were then separated by agarose gel electrophoresis. The target band was purified by gel excision.
[0043] Table 3 PCR Procedure
[0044] temperature time 95℃ / Pre-denaturation 1min 95℃ / denaturation 10s 55℃ / annealing 10s 72℃ / Extension 5s / Kb
[0045] use The IIOne Step Cloning Kit (C112-02) is a rapid cloning kit that performs homologous recombination ligation between pScaf vector fragments and PCR-amplified fragments. The optimal amount of cloning vector used in this system is 0.03 pmol, and the optimal amount of insert fragment is 0.06 pmol (the molar ratio of vector to insert fragment is 1:2, which can be roughly calculated using the following formula: Cloning vector amount = [0.02 × number of base pairs of cloning vector] ng; Insert fragment amount = [0.04 × number of base pairs of insert fragment] ng). The entire reaction system is shown in Table 4. Prepare the reaction system on ice, gently mix with a pipette, and briefly centrifuge to collect the reaction solution at the bottom of the tube. Then place the reaction system in a PCR instrument and react at 37°C for 30 min, followed by cooling to 4°C. This reaction product can be directly transformed or stored at -20°C.
[0046] Table 4. Reaction system for the recombination reaction (20 μL system)
[0047] reagents Dosage pScaf linearization vector 0.03 pmol Insert fragment 0.03 pmol 5×CEII buffer 4μL Exnase II 2μL Add water to make up to 20μL
[0048] Remove DH5α competent cells from -80℃ and thaw on ice. Add 10 μL of the recombinant product to 100 μL of competent cells, gently tap the tube to mix, and incubate on ice for 30 min. Then, heat shock the reaction in a 42℃ water bath for 45 s, and immediately cool on ice for 2 min. Add 900 μL of antibiotic-free LB medium and incubate at 37℃ for 1 h (220 rpm). Simultaneously, preheat the ampicillin-resistant solid medium plates in a 37℃ incubator. Centrifuge the bacterial culture at 5000 rpm for 5 min, discard 900 μL of supernatant, resuspend the bacterial cells in the remaining medium, and gently spread them evenly on the medium using a sterile spreader. Incubate overnight (12-16 h) upside down in a 37℃ incubator. On a plate confluent with bacterial colonies, pick 5-10 single colonies and place them separately into centrifuge tubes containing 1 ml of ampicillin-resistant 2×YT medium. Incubate at 37°C for 4-6 hours (37°C, 220 rpm) and send to a sequencing company for first-generation sequencing. After the correctly sequenced strains are returned to the sample, they are inoculated into new medium for plasmid extraction. Plasmid extraction is performed using the TIANGEN EndoFree Mini Plasmid Kit (DP11 8-02) endotoxin-free plasmid mini-extraction kit.
[0049] First, centrifuge 10 mL of overnight cultured bacterial solution at 12000 rpm for 1 min, removing as much supernatant as possible and retaining the bacterial cell pellet. Add 500 μL of solution P1 (containing RNase A) to the pellet and vortex thoroughly to resuspend the bacterial cell pellet. Then, add 500 μL of solution P2 to the centrifuge tube, invert 6-8 times to fully lyse the cells, and let stand at room temperature for 2 min. After the solution becomes clear, add 500 μL of solution P4, immediately invert 6-8 times to mix thoroughly, and a white flocculent precipitate will appear. Let stand at room temperature for 10 min, then centrifuge at 12000 rpm for 10 min to allow the precipitate to gather at the bottom of the centrifuge tube. Add the supernatant to the CS filter column in fractions, centrifuge at 12000 rpm for 2 min, and collect the filtrate in clean 2 mL centrifuge tubes. Add 0.3 times the volume of isopropanol to the filtrate, invert to mix, and then transfer in fractions to the CP4 adsorption column (maximum volume 700 μL). Centrifuge at 12,000 rpm for 1 min at room temperature, discard the waste liquid in the collection tube, and repeat this step until all liquid has passed through the column. Add 500 μL of protein removal solution (PD) to the adsorption column CP4, centrifuge at 12,000 rpm for 1 min, and discard the waste liquid in the collection tube. Add 600 μL of wash buffer (PW, pre-added with anhydrous ethanol) to the adsorption column CP4, let stand at room temperature for 3 min, centrifuge at 12,000 rpm for 1 min, discard the waste liquid in the collection tube, and repeat this step once. Then, put the empty adsorption column back into the collection tube, centrifuge at 12,000 rpm for 2 min, place the adsorption column CP4 in a clean centrifuge tube, open the cap, and let it stand at room temperature for 10 min to completely dry the wash buffer in the adsorption material. Then, add 200 μL of pure water (preheated to 55°C in a water bath) dropwise to the middle of the adsorption membrane, let stand at room temperature for 2 min, centrifuge at 12,000 rpm for 1 min, and add the resulting solution back into the centrifuged adsorption column for a second elution. The final collected solution is the target plasmid solution.
[0050] 2. Extraction of circular single-stranded DNA
[0051] (1) co-transformation of pScaf plasmid and pSB4423 plasmid (helper plasmid)
[0052] Remove 50 μL of competent XL1-Blue cells from -80°C and thaw on ice. Add 400 ng of the extracted pScaf plasmid and 200 ng of the helper plasmid pSB4423 to the competent cells, gently tap the tube wall to mix, and incubate on ice for 30 min. Heat shock the reaction in a 42°C water bath for 45 s, then immediately and gently place on ice to cool for 2 min. Add 950 μL of antibiotic-free LB medium and incubate at 37°C for 1 h (200 rpm). Simultaneously, preheat the ampicillin and chloramphenicol-resistant solid culture plates in a 37°C incubator. Then, take 200 μL of the bacterial culture and spread it evenly on a sterile spreader. Invert the plate and incubate overnight at 37°C (18 h).
[0053] (2) Shaking
[0054] After the plate is covered with colonies, add 3 mL of 2×YT medium containing two types of antibiotics. Gently scrape the plate with an inoculation needle to remove all colonies. Resuspend the colonies by pipetting. Then add the solution to 800 mL of 2×YT medium containing two types of antibiotics and incubate at 30°C and 260 rpm for 20 h with shaking.
[0055] (3) Remove E. coli and obtain bacteriophages
[0056] After the bacterial culture was shaken, 800 mL was dispensed into 1000 mL centrifuge bottles and centrifuged at 4°C and 12000×g for 15 min, collecting the supernatant. Approximately 200 mL of 5×buffer (PEG8000 / NaCl) was added to each 800 mL supernatant, and the mixture was shaken at 100 rpm for 16 h. After thorough mixing, the mixture was centrifuged at 4°C and 17568×g for 35 min, and the supernatant was discarded. At this point, a white, gate-shaped precipitate formed on the side wall of the centrifuge screen; this was the bacteriophage. The bacteriophage was resuspended in pure water into a 2 mL centrifuge tube and centrifuged at 4000×g for 5 min to remove residual E. coli, obtaining the bacteriophage supernatant. Plasmid extraction was performed using an endotoxin-free plasmid extraction kit. The final solution obtained was a circular single-stranded DNA solution of ITR-CMV-Luci-polyA-ITR-polyA-Luci-CMV-M13, and the pattern of the circular single-stranded DNA of ITR-CMV-Luci-polyA-ITR-polyA-Luci-CMV-M13 is shown in the figure below. Figure 2 As shown, it is named css-ITR-LUCI-ITR-LUCI.
[0057] Example 2 Cell-level verification
[0058] The circular single-stranded DNA obtained in Example 1 was co-transfected with DNA containing Rep and Cap proteins (GenBank ID: MT709014.1) and an accessory gene isolated from adenovirus (GenBank ID: DI087392.1). Complete culture medium (high glucose DMEM + 10% FBS + 1% antibiotics) was prepared in advance. The frozen 293T cells were removed from a liquid nitrogen storage tank or -80°C freezer and immediately placed in a 37°C water bath, shaking continuously to accelerate cell lysis. Under sterile conditions, the frozen cells were diluted with 4 times their volume of complete culture medium and centrifuged at 1000 rpm for 5 min. Simultaneously, an appropriate amount of culture medium was added to the culture dishes (8-10 mL for 10 cm dishes, 3-4 mL for 6 cm dishes), and the dishes were preheated in a 37°C incubator. After centrifugation, discard the supernatant and gently resuspend the cells in 1 mL of complete culture medium. Then, seed the cell suspension into a container of preheated complete culture medium, gently agitating the culture dish to distribute the cells evenly. Write the cell name, culture passage number, date, and the student's name on the dish lid. Place the dish in a 5% CO2 incubator at 37°C for static culture. Observe the cell status daily and change the medium as needed. When the cell density reaches 80%, passage can be performed. Aspirate the complete culture medium, wash the cells with 1-2 mL of PBS, remove the PBS, and add an appropriate amount of trypsin to digest the cells (2 mL for a 10 cm dish, 1 mL for a 6 cm dish). Incubate at 37°C for 2-5 minutes, determined by observing under a microscope that the cells become rounded and begin to detach. When the cells retract, disperse, and become rounded, add an equal volume of complete culture medium to neutralize the trypsin, and gently pipette the cells to detach completely. Transfer the cell solution into a centrifuge tube, centrifuge at 1000 rpm for 5 min, discard the supernatant, resuspend the cell pellet in 1-2 mL of complete culture medium, mix well, and passage at a ratio of 1:2-4. Write the cell name, passage number, date, and student's name on the dish lid, and incubate statically in a 5% CO2 incubator at 37°C.
[0059] Cells are ready for transfection experiments when they reach 80% confluency and are in good condition. Digest cells with trypsin, neutralize with culture medium, centrifuge, discard the supernatant, and resuspend the cells in 1 mL of culture medium. Transfer 10 μL to a cell counting chamber and insert the cell counter for counting (typically, 103 cells will be counted in a 10 cm2 dish). 7 A 6cm dish will have 10 cells. 6 Then, take an appropriate amount of cells, dilute them, and seed them into 96-well plates at a seeding density of 40%–50%. After culturing for 12–24 hours until the cells are fully adhered, perform cell transfection experiments using the cell transfection reagent Lipofectamine 2000 (lipo2000).
[0060] The following steps use a 96-well plate as an example: First, measure the required DNA at 0.1 μL / well into a 2 mL centrifuge tube, add Opti-MEM medium to dilute to 10 μL / well, gently tap the centrifuge tube to mix, and let stand for 5 min. Then, measure 0.3 μL / well of sufficient Lipo2000 solution into a new centrifuge tube, add Opti-MEM medium to dilute to 10 μL / well, gently tap the centrifuge tube to mix, and let stand for 5 min. Next, mix the solutions from steps one and two, gently mix, and let stand at room temperature for 15 min. Finally, add 20 μL / well of the solution to a 96-well plate that has already been seeded with cells (with 100 μL of medium). For the negative control group, add 20 μL of Opti medium. Shake the plate to mix the solution, and then incubate the plate at 37°C in a 5% CO2 incubator. Perform analysis after 24 h or 48 h.
[0061] Prepare a luminescent substrate at a concentration of 300 ng / μL (stored at -80℃) in advance. After removing the cells, add an equal volume of luminescent substrate to the culture medium under light-protected conditions. Then place the well plate into a microplate reader to detect the expression of the luciferase gene.
[0062] Test results as follows Figure 3 As shown, after transfection, the expression of the circular single-stranded DNA prepared according to the present invention in the sample group was found to be much higher at the cellular level than that of the ordinary plasmid and the negative control group.
[0063] Example 3: Expression in animals via intravenous injection
[0064] Three experimental groups were set up: the pScaf-Luci plasmid as the standard plasmid group, DPBS solution as the negative control, and the circular single-stranded DNA prepared in Example 1 as the sample group. The nucleic acid samples were diluted in DPBS solution to a final dose of 40 μg / mouse. For ease of calculation and volume control, the solution concentration could be adjusted to 2000 ng / μL during dissolution. Before the experiment, mice were anesthetized with isoflurane to prevent movement that could lead to experimental failure. After the mice were unconscious, the required DNA sample was injected into the tail vein of the mouse using a syringe.
[0065] Female BALB / c mice (aged 6-8 weeks) were used in the experiment. During the experiment, the mice were provided with a standard diet and water was supplied via an automatic water dispenser. The environmental conditions in the mouse enclosure were maintained within the range of 50%-55% relative humidity and 20.0-22.0℃. Corn cobs were placed on the bottom of the mouse cages as bedding. An automatic watering system was used for the mice.
[0066] All experiments involving mice have been approved to ensure compliance with ethical and regulatory requirements for the use of laboratory animals. These measures aim to ensure that mice are well cared for and protected during experiments to meet animal welfare standards.
[0067] Each mouse was injected with 40 μg of DNA, with 3-5 mice in each experimental group, via intravenous injection.
[0068] Bioluminescence imaging was performed at different time points using the Lumina (IVIS) Lumina III imaging system (PerkinElmer) for up to 72 hours. Mice were injected with 200 μL of 15 mg / mL fluorescein substrate before imaging. Bioluminescence imaging using IVIS showed that the positive control and experimental groups expressed plasmids from 6 hours onwards, with similar expression levels. Subsequently, plasmid expression decreased slightly, while the experimental group maintained high expression levels for an extended period.
[0069] Example 4: Detection of empty package rate of AAV samples
[0070] The obtained circular single-stranded DNA was used to prepare AAV samples by Paizhen Biotechnology. High-resolution imaging with transmission electron microscopy allowed for clear observation of the structural features of AAV particles, revealing that the empty shell rate was close to 0.
Claims
1. A circular single-stranded DNA molecule comprising inverted terminal repeats, characterized in that, The circular single-stranded DNA molecule comprises, in sequence, a spacer sequence, an inverted terminal repeat sequence, a gene expression cassette a, an inverted terminal repeat sequence, and a gene expression cassette b; Among them, gene expression cassette a and gene expression cassette b are the same or different gene expression cassettes.
2. The circular single-stranded DNA molecule comprising inverted terminal repeat sequences according to claim 1, wherein, The length of the interval sequence is at least 100 bp.
3. The circular single-stranded DNA molecule comprising inverted terminal repeat sequences according to claim 2, wherein, The interval sequence is shown in SEQ ID No.
2.
4. The circular single-stranded DNA molecule comprising inverted terminal repeat sequences according to claim 1, wherein, The inverted terminal repeat sequence is derived from any serotype of adeno-associated virus.
5. The circular single-stranded DNA molecule containing inverted repeat terminal sequences according to claim 4, characterized in that, The reversed terminal repeat sequence is derived from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9.
6. The circular single-stranded DNA molecule containing inverted repeat terminal sequences according to claim 1, characterized in that, The sequence of the circular single-stranded DNA molecule is shown in SEQ ID No.
1.
7. The circular single-stranded DNA molecule containing inverted repeat terminal sequences according to claim 1, characterized in that, The spacer sequence also includes a replication initiation site.
8. A cell / tissue / organ containing a circular single-stranded DNA molecule containing an inverted repeat end sequence as described in any one of claims 1 to 7.
9. The use of the circular single-stranded DNA molecule containing the inverted repeat terminal sequence as described in any one of claims 1 to 7 in the preparation of adeno-associated virus vectors or gene drugs.