Application of PABPC3 as target in diagnosis and treatment of systemic lupus erythematosus
By studying the regulatory mechanism of PABPC3 in the B-cell antibody class switching and recombination process, we developed diagnostic and therapeutic methods based on PABPC3, which solved the problem of abnormal B-cell antibody production in the diagnosis and treatment of SLE, and realized an innovative method for early diagnosis and treatment.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- CHINA AGRI UNIV
- Filing Date
- 2026-03-24
- Publication Date
- 2026-04-21
AI Technical Summary
Existing technologies struggle to precisely regulate the production of abnormal B-cell antibodies in the diagnosis and treatment of systemic lupus erythematosus (SLE), leading to uncontrollable disease progression. This is especially true in childhood SLE (cSLE), where diagnostic techniques are limited and the disease progresses rapidly, making it difficult for current interventions to effectively intervene while preserving immune function.
By exploring the regulatory mechanism of polyadenylate-binding protein 3 (PABPC3) in the B-cell antibody class switching recombination (CSR) process, we will develop diagnostic products using the PABPC3 gene or its encoded protein as biomarkers, and conduct treatments by specifically detecting and inhibiting the expression of the PABPC3 gene or its encoded protein, combined with animal models to screen effective drugs.
This provides a new approach to early diagnosis of SLE, achieving high-accuracy diagnosis through the detection of PABPC3 gene expression levels, and offering new treatment options by reducing or inhibiting PABPC3 gene expression to slow disease progression.
Smart Images

Figure CN121896347A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of biopharmaceuticals and medical diagnostics, specifically relating to the application of PABPC3 as a target in the diagnosis and treatment of systemic lupus erythematosus. Background Technology
[0002] Systemic lupus erythematosus (SLE) is one of the most common autoimmune diseases. It is a complex disease caused by multiple factors, including genetics, environment, and immunity. Clinical manifestations include the production of various autoantibodies and the deposition of immune complexes affecting multiple organs (skin, kidneys, lungs, heart, and brain), leading to a series of complications and, in severe cases, death. Childhood systemic lupus erythematosus (cSLE), compared to other types of patients, presents challenges such as limited diagnostic techniques, rapid onset, and severe consequences. Therefore, exploring the pathogenesis and treatment of SLE and cSLE, especially finding effective early diagnostic methods, has always been a key focus and challenge in basic immunology and rheumatology.
[0003] The core pathogenesis of SLE involves abnormally increased cell apoptosis, impaired clearance of late-stage apoptotic debris, and increased exposure to autoantigens. This is accompanied by abnormal responses of both innate and adaptive immune cells to autoantigens, disrupting the body's self-tolerance. Misguided T and B cells bind to and present these autoantigens, triggering an adaptive immune response that produces various autoantibodies and forms autoimmune complexes that deposit in tissues, leading to a violent and abnormal immune reaction that ultimately damages various organs throughout the body. As the core pathogenesis of SLE is explored, current clinical interventions primarily include novel calcineurin inhibitors, aniluzumab targeting type I interferon receptors, berutinumab targeting B lymphocyte stimulation receptors, and rituximab targeting CD20. However, these methods broadly intervene in B lymphocytes themselves or their signal reception and transduction, failing to precisely regulate the production of abnormal B cell antibodies while maintaining normal immune function. A crucial step in the production of diverse antibodies by B cells is antibody class switching and recombination (CSR). Identifying key regulatory factors controlling chronic renal stenosis (CSR) in SLE patients can influence B cell activity and antibody production, thereby intervening in the SLE disease progression. The purpose of this invention is to delve into the key regulatory factors of CSR and explore the relationship between these key regulatory factors and SLE. Summary of the Invention
[0004] Poly(A) Binding Protein Cytoplasmic 3 (PABPC3) is an RNA-binding protein that binds to the poly(A) tail of mRNA, participating in the cytoplasmic regulation of mRNA metabolism and thus influencing various physiological processes. However, its role in immune diseases has not been well understood. In our in vitro cellular immune response studies targeting this gene, we discovered that PABPC3 can regulate mRNA transport, stability, and translation by binding to the 5' and 3' UTR regions, affecting B cell antibody class switching. This is a key factor in the abnormal increase of autoantibodies in patients. Therefore, this invention provides a novel application of the PABPC3 gene, aiming to offer new insights for the early diagnosis and treatment of SLE.
[0005] To achieve the above objectives, the technical solution of the present invention is as follows: Firstly, it provides the application of the PABPC3 gene or its encoded protein as a biomarker in the preparation of diagnostic products for detecting diseases related to B-cell immune abnormalities.
[0006] Furthermore, the aforementioned B-cell immune abnormality-related diseases are antibody class switching and recombination-related diseases.
[0007] Furthermore, the antibody class conversion recombinant-related disease is systemic lupus erythematosus.
[0008] Secondly, the application of a substance specifically detecting the expression of the PABPC3 gene or its encoded protein in the preparation of products for diagnosing systemic lupus erythematosus is provided, characterized in that the substance specifically detecting the expression of the PABPC3 gene or its encoded protein includes primers, probes, aptamers, and antibodies.
[0009] Furthermore, the product is a primer pair, the sequences of which are shown in SEQ ID NO.7 and SEQ ID NO.8.
[0010] Thirdly, a primer pair for detecting the PABPC3 gene is provided, characterized in that the primers have sequences as shown in SEQ ID NO.7 and SEQ ID NO.8.
[0011] Fourthly, it provides the application of reagents that specifically reduce or inhibit the expression of the PABPC3 gene or its encoded protein in the preparation of drugs for treating SLE.
[0012] Further, the reagent is si-RNA1 and / or si-RNA2, wherein the si-RNA1 sequence is shown in SEQ ID NO.1 and the si-RNA2 sequence is shown in SEQ ID NO.2.
[0013] Fifthly, a method is provided for assisting in determining the effectiveness of potential drug treatments for systemic lupus erythematosus, characterized in that the method comprises: (1) Construct an animal model of systemic lupus erythematosus; (2) Intervene in animal models using potential therapeutic drugs; (3) RNA was extracted from peripheral blood samples of untreated and treated animal models and reverse transcribed into DNA. The expression of PABPC3 in these samples was detected by RT-qPCR. (4) The effectiveness of the potential drug can be determined by the change in PABPC3 expression level.
[0014] Sixthly, a method for screening drugs for treating systemic lupus erythematosus is provided, characterized in that the method comprises; (1) Construct an animal model of systemic lupus erythematosus; (2) Intervene in animal models using potential therapeutic drugs; (3) RNA was extracted from peripheral blood samples of untreated and treated animal models and reverse transcribed into DNA. The expression of PABPC3 in these samples was detected by RT-qPCR. (4) Screening for effective therapeutic drugs by changing the expression level of PABPC3.
[0015] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention reveals for the first time a novel mechanism by which PABPC3 participates in the B-cell antibody class conversion and recombination process. In an animal model of SLE, it demonstrates that PABPC3 exhibits a strong response to the progression of SLE and plays a crucial regulatory role in antibody production during the immune response. It has the potential to serve as a biomarker for early diagnosis and intervention in SLE, and could be developed into related diagnostic products. Furthermore, reducing or inhibiting PABPC3 gene expression may also provide a new approach to SLE treatment. Attached Figure Description
[0016] Figure 1 Serum proteomics analysis of cSLE patient samples; where A is a schematic diagram of the correlation analysis between samples from healthy individuals and patients; B is a pie chart of differentially expressed proteins in the serum of healthy controls and cSLE patients; C is a volcano plot of the fold change of differentially expressed proteins in the serum of healthy controls and cSLE patients; D is a bar chart of the number of increases and decreases in differentially expressed proteins in cSLE patients compared to healthy individuals; E is a schematic diagram of the proportion of changes in differentially expressed proteins; F is a graph of pathway enrichment results for differentially expressed proteins; G is a bar chart of expression changes of immunoglobulin-related genes, including heavy chain gene (IGH), light chain (k) chain gene (IGK), and light chain (λ) chain gene (IGL).
[0017] Figure 2 This diagram illustrates the results of silencing PABPC3 in the CH12F3 cell line in vitro, which weakens antibody class conversion and recombination function. A shows a schematic diagram of the silencing sequence sites of si-Pabpc3 in the cell line model; B shows the silencing efficiency of Pabpc3 mRNA in the cell line detected by qPCR; C shows the silencing efficiency of Pabpc3 protein in the cell line detected by Western spectroscopy; D shows a flow cytometry diagram of the proportion of IgA generated after antibody class conversion and recombination in the cell line; E shows a statistical diagram of the proportion of IgA generated in the cell line; F shows a volcano plot of differentially expressed genes in the cell line RNA-seq samples; G shows a heatmap of differentially expressed genes in the cell line RNA-seq samples; and H shows a schematic diagram of GO enrichment analysis of differentially expressed genes after Pabpc3 silencing.
[0018] Figure 3 Analysis of PABPC3 binding sites; where A is a schematic diagram of the correlation analysis between samples in LACE-seq; B is a schematic diagram of the binding sequence position analysis of RNA-binding protein PABPC3 under immune activation; C is a characteristic analysis of the binding site of RNA-binding protein PABPC3 under immune activation; D is a motif analysis of PABPC3 binding under immune activation; E is a schematic diagram of the abundance of different motifs of PABPC3 binding based on zscore analysis; F is a schematic diagram of GO enrichment analysis of RNA bound by PABPC3; G is a schematic diagram of the binding of PABPC3 in transcripts of antibody class switching recombination-related genes.
[0019] Figure 4 PABPC3 expression in a mouse SLE model and under nutritional intervention; where AB is a statistical diagram of the ratio of mouse spleen to body weight; C is a statistical diagram of the content of ds-DNA in mouse serum; D is a statistical diagram of the content of TNF-α in mouse serum; E is a statistical diagram of the mRNA expression level of Pabpc3.
[0020] Figure 5 Expression of SLE samples under different primer sequences of PABPC3; where A is the amplification curve of the sample under the action of internal reference primer, primer 1, primer 2 and primer 3; B is the melting curve of the sample under the action of internal reference primer, primer 1, primer 2 and primer 3. Detailed Implementation
[0021] The following detailed embodiments further illustrate the concept and technical effects of the present invention to fully understand its purpose, features, and effects. Unless otherwise specified, all methods described are conventional methods. Unless otherwise specified, all materials are available from publicly available commercial sources. The illustrative embodiments and descriptions of the present invention are used to explain the invention and do not constitute an undue limitation thereof. It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other.
[0022] Example 1: cSLE Differential Protein Expression Analysis
[0023] Peripheral blood samples were randomly collected from 5 children diagnosed with SLE and 5 healthy children from the Capital Institute of Pediatrics Affiliated Hospital for serum proteomics analysis. The specific procedures were as follows: (1) Sample preparation: Collect 5 mL of venous blood using an anticoagulant-free vacuum blood collection tube. Let it stand at room temperature for 30-60 min until completely coagulated, avoiding vigorous shaking or delayed processing to prevent hemolysis. Centrifuge at 1500 ×g for 10 min at 4℃. Carefully aspirate the supernatant serum into a new tube, aliquoting 100 µL / tube, and store at -80℃ for later use. Bind 100 µL of serum to an Agilent Hu-14 column and load the sample with binding buffer (pH 7.4) according to the instructions at a flow rate of 0.5 mL / min. Collect the flow-through. Repeat the column pass twice to improve removal efficiency.
[0024] (2) Protein extraction and quantification: The serum (without high-abundance proteins) and lysis buffer were mixed at a volume ratio of 1:4, vortexed for 5 min, and then sonicated on ice (40% power, 10 s pulse × 3 times, 30 s interval). The sonication was performed on ice throughout, avoiding temperatures exceeding 25℃. The sample concentration was determined and adjusted to 1 µg / µl according to the BCA kit instructions.
[0025] (3) Protein digestion and peptide purification: Add 10 mM DTT to a final concentration of 5 mM and incubate at 56℃ for 30 min.
[0026] After cooling to room temperature, add 55 mM IAM and incubate in the dark for 30 min. Dilute the sample with 50 mM NH4HCO3 to a urea concentration ≤1 M, add trypsin at an enzyme:substrate ratio of 1:50, and incubate at 37°C with shaking (600 rpm) for 16 h. Terminate the reaction by adding 1% TFA and adjust the pH to 2-3. Prepare the C18 StageTip: Load three layers of C18 membranes into 200 µL pipette tips and activate them sequentially with 100 µL methanol and 60% ACN / 0.1% FA. After loading the sample, wash sequentially with 0.1% FA and 5% ACN / 0.1% FA, elute the peptides with 60% ACN / 0.1% FA, and concentrate to near dryness by vacuum centrifugation. Determine the peptide concentration for LC-MS analysis.
[0027] (4) DIA mass spectrometry data acquisition: Peptide samples were separated using a Neo UHPLC system. The chromatographic column used 0.1% formic acid aqueous solution (phase A) and 0.1% formic acid acetonitrile solution (phase B) as the mobile phase. During the initial equilibration phase, the trap column was washed with 96% phase A. The gradient separation program was as follows: 0-0.1 min, phase B linearly increased from 4% to 6%; 0.1-1.1 min increased to 12%; 1.1-4.3 min increased to 22.5%; 4.3-6.1 min rapidly increased to 45%; 6.1-8 min maintained 99% phase B washing of the column. The separated peptides were analyzed by DIA using an Orbitrap Astral mass spectrometer with the following parameters: electrospray voltage 2.2 kV, positive ion mode, precursor ion scan range 380-980 m / z; primary mass spectrometry resolution 240,000 (AGC 500%, maximum injection time 3 ms), and secondary resolution 80,000 (same as AGC and injection time).
[0028] (5) DIA mass spectrometry data retrieval: DIA-NN software (v1.8.1) is used for unified integration. The original files (such as .raw, .mzML) are parallelized by preset parameters, and peptide and protein identification is completed by combining the UniProt database (FDR≤1%).
[0029] Figure 1 The results showed that cSLE patient samples and serum samples from healthy individuals had good technical reproducibility. Figure 1 (A) The ring heatmap showed significant differences in protein expression between healthy individuals and cSLE patient samples. Figure 1 (B, E). Compared with healthy controls, the expression of 272 proteins was significantly increased in cSLE patient samples, while the expression of 123 proteins was decreased ( Figure 1(C, D) Figure 1 Figure F shows the relationship between proteins with significant changes in proteomics and their enrichment pathways. GO cluster analysis revealed that differentially expressed proteins in cSLE patients were mainly enriched in immunoglobulin-mediated immune responses, IgG immunoglobulin complexes, IgA immunoglobulin complexes, and antigen binding processes. Figure 1 (F). In addition, we analyzed the expression of immunoglobulins, such as... Figure 1 As shown in Figure G, the results indicate that proteins associated with the abundance of IgA and IgG proteins were also significantly elevated. Overall, cSLE patients exhibit more differentially expressed proteins compared to healthy individuals, all of which are related to immune responses and antibody production processes.
[0030] Example 2: Function of PABPC3 in Immune Response
[0031] The involvement of PABPC3 in antibody production during SLE disease was investigated. This process was first explored using the CH12F3 cell line (provided from the Kefei Yu laboratory at Michigan State University, but also commercially available; both can serve as in vitro models in this invention) as an in vitro model to investigate the effect of PABPC3 on antibody type conversion recombinant (CSR) antibody production. The CH12F3 cell line, as a B lymphocyte cell line used to study antibody production function, represents the efficiency of CSR by its ability to specifically convert IgM to IgA antibodies induced by cytokines.
[0032] This embodiment constructed two si-RNAs for PABPC3 (such as...). Figure 2 (As shown in Figure A), the si-RNA sequence is shown in Table 1. It was transfected into the CH12F3 cell line (…). Figure 2 The corresponding siRNAs are siRNA1 and siRNA2, respectively, and a normal, untransfected CH12F3 cell line was set as a control. Figure 2 The silencing efficiency of PABPC3 mRNA in the cell line was detected by qPCR, and the silencing efficiency of PABPC3 protein in the cell line was detected by Western blotting. The primers used for qPCR are shown in Table 2, the reaction system is shown in Table 3, and the reaction procedure is shown in Table 4.
[0033] The transfection process specifically includes the following steps: a. Take 10 ml of approximately 3-5 million CH12F3 cells, centrifuge at 1500 rpm for 5 min, remove the supernatant, resuspend and wash twice with sterile PBS, and then add buffer R from the electroporation kit to the cell pellet to resuspend the cells.
[0034] b. Aliquot the cells into three 1.5ml centrifuge tubes, and add siRNA stock solution to each tube at a ratio of 1:200 and mix well.
[0035] c. Place the electroporation tube in the electroporation apparatus and add 3 ml of electroporation buffer to the tube. After attaching the electroporation tip to the electroporator, aspirate 100 μL of the electroporation mixture and place it in the electroporation tube. Stimulate the cells with electrical stimulation at 1700 V, 20 ms, and 1 pulse to induce siRNA entry into CH12F3 cells.
[0036] d. After electroporation, the cells were placed in an incubator and cultured. They were stimulated with purified 1 μg / mL anti-mouse / rat CD40, 10 ng / mL recombinant mouse IL-4, and 2 ng / mL recombinant human TGF-β1 at a concentration of 1×10⁻⁶. 5 Culture cells at a density of cells / mL for 3 days.
[0037] e. Collect the processed cells into 1.5 ml centrifuge tubes, centrifuge at 1500 rpm for 5 minutes, and discard the supernatant. Mix the fluorescently labeled antibody with PBS at a ratio of 1:400, add 100 μL of IgA antibody mixture to each tube, and perform detection using a BDLSL Fortessa X-20 flow cytometer.
[0038] Table 1 si-RNA sequences
[0039] Table 2 qPCR primer sequences
[0040] Table 3 qPCR reaction system
[0041] Table 4 qPCR reaction procedure
[0042] The results are as follows Figure 2 As shown, the expression levels of both mRNA and protein of PABPC3 were significantly suppressed compared to normal cells. Figure 2 (Figures B and C) indicate that both siRNAs significantly inhibited the expression of the PABPC3 gene in B lymphocytes, with siRNA2 showing a stronger effect. Under gene silencing, the proportion of IgA produced by stimulated cells decreased significantly. Figure 2The results (D and E) indicate that PABPC3 is involved in antibody production during the immune response. RNA-seq results show that there are a large number of differentially expressed genes between PABPC3-silenced cells and normal cells. Figure 2 In the F-cell line, the two siRNAs showed a high correlation and both were significantly different from the normal cell line (NC). Figure 2 GO enrichment analysis of differentially expressed genes in the G10 showed that pathways related to B cell activation, mRNA 3'UTR binding, DNA recombination, antibody production, and immune response regulation were significantly altered. Figure 2 (H). The above results indicate that PABPC3 participates in the CSR process and thus affects the immune response process of antibody production, making it a key influencing factor in the CSR process. The two siRNAs designed in this embodiment can intervene in the influence of PABPC3 on the CSR process, resulting in a significant decrease in the proportion of IgA produced by B lymphocytes upon stimulation.
[0043] Example 3: Mechanism of action of PABPC3 in the antibody production process
[0044] As an RNA-binding protein, PABPC3 was further investigated in this embodiment to explore whether it directly binds to RNA and its mechanism of action in influencing antibody production. Allylation complementary end ligation sequencing (LACE-seq) was used to detect the RNA-binding target. The procedure is as follows: a. A portion of the CH12F3 cell line was stimulated with CD40, IL4, and TGF-β for three days, and the samples were collected. The RNA and protein complexes within the cells were covalently cross-linked using a UV spectrometer to stabilize the RNA-protein complexes.
[0045] b. The cross-linked cells were lysed, and the RNA was partially digested using RNase. Immunoprecipitation (IP) was followed by reverse transcription and linear amplification. Library construction was then performed: the amplified products were ligated with adapters, amplified by PCR, and a sequencing library was generated.
[0046] c. After the immunoprecipitation (IP) reaction, the IP complex was washed in multiple steps using gradient washing buffers to effectively remove non-target RNA residues. Subsequently, the target RNA fragment was isolated and purified by proteinase K digestion and acid dissociation, and an NGS-ready library was constructed using the NEBNext® Ultra™ II RNA high-efficiency library construction module.
[0047] d. Perform paired-end sequencing using the Illumina platform. Use cutadapt to remove adapters and poly-A tails, filter low-quality (Phred <30) and short sequences (<18bp), first align to pre-RRNA to remove rRNA contamination, then align unaligned reads to the genome (hg38, allowing 2 mismatches), and output BAM files (tools: bowtie or STAR). Use bedtools bamtobed to convert the format, and use Piranha modeling to identify significant peaks (parameters: -p 0.001, -b 20).
[0048] e. Finally, the peak distribution is displayed using the Integrative Genomics Viewer (IGV).
[0049] Assuming high correlation between group samples, the results are as follows Figure 3 As shown, PABPC3 mainly binds to the Repeat region (50%), Intergenic region (44.95%), and Intron region (3.49%) in all detected sequences. Figure 3 Meta-analysis showed that in activated B cells, PABPC3 mainly binds at the 5' UTR of the transcription start site (TSS) and the 3' UTR of the transcription termination site (TES). Figure 3 (B). Kmer and HOMER-E analyses showed that PABPC3 binding was more significant in motifs rich in CCCCC. Figure 3 (D). Furthermore, GO enrichment analysis results indicate that PABPC3-bound mRNA is mainly enriched in processes such as 5'UTR and 3'UTR binding, mRNA cleavage, Poly(A) binding, and mRNA stabilization. Figure 3 (E, F). By comparing the transcripts of PABPC3-related binding genes in cells under immune activation and physiological states, we found that CSR-related gene transcripts bind more strongly to PABPC3 under immune stimulation. Figure 3 (G). The above results indicate that PABPC3 directly mediates antibody production in the immune response by binding to transcripts of genes involved in the CSR process.
[0050] Example 4: Constructing an animal model to investigate the role of PABPC3 in SLE.
[0051] Pristane is a medium-length alkyl chain that can induce inflammation and enhance the immune response. In this embodiment, a single intraperitoneal injection of 0.5 mL pristane was used to establish a SLE model in 6-8 week old C57 / BL6 female mice. A total of 24 mice were divided into a control group (n=8) and a model group (n=16). The control group mice received an intraperitoneal injection of 0.5 mL saline, while the model group mice received an intraperitoneal injection of 0.5 mL pristane. The growth and disease changes in both groups were observed periodically for approximately 6 months. After the modeling period, half of the mice (n=8) were separated from the model group to form a Bifidobacterium intervention group, and the remaining 8 mice were used as the model. The Bifidobacterium group mice were treated with 1×10... 8 Nutritional intervention was administered to SLE model mice via gavage at a dose of CFU / mouse once daily for two months. Bifidobacterium, a probiotic isolated from the feces of breastfed infants, has been extensively studied and its regulatory role in immunity has been revealed.
[0052] After the animal model was established, during the euthanasia of the mice, gross observation revealed lesions in the abdominal organs, including varying numbers of fatty granulomatous nodules and abnormally enlarged spleens. Figure 4 (A, B). The success of mouse modeling was determined by the expression level of anti-dsDNA antibody (a commonly used reference indicator for clinical disease assessment) in mouse serum. Figure 4 The C-value indicates that the serum dsDNA level in the Model group mice was significantly higher than that in the Ctrl group mice; in addition, the significantly elevated inflammatory factor TNF-α in the Model group compared with the Ctrl group also helps to explain the modeling effect in SLE mice. Figure 4 (D).
[0053] The modeling process is illustrated in the following reference: Yang, L., Zhang, T., Wang, P. et al. Imatiniband M351-0056 enhances the function of VISTA and ameliorates the development of SLE via IFN-I and noncanonical NF-κB pathway. Cell Biol Toxicol 39, 3287–3304(2023). https: / / doi.org / 10.1007 / s10565-023-09833-6
[0054] ds-DNA and TNF-α detection: An enzyme-linked immunosorbent assay (ELISA) was used, specifically as follows: a. Dilute the coating antibody with ELISA Coating Buffer, adding 100 μL of the diluted coating antibody to each well (Note: Each standard or sample should be tested repeatedly). Incubate at room temperature (20-25°C) for 1 hour.
[0055] b. After incubation, wash the plate five times with ELISA Wash Solution.
[0056] c. Then, add 200 μL of ELISA Blocking Buffer to each well and incubate at room temperature for 30 minutes.
[0057] d. After incubation, wash the plate five times with ELISA Wash Solution.
[0058] e. Dilute the coated antibody using Sample / Conjugate Diluent, and add 100 μL of standard or mouse serum sample diluent to each well. Incubate at room temperature for 1 hour.
[0059] f. After incubation, wash the plate five times with ELISA Wash Solution.
[0060] g. Dilute the HRP detection antibody with ELISA Coating Buffer, adding 100 μL of the diluted HRP detection antibody to each well. Incubate at room temperature for 1 hour.
[0061] h. After incubation, wash the plate five times with ELISA Wash Solution.
[0062] i. Add 100 μL of TMB reaction solution to each well, develop the plate in the dark at room temperature for 15 minutes, and add 100 μL of stop solution to each well to stop the reaction.
[0063] j. Measure the absorbance at 450 nm using an ELISA reader, and calculate the fitted curve and concentration using ELISA Calc.
[0064] PABPC3 mRNA detection: Spleen tissues were collected from model and control mice, RNA was extracted, and the expression level of PABPC3 in mouse tissues was detected by qRT-PCR. The gene sequence and reaction system are shown in Tables 2 and 3.
[0065] Due to abnormal activation of the immune system, the spleen mass ratio of the model group mice was significantly increased. Figure 4 (AB), and the levels of ds-DNA and TNF-α in mouse serum were significantly increased ( Figure 4 (C, D) This indicates that the mouse SLE model was successfully established. With successful model establishment, Pabpc3 expression increased significantly ( Figure 4 The results (E) indicate that Pabpc3 has a strong response to SLE. Furthermore, the results also showed that, compared to the model group, under Bifidobacterium nutritional intervention, the spleen mass of the model mice tended to decrease, and the levels of dsDNA and TNF-α in serum were significantly reduced. With this abnormal immune response alleviated, the expression of Pabpc3 in the spleen tissue of the model-intervention mice also tended to be consistent with that of the control group. Figure 4 (E).
[0066] The above results indicate that PABPC3 has a strong response to the progression of SLE and plays an important regulatory role in CSR during the immune response process. It has the potential to serve as a biomarker for the diagnosis and intervention of SLE. Furthermore, reducing or inhibiting the expression of the PABPC3 gene or increasing its adsorption can effectively delay the progression of SLE, which will open up new application scenarios for the treatment of SLE.
[0067] Example 5: Application of PABPC3 gene in the clinical diagnosis of SLE
[0068] 1. Based on the research results of Examples 1-4, this example explores the preliminary application of the PABPC3 gene in the clinical diagnosis of SLE. Peripheral blood samples from 15 children diagnosed with SLE and 15 healthy children were randomly collected from the Affiliated Hospital of Capital Institute of Pediatrics. RNA was extracted from the samples and reverse transcribed into cDNA. The expression of PABPC3 in these samples was detected by RT-qPCR.
[0069] Specifically as follows: The primers used are as follows. In addition, the reaction system used for qPCR is shown in Table 3, and the reaction procedure is shown in Table 4.
[0070] This embodiment designs three sets of primers relevant to the clinical application of PABPC3. All three sets of primers conform to the basic rules of primer design. Group 1: Forward primer: AGACACAACGAAGCAGCTGAA (SEQ ID NO.7); GC content of forward primer is 50%, Tm: 59.9; Reverse primer: TGTGCGCTTAAGTTCCGTCT (SEQ ID NO.8); GC content of reverse primer 50%, Tm: 59.9; Group 2: Forward primer: AGACGGAACTTAAGCGCACA (SEQ ID NO.9); forward primer GC content 50%, Tm: 59.9; Reverse primer: TTTGCTTTTGAGGAGGGGCA (SEQ ID NO.10); reverse primer GC content 50%, Tm: 60; Group 3: Forward primer: GTGGTCTCAGCGTGATCCAT (SEQ ID NO.11); GC content of forward primer is 55%, Tm: 59.8; Reverse primer: AGCTCTTTCAGCTGCTTCGT (SEQ ID NO.12); GC content of reverse primer is 50%, Tm: 59.9; Primer performance characterization: Four sets of candidate primer sequences were diluted according to the required concentration in the reaction system. The forward and reverse primers were used as one set, and the results were validated in peripheral blood samples from cSLE patients. Each sample was tested in triplicate. A blank control group (sterile enzyme-free water) and a negative control group (peripheral blood samples from 15 healthy individuals) were also included. Real-time quantitative PCR was performed on the cSLE samples according to the above reaction system and conditions.
[0071] The results showed that, after screening, the first group of primer sequences was the most effective, exhibiting a single-peaked melting curve, a Ct value below 25, and a clear amplification curve. The second and third groups of primers showed distinct double-peaked melting curves, with Ct values ≥25, indicating poor primer specificity. Figure 5 As shown in Figures A and B, where Figure 5 In the diagram, A represents the amplification curve. Figure 5 B is the primer dissolution curve.
[0072] Furthermore, the detection results of 30 samples using the first set of primers are shown in the table below. All 15 positive samples tested positive by qPCR, and all 15 healthy samples tested negative by qPCR. The qPCR definition criteria are: CT value > 25 is negative, and CT value ≤ 25 is positive.
[0073] Table 4 Clinical Sample Test Results
[0074] 2. Based on the above research results, this embodiment further expands the application of the PABPC3 gene in the clinical diagnosis of SLE. Ten peripheral blood samples were randomly collected from the Capital Institute of Pediatrics Affiliated Hospital, including five healthy samples and five cSLE patient samples. During collection and experimentation, it was unknown which sample was from an SLE patient. RNA was extracted from the samples and reverse transcribed into cDNA. The expression level of PABPC3 in these samples was detected by RT-qPCR. Primer 1 selected in Example 5 was used, and the same quantitative real-time PCR experimental method as in Example 5 was used to detect the PABPC3 expression level in the 10 samples. The results were then compared to determine that five samples were SLE.
[0075] By comparing with clinical diagnoses, peripheral blood samples diagnosed with SLE showed elevated cardiolipin antibody IgG (>12, indicating a positive result; <8, indicating a negative result), lupus anticoagulant (>1.2, with 0.8-1.2 considered normal), and dsDNA (>200, with <100 considered normal). Therefore, the peripheral blood samples identified in this experiment were indeed from cSLE patients, with an accuracy rate of 100%. This demonstrates the accuracy of PABPC3 expression analysis in patients with unknown clinical disease status.
[0076] The embodiments described above are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.
Claims
1. The application of the PABPC3 gene or its encoded protein as a biomarker in the preparation of diagnostic products for detecting diseases related to B-cell immune abnormalities; wherein the B-cell immune abnormality-related diseases are antibody class switching and recombination-related diseases; wherein the antibody class switching and recombination-related diseases are systemic lupus erythematosus.
2. The application of substances that specifically detect the expression of the PABPC3 gene or its encoded protein in the preparation of products for diagnosing systemic lupus erythematosus, characterized in that, The substances specifically used to detect the expression of the PABPC3 gene or its encoded protein include primers, probes, aptamers, and antibodies.
3. The application according to claim 2, characterized in that, The product is a primer pair, and the primer pair sequences are shown in SEQ ID NO.7 and SEQ ID NO.
8.
4. The application of reagents that specifically reduce or inhibit the expression of the PABPC3 gene or its encoded protein in the preparation of drugs for treating SLE.
5. The application according to claim 4, characterized in that, The reagents are si-RNA1 and / or si-RNA2, wherein the si-RNA1 sequence is shown in SEQ ID NO.1 and the si-RNA2 sequence is shown in SEQ ID NO.2.
Citation Information
Patent Citations
Antibodies bound to tumor tissue for diagnosis and therapy
CN114040774A
Male infertility marker screening method, system and equipment
CN116884488A
Gene combination for risk prediction of acute graft versus host disease and donor screening before hematopoietic cell transplantation and application thereof
CN119144710A
Application of PABPC3 as marker for evaluating prognosis of metastatic ovarian cancer
CN119506430A
SNP (Single Nucleotide Polymorphism) marker for targeted identification of systemic lupus erythematosus of children and application thereof
CN121653243A