KASP marker related to white character of cucumber peel and application of KASP marker

Abstract

The invention discloses a KASP marker related to a white character of cucumber peel and an application of the KASP marker. The SNP site of the KASP marker corresponds to the mutation from A to T of a basic group at 181 bp of a second exon of the CsLeuC gene, and the TT genotype at the molecular marker is a cucumber with white peel.

Description

Technical Field

[0001] This invention belongs to the field of breeding technology, specifically relating to a KASP marker related to the white trait of cucumber peel and its application. Background Technology

[0002] Peel color is an important quality trait of cucumbers and has significant commercial economic value. The peel color of immature cucumbers mainly includes light green, green, dark green, and white. With the improvement of national living standards, high-quality white-peeled cucumber varieties are not only favored by consumers but have also become a focus of breeders. Therefore, specifically breeding white-peeled cucumber varieties that meet market demands and satisfy consumers' growing quality requirements is an important breeding goal for increasing the economic value of cucumbers.

[0003] During the early development of cucumber fruits, decreased chlorophyll content and chloroplast development defects are the main reasons for the white or light green color of the peel. (Cucumber white peel gene) w The gene for white skin was initially located in a 33 kb region between the SNP markers ASPCR39262 and ASPCR39229 on the flanking sides of chromosome 3. Further research led to a more precise localization of this gene. appr2 ( w Compared to white-skinned cucumbers, green-skinned cucumbers... APRR2 The expression levels are higher, and the content of chlorophyll a and chlorophyll b in the exocarp is also higher, with more chloroplasts. In white-skinned cucumbers... APRR2 alleles aprr2 Because it lacks the C-terminal functional domain, it cannot perform its normal function in the fruit ripening signaling pathway, resulting in a decrease in chlorophyll content and the number of chloroplasts, ultimately leading to white-skinned cucumbers. CsaARC5 It has been confirmed that the gene responsible for the light green peel of cucumbers is present. CsaARC5 The loss of function severely affects chloroplast division, leading to a decrease in the number of chloroplasts and an increase in their size. lgp (Light green peel) The mutant has a light green peel. In cucumbers... CsYcf54 It encodes Ycf54-like proteins, which are important cyclases required for chlorophyll synthesis. CsYcf54 The mutation resulted in inhibited chlorophyll synthesis and a significant reduction in chlorophyll content. Subcellular localization results proved... CsYcf54 The encoded protein is located in the chloroplast. Therefore, CsYcf54 It mainly regulates the light green color of cucumber leaves and peel by affecting chlorophyll biosynthesis.

[0004] In recent years, research on the white or light-colored pericarps of other cucurbitaceous plants has gradually unfolded. Among melons... CmAPPR2 It's the gene for cucumber white skin. appr2 Homologous genes. Compared to the dark green rind of melons, the light green rind contains... CmAPPR2 Exon polymorphisms reduce the chlorophyll content in the pericarp, resulting in a lighter pericarp color. (This is relevant to winter melon.) appr2 It participates in regulating the white color of the fruit peel. Compared to green-skinned winter melons, white-skinned winter melons... Bhaprr2 The absence of two key bases leads to poor chloroplast development and chlorophyll synthesis, resulting in a white pericarp phenotype. Yan et al. conducted a combined metabolomic and transcriptomic analysis of the mature pericarps of two winter melon inbred lines (yellow-green pericarp B214 and dark green pericarp B227). The chlorophyll content of the dark green pericarp B227 was higher than that of the yellow-green pericarp B214. Downregulation of all significantly differentially expressed genes in the chlorophyll synthesis pathway was detected in the B214 pericarp, suggesting that the low expression rate of chlorophyll synthesis genes is the cause of the yellow-green pericarp. Li et al. detected that the chlorophyll content of the dark green pericarp 9904 watermelon was four times that of the light green pericarp Handel. Transmission electron microscopy revealed fewer and loosely arranged chloroplasts in the light green pericarp Handel. Fine localization on chromosome 8... ClCGMenG It is Arabidopsis thaliana MENG Homologous genes encode enzymes that are involved in the development of chlorophyll and chloroplasts. ClCGMenG The mutation is the cause of the formation of the light green fruit peel Handel.

[0005] The color of cucumber peel is one of the main factors influencing market selection. Exploring new genes for white peel in high-quality cucumber varieties and developing high-quality white-peel cucumber varieties that meet market demands will lay the foundation for the creation of cucumber germplasm resources in the future. Summary of the Invention

[0006] The present invention aims to overcome the shortcomings of the prior art and provide a KASP marker and its application related to the white morphology of cucumber peel.

[0007] To achieve the above objectives, the technical solution provided by this invention is as follows: The SNP sites of the KASP markers associated with the white trait of cucumber pericarp correspond to... CsLeuC A mutation from A to T at 181 bp in the second exon of a gene results in a cucumber with a white peel, which is the TT genotype at this molecular marker.

[0008] Preferably, the nucleotide sequence of the KASP label is as shown in DEQ ID NO.1.

[0009] A kit for detecting KASP markers associated with the white trait of cucumber pericarp, characterized in that the kit includes primers for detecting KASP markers associated with the white trait of cucumber pericarp, the primers comprising: Primer_AlleleFAM: GAAGGTGACCAAGTTCATGCTGAAGAAAACCCAACAGAGCCAGA (SEQ ID NO. 2); Primer_AlleleHEX: GAAGGTCGGAGTCAACGGATTGAAGAAAACCCAACAGAGCCAGT (SEQ ID NO. 3); Primer_Common: CGCCTCAACAATCGGAACGCAAG (SEQ ID NO. 4).

[0010] This invention also provides the application of a reagent for detecting KASP markers associated with the white trait of cucumber peel in identifying the genetic traits of white cucumber peel in breeding; the KASP marker is the KASP marker described in claim 1.

[0011] The present invention also provides the application of primers for detecting KASP markers associated with the white trait of cucumber peel in identifying the genetic breeding of the white trait of cucumber peel; wherein the KASP marker is the aforementioned KASP marker, and the primers are the aforementioned primers.

[0012] The present invention will be further described below: Cucumber peel color is an important quality trait, and high-quality white-peeled cucumber varieties are increasingly favored by the market. In previous work, the inventors discovered a white-peeled mutant strain, Cuiqiu White Peel, while propagating the green-peeled parent line Cuiqiu in inbred lines of higher generations. After self-pollination and years of systematic breeding, the mutant Cuiqiu White Peel yielded near-isogenic lines of the white-peeled mutant Cuiqiu White (Cuiqiu-W) and the green-peeled wild-type Cuiqiu Green (Cuiqiu-G). The chlorophyll content and chloroplast number in the peel of Cuiqiu Green are significantly higher than those of Cuiqiu White. In this invention, genetic populations of Cuiqiu Green, Cuiqiu White, and their F2 and F3 generations were constructed. Genetic analysis showed that the white peel trait is controlled by a recessive single gene. By combining BSA-seq and KASP genotyping, a candidate new gene involved in the formation of white cucumber peel was precisely located and cloned. CsLeuC ( Csa3G912340 A missense mutation occurs at SNP-181 in exon 2 of the gene, resulting in a threonine mutation into a serine. CsLeuC homologous genes LeuC ( At4g13430 CsLeuC is involved in the biosynthesis of leucine (Leu) in Arabidopsis chloroplasts. Subcellular localization prediction showed that CsLeuC is distributed in chloroplasts and cytoplasm. qRT-PCR results indicated that... CsLeuCThe expression level in the green pericarp of cucumber is higher than that in the white pericarp. This invention enriches the research content on cucumber pericarp color and provides a new research foundation for future high-quality cucumber breeding. Attached Figure Description

[0013] Figure 1 Phenotypic identification of wild-type Cuiqiu Green and mutant Cuiqiu White: (A) Fruits of 9 DAP Cuiqiu Green, F1 and Cuiqiu White respectively; (B) Phenotypic characteristics of leaves, buds, male flowers, female flowers and tendrils; Scale bar: 5 cm; Figure 2 9. DAP chlorophyll detection in fruit peel; Figure 3 Transmission electron micrographs of chloroplasts: (A, B) show the number of chloroplasts in emerald green and emerald white, respectively. Arrows indicate chloroplasts; (C) Ultrastructure of chloroplasts of normal size and shape in emerald green; (D) Ultrastructure of chloroplasts with enlarged volume and irregular shape in emerald white; Figure 4 : CsLeuC Linkage map and sequence analysis: (A) Single nucleotide polymorphism (SNP)-index distribution, Chr1, Chr2, Chr3, Chr4, Chr5, Chr6 and Chr7 are the seven chromosomes of cucumber, and the differential SNPs are shown with blue dots; (B) KASP genotyping of the F2 population; (C) KASP genotyping of the F3 population; (D) CsLeuC Gene structure; Figure 5 Subcellular localization of CsLeuC; Figure 6 : CsLeuC Expression level analysis: (A) Cuiqiu-G and Cuiqiu-W CsLeuC The expression level of Cuiqiu-G in different tissues; (B) Cuiqiu-G CsLeuC Expression levels; error bars represent 3 biological replicates ± SEM, **, 0.001 < p <0.01.*,0.01< p < 0.05; Figure 7 Different cucumber varieties CsLeuC A mutation in SNP-181 on the second exon; Figure 8 : CsLeuC Gene editing function verification Detailed Implementation

[0014] 1. Materials and Methods 1.1 Plant materials and community construction In 2008, the parent plant, Cuiqiu, was collected from a local variety in Haiyang City, Shandong Province. In 2011, during the propagation of the high-generation inbred line parent Cuiqiu (green peel) at the research base, the group discovered a white-peeled mutant, Cuiqiu Baipi, among more than 2800 parent plants. After self-pollination and years of systematic selection, the mutant Cuiqiu Baipi produced five generations of homozygous self-pollinated mutants (white peel) Cuiqiu Bai and five generations of homozygous near-isogenic wild-type (green peel) Cuiqiu Lv. In 2016, the F1 generation was obtained from hybridization in the autumn of Hunan and the winter of Hainan, and the F2 generation was obtained through self-pollination. Recombinant single plants were selected from the F2 generation and self-pollinated to obtain the F3 generation heterozygous family. In 2017, the parents, F1, and F2 generations were planted in a spring greenhouse in Hunan. In 2023, the F3 generation heterozygous family will be planted in a spring greenhouse in Hunan. The peel color phenotype was comprehensively identified and genetic analysis was performed based on the F1, F2, and F3 generation heterozygous family populations. The F2 generation was used for initial localization and narrowing down the localization range, while the F3 generation heterozygous families were used for fine-tuning. Except for the F1 generation planted in Hainan in 2016, all other materials were grown in greenhouses at the Hunan Academy of Agricultural Sciences Vegetable Research Institute. Single plants were planted in double rows, using A-frame trellises. Cultivation was done under plastic film mulch, with fertilizer and water conditions similar to those in general field production.

[0015] 1.2 Chlorophyll content detection Three g of fresh pericarp was collected from each sample for chlorophyll quantification. The chlorophyll a, chlorophyll b, and total chlorophyll content of the fresh pericarp of both *Cuiqiu Green* and *Cuiqiu White* materials were determined using a BioTek Epoch microplate reader and a chlorophyll reader (BC0995, Solarbio®, Beijing, China). Absorbance values ​​at 663 nm and 645 nm were measured using the microplate reader and denoted as A. 663 and A 645 .

[0016] Chlorophyll a content (mg / g mass) = (21.2×A663-4.48×A645)×Vextracted×F÷W÷1000=0.01×(21.2×A663-4.48×A645)×F÷W.

[0017] Chlorophyll b content (mg / g mass) = (38.2×A645-7.8×A663)×Vextracted×F÷W÷1000 = 0.01×(38.2×A645-7.8×A663)×F÷W.

[0018] Total chlorophyll content (mg / g mass) = (33.7×A645+13.4×A663)×Vextracted×F÷W÷1000 = 0.01×(33.7×A645+13.4×A663)×F÷W.

[0019] V_extract: Extraction volume, 10 mL; F: Dilution factor; W: Sample mass, g. Each sample was replicated 3 times, for a total of 6 samples.

[0020] 1.3 Transmission electron microscopy observation of chloroplasts Take fresh peels of *Cuiqiu Lv* and *Cuiqiu Bai* fruits, and sample within 1 to 3 minutes. The sampled tissue should be 1 mm thick. 3 Size. Tissue was fixed in EP tubes containing electron microscopy fixative (G1102, Servicebio®, Wuhan, China), rinsed three times with 0.1 M phosphate buffer PB (pH 7.4) for 15 min each time. Fixed with 1% osmium tetroxide prepared in 0.1 M phosphate buffer PB (pH 7.4) at room temperature in the dark for 7 h. Rinse three times with 0.1 M phosphate buffer PB (pH 7.4) for 15 min each time. Tissue was sequentially dehydrated by ascending in 30%, 50%, 70%, 80%, 95%, 100%, and 100% ethanol for 1 h each time. At 37°C, the tissue was permeated with a mixture of acetone and 812 resin (CAT#:25068-38-6, supplied by SPI®, PA, USA) at a 3:1 ratio for 2–4 hours, overnight at a 1:1 ratio, and 2–2 hours at a 1:3 ratio; then permeated with pure 812 resin for 5–8 hours. The infiltrated sample was embedded in a mold and cured overnight in an oven at 37°C, followed by polymerization at 60°C for 48 hours. The resin block was then removed for later use. The resin block was ultrathinly sectioned at 60-80 nm using a Leica UC7 microtome and slided onto a 150-mesh copper mesh. The copper mesh was stained with 2% uranium acetate-saturated alcohol solution in the dark for 8 min; washed three times with 70% alcohol; washed three times with ultrapure water; stained with 2.6% lead citrate solution in the dark for 8 min; washed three times with ultrapure water; and slightly blotted dry with filter paper. The copper mesh sections were then placed in a copper mesh box and dried overnight at room temperature. Chloroplast structure was observed using a Hitachi HT7800 transmission electron microscope, and representative images were acquired from three biological replicates of each sample.

[0021] 1.4 Whole genome resequencing Twenty plants with the wild phenotype (green pericarp) and twenty plants with the mutant phenotype (white pericarp) were selected from the F2 segregating population. Leaves from these plants were used to construct DNA pools with green pericarp and those with white pericarp. DNA was extracted using the CTAB method (Wilkie et al., 1997). Two parental pools (green pericarp and white pericarp) and two DNA pools (green pericarp pool and white pericarp pool) were obtained. DNA samples were randomly fragmented into 350 bp fragments using a Covaris fragmenter (S220, Covaris, Woburn, MA, USA). Complete libraries were prepared through end repair, polyA tailing, sequencing adapter addition, purification, and PCR amplification. After library construction, preliminary quantification was performed using a Qubit 2.0 fluorometer (Thermo Fisher Scientific, Waltham, Massachusetts, USA). The libraries were diluted to 1 ng / μL, and the insert size was then determined using an Agilent 2100 bioanalyzer (Agilent Technologies, Santa Clara, California, USA). The Q-PCR method accurately quantifies the effective library concentration (effective library concentration > 2 nM). Qualified libraries were constructed and sequenced using the Illumina novaseq platform (HiSeq PE150). SNP filtering criteria included a sequencing depth of ≥5 for each SNP site and each sample, an alignment quality score ≥20, and a variant detection quality score ≥30. SNP mapping was performed by subtracting the SNP indices from the dominant pool for the recessive pool.

[0022] 1.5 KASP Genotyping Technology KASP genotyping used 273 F2 plants and 400 F3 plants. SNP information for candidate regions of the target gene was detected using the LGC Genomics genotyping platform at the Vegetable Research Center of the Beijing Academy of Agricultural and Forestry Sciences. 100bp DNA sequences upstream and downstream of each SNP site were extracted as templates for KASP primer design, resulting in three primers: Primer_Allele FAM, Primer_Allele HEX, and Primer_Common.

[0023] 1.6 Gene Cloning and Sequencing DNA was extracted using the CTAB method. 5 μl of the PCR product was electrophoresed on a 1% agarose gel at 150 V, 100 mA, for 10–20 min. The agarose gel containing the target DNA was extracted and purified using an Axygen gel extraction kit (Axygen, Union City, CA, US). The PCR products were sequenced using an ABI 3730XL sequencer.

[0024] 1.7 RNA extraction and qRT-PCR Total RNA was extracted using the TaKaRa MiniBEST kit (TaKaRa Bio, Japan) according to Protocol-II. cDNA synthesis was performed using the TaKaRa PrimeScript™ RT kit and gDNA Eraser (TaKaRa Bio, Japan). Following reverse transcription, qRT-PCR was performed using TB Green Premix Ex Taq II (TaKaRa Bio, Japan). CsActin ( Csa6G041900 () was used as an internal reference gene. The reaction was performed using a real-time PCR instrument (ABI 7300). After the reaction, the amplification and melting curves of the Real-Time PCR were confirmed using 2... -∆∆CT The relative gene expression levels were analyzed using a method. Each sample was analyzed in triplicate.

[0025] 1.8 Subcellular localization of tobacco Amplification CsLeuC The full-length coding region of the gene was extracted and constructed into the pCAMBIA1300-35S-N-GFP plasmid. The pCAMBIA1300-35S-N-GFP vector was constructed and transformed with Agrobacterium EHA105 (empty vector was converted to control). Selection was performed using plates containing kanamycin resistance. Single clones were picked and shaken overnight for growth. The bacterial suspension was collected, resuspended in induction medium for 4 hours, and then resuspended in osmotic medium. OD... 600 The concentration was controlled at around 0.5. Four-week-old tobacco leaves were injected with 1 mL syringe. After 48 hours, the injected leaves were cut off and observed and photographed under a laser confocal scanning microscope. The induction medium formula was: 60 mM K₂HPO₄, 33 mM KH₂PO₄, 7.6 mM (NH₄)₂SO₄, 2 mM sodium citrate, 1 mM MgSO₄, 0.2% glucose, 0.4% glycerol, 10 mM MES, 50 μg / mL acetosyringone, pH 5.6. The osmotic medium formula was: 0.5 × MS, 10 mM MES, 150 μg / mL acetosyringone, pH 5.6.

[0026] 1.9 Gene Editing and Genetic Transformation design CsLeuC gRNA target-specific primers were used to ligate the pKSE402 vector and transform it into E. coli DH5α. Single colonies were picked for colony PCR identification of positive clones and sequencing. This completed the pKSE402- CsLeuC Vector construction. The pKSE402- vector was constructed using a thermal shock method. CsLeuC EHA105 competent cells were transformed, and single colonies were selected to identify positive clones, thus obtaining Agrobacterium strains containing the target vector. Using cucumber pericarp green material Cuiqiulv as the recipient, pKSE402- was introduced via Agrobacterium-mediated transformation. CsLeuC The vector was transferred into cucumber explants, and gene knockout positive plants were obtained through culture.

[0027] 2 Results 2.1 Phenotypic identification of near-isogenic cucumber lines Cuiqiu Green and Cuiqiu White Cuiqiu Green and Cuiqiu White are two high-generation inbred lines of cucumber with genetically stable pericarp color traits. At 9 DAP (days after pollination), the mutant Cuiqiu White was observed to have a significantly white pericarp compared to the wild-type Cuiqiu Green. Figure 1 A), while other traits, such as fruit length, leaves, terminal buds, male flowers, female flowers, and tendrils, did not show significant differences ( Figure 1 B).

[0028] 2.2 Detection of chlorophyll content in fruit peel The chlorophyll content of fresh pericarps of cucumbers at commercial stage 9 (DAP) were measured. The results showed that the chlorophyll a content of 9% and 9% of cucumbers was 1.22 mg / g and 0.04 mg / g, respectively; the chlorophyll b content was 0.51 mg / g and 0.07 mg / g, respectively; and the average total chlorophyll content was 1.73 mg / g and 0.11 mg / g, respectively. Figure 2 The chlorophyll content of Cuiqiu Green is 15.73 times that of Cuiqiu White, indicating that the white peel of Cuiqiu White may be due to a lack of chlorophyll.

[0029] 2.3 Transmission electron microscopy observation of chloroplasts We compared the morphology and number of chloroplasts in the pericarp cells of wild-type *Cuiqiulv* and the mutant *Cuiqiubai* using transmission electron microscopy. Figure 3 In the 'Cuiqiubai' variety, there are two enlarged, irregularly shaped chloroplasts, which may be related to a decrease in chlorophyll content. Figure 3 B, D). The presence of 6 morphologically normal chloroplasts in the emerald green chloroplast indicates that chlorophyll synthesis is under normal conditions. Figure 3 A, C).

[0030] 2.4 Genetic Analysis The F1 generation was obtained by crossing Cuiqiu Green and Cuiqiu White melons. All F1 generation melons had green rinds. In 2017, the parents, F1, and F2 generations were grown in greenhouses in Hunan Province during the spring. The color change of the rind was assessed during the commercial stage, and traits were investigated and genetic analysis was performed. The results showed that the ratio of green-fruited to white-fruited plants was 3:1 according to the chi-square test (Table 1). This indicates that the white rind trait is controlled by a recessive single gene.

[0031] Table 1. Segregation of plants with green and white pericarps in the Cuiqiulv × Cuiqiubai genetic population

[0032] 2.5 Preliminary localization of target genes using BSA-based whole-genome resequencing From the F2 segregating population, we selected 20 plants with the dominant trait (green pericarp) and 20 plants with the recessive trait (white pericarp), constructing two DNA pools (dominant and recessive pools). Whole-genome resequencing was performed on both parents (Cuiqiu White and Cuiqiu Green) and the two DNA pools, generating a total of 38 Gb of sequence data. The GC content of the samples ranged from 37.38% to 38.34%, and the Q30 was ≥91.33% for all samples. The sequencing depths of the dominant parent pool, recessive parent pool, dominant pool, and recessive pool were 14.12×, 16.19×, 24.02×, and 25.71×, respectively, all covering more than 90% of the whole genome. The sequencing data yield and quality met the analytical requirements. Differential SNP analysis identified 2710 differential SNPs. Since the SNPs associated with the target trait are linked to surrounding SNPs on chromosomes, the target gene for white pericarp was initially located at the terminal region 36027253–39778966 bp on chromosome 3, a candidate region containing 1600 SNPs. Figure 4 A).

[0033] 2.6 New gene for white pericarp CsLeuC fine positioning To narrow down the candidate region for the target gene, KASP technology was used to genotype 273 F2 segregating populations, and recombinant single plants were selected. The gene for white pericarp was initially located on chromosome 3 between SNP3G39144487 and SNP3G39531980 at a depth of 387 kb. Figure 4 B). To precisely locate the white pericarp gene and verify the accuracy of KASP genotyping in the F2 population, five heterozygous individuals (#169, #310, #199, #231, #319) from the F2 generation were selected, resulting in 400 F3 families. Five SNP markers were designed for genotyping verification. The target gene was ultimately located between 26 kb of SNP3G39505114 and SNP3G39531980 on chromosome 3. Figure 4C). Within this interval, the 9930 reference genome (version v2) contains 4 annotated genes, and sequencing revealed that only 4 of them were annotated. CsLeuC A missense mutation (A181T) occurs at SNP-181 in exon 2, resulting in a threonine (Thr) mutation to a serine (Ser) ( Figure 4 D). CsLeuC homologous genes LeuC Expression in Arabidopsis chloroplasts, preliminarily inferred CsLeuC This gene may be related to chlorophyll synthesis in cucumbers and is considered a candidate gene for regulating the white color of cucumber peel. Primer information is shown in Table 2.

[0034] Table 2 KASP primer information

[0035] 2.7 Subcellular localization of CsLeuC Multiple predictions showed that of the 14 Nearest Neighbors, 8 were located on chloroplasts, 5 were located extracellularly, and 1 was located in the cytoplasm. CsLeuC was located in both the cytoplasm and chloroplasts, with reliability values ​​of 1.666 and 1.588, respectively, significantly higher than those located on other structures. To confirm the specific intracellular location of the CsLeuC protein, a GFP-tagged CsLeuC fusion protein was transiently transfected into tobacco. The results are as follows: Figure 5 As shown, the CsLeuC-GFP signal was observed in chloroplasts, indicating that CsLeuC is distributed on chloroplasts.

[0036] 2.7 CsLeuC Expression analysis To understand CsLeuC The expression of different growth stages of Cuiqiulv and Cuiqiubai was observed. qRT-PCR analysis revealed that the expression of these growth stages in the pericarp of Cuiqiubai was different. CsLeuC The expression levels of these were all higher than those of Cuiqiulv. CsLeuC Differences in expression may have led to differences in the peel color of the two materials. Figure 6 A). Analyze different organs of the *Echeveria elegans* plant (peel, carpel, root, flower, stem, tendrils, and leaves). CsLeuC The expression level. The results showed that... CsLeuC The highest expression level was observed in leaves, exceeding that in other organs. Expression was also found in flowers, carpels, and pericarps. Figure 6 B).

[0037] 2.8 KASP Tag Development The KASP markers related to the white trait of cucumber pericarp described in this invention and their applications are located in... Csa3G912340 ( CsLeuCThe SNP is located at 181 bp in the second exon of the gene. Cucumbers with a T:T base combination at this location have white skin, while cucumbers with an A:A base combination at this location have green skin.

[0038] The primers used to detect the KASP markers associated with the white trait of cucumber pericarp are: Primer_AlleleFAM: GAAGGTGACCAAGTTCATGCTGAAGAAAACCCAACAGAGCCAGA (SEQ ID NO.2) Primer_AlleleHEX: GAAGGTCGGAGTCAACGGATTGAAGAAAACCCAACAGAGCCAGT (SEQ ID NO.3) Primer_Common: CGCCTCAACAATCGGAACGCAAG (SEQ ID NO. 4).

[0039] This invention first performs KASP analysis on 428 materials, including the Cuiqiu Green parent, the Cuiqiu White parent, the hybrid F2 generation, and the F3 generation, and then identifies the peel color phenotype of the 428 materials.

[0040] The parents of Cuiqiu Green were A:A at SNP-181, with green pericarp phenotype, totaling 19 plants. The parents of Cuiqiu White were T:T at SNP-181, with white pericarp phenotype, totaling 15 plants. The F1 generation was a heterozygous population, with A:T at SNP-181, green pericarp phenotype, totaling 20 plants (Table 3).

[0041] The F2 population consisted of 327 plants. At SNP-181, 69 plants were T:T, with 64 having a white peel phenotype and 5 having a green peel phenotype. At SNP-181, 72 plants were A:A, with 71 having a white peel phenotype and only 1 having a green peel phenotype. There were 186 heterozygous plants (A:T) at SNP-181, with 180 having a green peel phenotype and 6 having a white peel phenotype (Table 3). The F3 population consisted of 141 plants. At SNP-181, 3 plants were A:A, all with a green peel phenotype. There were 2 T:T plants, both with a white peel phenotype. There were 42 A:T heterozygous plants, all with a green peel phenotype (Table 4). In conclusion, this indicates that SNP-181 is linked to the white peel trait.

[0042] Table 3. Relationship between KASP test results and pericarp phenotypic traits of SNP-181

[0043] Table 4. Relationship between KASP test results and pericarp phenotypic traits of SNP-181

[0044] 2.9 Cucumber varieties with different peel colors CsLeuC Detection of the second exon SNP39505114 In addition, we separately tested the white-peel materials (Cuiqiu-W and T-1-5) and green-peel materials (Cuiqiu-G, NY19, S519, and BLF). CsLeuC SNP-181 on the second exon was sequenced. The results showed that the SNP was T in the white material of the pericarp and A in the green material. Figure 7 This further confirms CsLeuC It is the key gene for the formation of white skin on cucumbers.

[0045] 2.10 CsLeuC Gene editing verification The constructed CRISPR / Cas9 gene editing vector pKSE402- CsLeuC The green material for converting fruit peel, Cuiqiu Green, has the effect of... CsLeuC Gene editing was performed. Cucumber explants were screened using a fluorescence stereomicroscope, and one T1 generation positive plant was obtained. CR-csleuc -B4a, sequencing results analysis revealed that this gene-edited strain is a homozygous edited plant ( Figure 8 Gene-edited plants CR-csleuc -B4a has a white peel, which is inconsistent with the green phenotype of the Cuiqiu Green peel, confirming that... CsLeuC It is the gene that regulates the white color of cucumber peel.

[0046] Exon sequences > Csa3G912340

Claims

1. A KASP marker associated with the white trait of cucumber pericarp, characterized in that, The SNP sites of the KASP marker correspond to CsLeuC A mutation from A to T at 181 bp in the second exon of the gene results in a cucumber with a white peel, which is the TT genotype at this molecular marker.

2. The KASP marker associated with the white trait of cucumber pericarp as described in claim 1, characterized in that, The nucleotide sequence of the KASP marker is shown in DEQ ID NO.

1.

3. A kit for detecting KASP markers associated with the white trait of cucumber pericarp, characterized in that, The kit includes primers for detecting KASP markers associated with the white trait of cucumber pericarps, the primers comprising: Primer_AlleleFAM: GAAGGTGACCAAGTTCATGCTGAAGAAAACCCAACAGAGCCAGA; Primer_AlleleHEX: GAAGGTCGGAGTCAACGGATTGAAGAAAACCCAACAGAGCCAGT; Primer_Common: CGCCTCAACAATCGGAACGCAAG.

4. The application of a reagent for detecting KASP markers associated with the white trait of cucumber peel in identifying the genetic traits of white cucumber peel in breeding; wherein the KASP marker is the KASP marker described in claim 1.

5. Application of primers for detecting KASP markers associated with the white trait of cucumber peel in identifying the genetic breeding of the white trait of cucumber peel; wherein the KASP marker is the KASP marker described in claim 1, and the primers are the primers described in claim 3.

Images