Recombinant strain for synthesizing veratrazine and steroid precursor thereof and application of recombinant strain

Abstract

The invention relates to the technical field of biology, in particular to construction and application of a recombinant strain for synthesizing veratrazine and steroid precursors of the veratrazine, and the steroid precursors comprise squalene, ergosterol, lanosterol, 22R-hydroxy cholesterol, 22R, 26-dihydroxy cholesterol and 22-hydroxy-26-amino-cholesterol. The recombinant strain provided by the invention can efficiently express steroid precursors, for example, the content of lanosterol reaches 172mg / L and is increased by about 170 times compared with that of an original strain, the yield of 22R-hydroxycholesterol reaches 3482.83 mu g / L, the yield of 22R, 26-dihydroxycholesterol reaches 1003.05 mu g / L, veratrazine can be efficiently synthesized, and the yield of veratrazine reaches 265.38 mu g / L.

Description

Technical Field

[0001] This application relates to the field of biotechnology, and in particular to the construction and application of a recombinant strain for synthesizing veratrazine and its steroidal precursors. Background Technology

[0002] Hellebore ( Veratrum nigrum *Veratrum nigrum* (L.) is a perennial herb belonging to the genus *Veratrum* in the family Veratraceae. Both its roots and rhizomes are used medicinally, as recorded in the *Shennong Bencao Jing* (Shennong's Classic of Materia Medica), where it was used to treat poisoning, coughs, induce vomiting, and kill parasites. Steroidal alkaloids are the main active ingredient in *Veratrum nigrum*, and veratrazine, a typical hexacyclic steroidal alkaloid, possesses various biological activities. Modern pharmacological studies have shown that veratrazine can activate mitochondrial apoptosis pathways, block PI3K / AKT signaling, and inhibit NF-κB nuclear translocation, exhibiting dose-dependent cytotoxic and tumor growth-inhibiting effects in liver cancer, lung cancer, and breast cancer models. In animal experiments, veratrazine can inhibit DNA synthesis in mouse ascites-type liver cancer cells S-180 and downregulate melanin production in mouse melanoma cells B16-F10. Furthermore, veratrazine can act as an antibacterial agent against *Candida albicans* (…). Candida albicans ), Trichophyton rubrum ( Trichophyton rubrum ) and Trichophyton mentagrophytes ( T. mentagrophytes It has a significant inhibitory effect, and its mechanism is related to the disruption of membrane integrity and biofilm formation.

[0003] Although veratrazine possesses various important pharmacological activities, the low content of its active ingredients in plants and the slow growth rate of plants greatly hinder its further development and large-scale production. Chemical synthesis can achieve the asymmetric synthesis of veratrazine based on a cascade ring-opening reaction of diosgenin, but the reaction process is complex and generates a large number of byproducts. Some studies have transferred the metabolic pathway of veratrazine into *Capsella bursa-pastoris* (*Capsella bursa-pastoris*). Camelina sativa This allows for the synthesis of veratrazine and other steroidal alkaloids, but the yield is only 6.7 ng / g. Based on high-cholesterol-producing tobacco, transient expression of key genes VnCYP90B27, VnCYP94N2, VnGABAT, and VnCYP90G9, along with optimization of the subcellular localization of GABAT, enabled heterologous synthesis of veratrazine in tobacco leaves, achieving a yield of 0.63 μg / g. However, this still falls short of meeting large-scale pharmaceutical demands. Therefore, there is an urgent need to develop more efficient biosynthetic systems to increase veratrazine production. Summary of the Invention

[0004] Therefore, this invention provides the construction and application of strains that synthesize veratrazine and its steroidal precursors. The constructed recombinant strains can not only efficiently synthesize veratrazine, but also efficiently synthesize veratrazine steroidal precursors, including squalene, ergosterol, lanosterol, 22R-hydroxycholesterol, 22R,26-dihydroxycholesterol and 22-hydroxy-26-amino-cholesterol.

[0005] According to a first aspect of the embodiments of this application, a recombinant strain is provided. The recombinant strain is based on Saccharomyces cerevisiae as the starting strain, the YPL062w gene is knocked out in its genome, and the PptHMGR gene is integrated into the genome. The nucleotide sequence of the YPL062w gene is shown in SEQ ID NO.38, and the nucleotide sequence of the PptHMGR gene is shown in SEQ ID NO.8.

[0006] According to an embodiment of this application, the PptHMGR gene is inserted into the genome of Saccharomyces cerevisiae via a PptHMGR gene expression cassette, wherein the PptHMGR gene expression cassette includes a promoter PGK1, the PptHMGR gene, and a terminator CPS1.

[0007] According to the embodiments of this application, the Saccharomyces cerevisiae is the CEN.PK2-1C Saccharomyces cerevisiae strain.

[0008] According to an embodiment of this application, the recombinant strain further knocks out the DPP1 gene in its genome and integrates the ERG10 gene, ERG13 gene and tHMG1 gene into the genome, wherein the nucleotide sequence of the DPP1 gene is shown in SEQ ID NO. 39, the nucleotide sequence of the ERG10 gene is shown in SEQ ID NO. 9, the nucleotide sequence of the ERG13 gene is shown in SEQ ID NO. 10, and the nucleotide sequence of the tHMG1 gene is shown in SEQ ID NO. 11.

[0009] According to embodiments of this application, the ERG10 gene, ERG13 gene, and tHMG1 gene are inserted into the genome of the recombinant strain via the ERG10 gene expression cassette, the ERG13 gene expression cassette, and the tHMG1 gene expression cassette, respectively. The ERG10 gene expression cassette includes the promoter TDH3, the ERG10 gene, and the terminator PDC1. The ERG13 gene expression cassette includes the promoter FBA1, the ERG13 gene, and the terminator ADH1. The tHMG1 gene expression cassette includes the promoter TEF1, the tHMG1 gene, and the terminator ENO2.

[0010] According to an embodiment of this application, the recombinant strain further knocks out the LPP1 gene in its genome and integrates the ERG12, ERG8, ERG19 and IDI1 genes into the genome. The nucleotide sequence of the LPP1 gene is shown in SEQ ID NO. 40, the nucleotide sequence of the ERG12 gene is shown in SEQ ID NO. 12, the nucleotide sequence of the ERG8 gene is shown in SEQ ID NO. 13, the nucleotide sequence of the ERG19 gene is shown in SEQ ID NO. 14, and the nucleotide sequence of the IDI1 gene is shown in SEQ ID NO. 15.

[0011] According to embodiments of this application, the ERG12 gene, ERG8 gene, ERG19 gene, and IDI1 gene are inserted into the genome of the recombinant strain via the ERG12 gene expression cassette, ERG8 gene expression cassette, ERG19 gene expression cassette, and IDI1 gene expression cassette, respectively. The ERG12 gene expression cassette includes the promoter ENO2, the ERG12 gene, and the terminator THD2. The ERG8 gene expression cassette includes the promoter PDC1, the ERG8 gene, and the terminator PGK1. The ERG19 gene expression cassette includes the promoter TDH3, the ERG19 gene, and the terminator CYC1. The IDI1 gene expression cassette includes the promoter TPI1, the IDI1 gene, and the terminator ADH1.

[0012] According to an embodiment of this application, the recombinant strain further knocks out the ROX1 gene in its genome and integrates the ERG20 gene, ERG9 gene and ERG1 gene into the genome, wherein the nucleotide sequence of the ROX1 gene is shown in SEQ ID NO. 41, the nucleotide sequence of the ERG20 gene is shown in SEQ ID NO. 16, the nucleotide sequence of the ERG9 gene is shown in SEQ ID NO. 17, and the nucleotide sequence of the ERG1 gene is shown in SEQ ID NO. 18.

[0013] According to embodiments of this application, the ERG20 gene, ERG9 gene, and ERG1 gene are inserted into the genome of the recombinant strain via the ERG20 gene expression cassette, ERG9 gene expression cassette, and ERG1 gene expression cassette, respectively. The ERG20 gene expression cassette includes the promoter PGK1, the ERG20 gene, and the terminator TDH2. The ERG9 gene expression cassette includes the promoter TEF1, the ERG9 gene, and the terminator PGK1. The ERG1 gene expression cassette includes the promoter TDH3, the ERG1 gene, and the terminator ADH1.

[0014] According to an embodiment of this application, the recombinant strain further knocks out the ARO10 gene in its genome and integrates the ERG11, ERG2, and ERG3 genes into the genome. The nucleotide sequence of the ARO10 gene is shown in SEQ ID NO. 42, the nucleotide sequence of the ERG11 gene is shown in SEQ ID NO. 19, the nucleotide sequence of the ERG2 gene is shown in SEQ ID NO. 20, and the nucleotide sequence of the ERG3 gene is shown in SEQ ID NO. 21.

[0015] According to embodiments of this application, the ERG11 gene, ERG2 gene, and ERG3 gene are inserted into the genome of the recombinant strain via the ERG11 gene expression cassette, ERG2 gene expression cassette, and ERG3 gene expression cassette, respectively. The ERG11 gene expression cassette includes the promoter PYK1, the ERG11 gene, and the terminator FBA1. The ERG2 gene expression cassette includes the promoter TPI1, the ERG2 gene, and the terminator PDC1. The ERG3 gene expression cassette includes the promoter FBA1, the ERG3 gene, and the terminator CYC1.

[0016] According to an embodiment of this application, the recombinant strain further integrates the ERG1 gene, DrDHCR7 gene, and GgDHCR24 gene at the δDNA site, wherein the nucleotide sequence of the δDNA site is shown in SEQ ID NO.45, the nucleotide sequence of the ERG1 gene is shown in SEQ ID NO.18, the nucleotide sequence of the DrDHCR7 gene is shown in SEQ ID NO.1, and the nucleotide sequence of the GgDHCR24 gene is shown in SEQ ID NO.2.

[0017] According to embodiments of this application, the ERG1 gene, DrDHCR7 gene, and GgDHCR24 gene are inserted into the genome of the recombinant strain via the ERG1 gene expression cassette, DrDHCR7 gene expression cassette, and GgDHCR24 gene expression cassette, respectively. The ERG1 gene expression cassette includes the promoter FBA1, the ERG1 gene, and the terminator CPS1. The DrDHCR7 gene expression cassette includes the promoter TEF1, the DrDHCR7 gene, and the terminator PDC1. The GgDHCR24 gene expression cassette includes the promoter TDH3, the GgDHCR24 gene, and the terminator ENO2.

[0018] According to an embodiment of this application, the recombinant strain further knocks out the GAL80 gene in its genome and integrates the VcCPR gene into its genome, wherein the nucleotide sequence of the GAL80 gene is shown in SEQ ID NO.43 and the nucleotide sequence of the VcCPR gene is shown in SEQ ID NO.3.

[0019] According to embodiments of this application, the VcCPR gene is inserted into the genome of the recombinant strain via a VcCPR gene expression cassette. The VcCPR gene expression cassette includes the promoter TEF1, the VcCPR gene, and the terminator CPS1.

[0020] According to embodiments of this application, the genome of the recombinant strain is further modified in any of the following ways: (1) The ATF2 gene in its genome was knocked out while the VcCYP90B27 gene was expressed in its genome to obtain the recombinant strain CEN-V1; (2) While knocking out the ATF2 gene in its genome, the VcCYP90B27 gene and the VcCYP94N1 gene were expressed in its genome to obtain the recombinant strain CEN-V2; (3) While knocking out the ATF2 gene in its genome, the VcCYP90B27 gene, VcCYP94N1 gene and VcGABAT gene were expressed in its genome to obtain the recombinant strain CEN-V3. (4) While knocking out the ATF2 gene in its genome, the VcCYP90B27 gene, VcCYP94N1 gene, VcGABAT gene and VcCYP90G1 gene were expressed in its genome to obtain the recombinant strain CEN-Vera. The nucleotide sequences of the ATF2 gene, VcCYP90B27, VcCYP94N1, VcGABAT, and VcCYP90G1 genes are shown in SEQ ID NO.44, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, and SEQ ID NO.7, respectively.

[0021] According to embodiments of this application, the VcCYP90B27 gene, VcCYP94N1 gene, VcGABAT gene, and VcCYP90G1 gene are inserted into the genome of the recombinant strain CEN-CPR via the VcCYP90B27 gene expression cassette, VcCYP94N1 gene expression cassette, VcGABAT gene expression cassette, and VcCYP90G1 gene expression cassette, respectively. The VcCYP90B27 gene expression cassette includes the promoter TEF1, the VcCYP90B27 gene, and the terminator ADH1. The VcCYP94N1 gene expression cassette includes the promoter FBA1, the VcCYP94N1 gene, and the terminator TDH2; The VcGABAT gene expression cassette includes the promoter TDH3, the VcGABAT gene, and the terminator FBA1. The VcCYP90G1 gene expression cassette includes the promoter PGK1, the VcCYP90G1 gene, and the terminator CYC1.

[0022] A second aspect of the embodiments of this application provides the application of a recombinant strain in the production of veratrazine and veratrazine steroid precursors, or in increasing the yield of veratrazine and veratrazine steroid precursors.

[0023] According to embodiments of this application, veratrazine steroid precursors include squalene, ergosterol, lanosterol, 22R-hydroxycholesterol, 22R,26-dihydroxycholesterol, and 22-hydroxy-26-amino-cholesterol.

[0024] Compared with the prior art, the present invention has the following advantages and beneficial effects: Experiments of this invention demonstrate that, based on *Saccharomyces cerevisiae*, a corresponding recombinant strain was constructed, and recombinant strains that achieved high production of squalene, ergosterol, lanosterol, 22R-hydroxycholesterol, 22R,26-dihydroxycholesterol, and 22-hydroxy-26-amino-cholesterol were obtained. Furthermore, a recombinant strain for synthesizing veratrazine was constructed based on this strain, achieving heterologous and efficient veratrazine synthesis, as detailed below: 1) Squalene synthesis: The accumulation of squalene in recombinant strains CEN-1, CEN-2, CEN-3 and CEN-OS gradually increased, with the squalene content of recombinant strain CEN-OS reaching 1.24 g / L. 2) Synthesis of ergosterol: Recombinant strains CEN-1, CEN-2, CEN-3 and CEN-OS can all accumulate ergosterol, with a content between 50 and 85 mg / L. 3) Synthesis of lanosterol: The lanosterol content in recombinant strains CEN-1, CEN-2, CEN-3, CEN-OS and CEN-4 also gradually increased. Among them, the lanosterol content of recombinant strain CEN-OS reached 172 mg / L, which was about 170 times higher than that of the original strain. The lanosterol content of recombinant strain CEN-4 reached 175.80 mg / L, which was about 174 times higher than that of the original strain. 4) Cholesterol synthesis: The cholesterol production in recombinant strains CEN-Chol and CEN-CPR was 79.92 mg / L and 115.37 mg / L, respectively; 5) Synthesis of 22R-hydroxycholesterol: 22R-hydroxycholesterol was detected in the products of recombinant strains CEN-V1, V2, V3 and Vera. Among them, the yield of 22R-hydroxycholesterol in recombinant strain CEN-V1 was 3482.83 μg / L. 6) Synthesis of 22R,26-dihydroxycholesterol: 22R,26-dihydroxycholesterol was detected in the products of recombinant strains CEN-V2, V3 and Vera. Among them, recombinant strain CEN-V2 had the highest yield, reaching 1003.05 μg / L. 7) Synthesis of 22-hydroxy-26-amino-cholesterol: 22-hydroxy-26-amino-cholesterol was detected in the products of recombinant strains V3 and Vera, with yields of 662.98 μg / L and 124.56 μg / L, respectively; 8) Synthesis of veratrazine: Veratrazine was detected in the product of strain CEN-Vera, with a yield of 265.38 μg / L. Attached Figure Description

[0025] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0026] Figure 1 This is a partial schematic diagram of an expression element carrier constructed according to an embodiment of this application using eight pairs of constitutive promoters and terminators; Figure 2 The images are of plasmids pTEF1-Cas9-CYC1t and pRS426-SRN52 according to embodiments of this application, wherein... Figure 2 Image (a) shows the spectrum of plasmid pTEF1-Cas9-CYC1t. Figure 2 (b) in the image is the spectrum of plasmid pRS426-SRN52; Figure 3 This is a schematic diagram illustrating the integration and construction of the target gene of strain CEN-1 according to an embodiment of this application; Figure 4 This is an electrophoresis diagram of the expression product of strain CEN-1 according to an embodiment of this application, wherein, Figure 4 Image (a) shows the electrophoresis diagram of the expression product of this strain after the YPL062w gene was knocked out. Figure 4(b) is an electrophoresis diagram of the expression product of the strain expressing the PptHMGR gene; Figure 5 Here is an electrophoresis diagram of the expression product of strain CEN-Chol according to an embodiment of this application, wherein, Figure 5 Image (a) is an electrophoresis diagram of the expression product of the strain expressing the ERG1 gene. Figure 5 Image (b) is an electrophoresis diagram of the expression product of the DrDHCR7 gene in this strain. Figure 5 (c) is an electrophoresis diagram of the expression product of the strain expressing the GgDHCR24 gene; Figure 6 The GS-MS chromatograms and concentration quantification results of sterol compounds in strains CEN-1, CEN-2, CEN-3, and CEN-OS according to embodiments of this application are shown below. Figure 6 (a) shows the chromatograms of sterol compounds in strains CEN-1, CEN-2, CEN-3, and CEN-OS. Figure 6 (b) shows the squalene titer in strains CEN-1, CEN-2, CEN-3, and CEN-OS. Figure 6 (c) shows the ergosterol titer in strains CEN-1, CEN-2, CEN-3, and CEN-OS. Figure 6 (d) in the figure is the titer of lanosterol in strains CEN-1, CEN-2, CEN-3 and CEN-OS; Figure 7 Chromatograms of cholesterol detection by GC-MS in strains CEN-OS, CEN-4, CEN-Chol and CEN-CPR according to embodiments of this application; Figure 8 The image shows the MS / MS mass spectra of the products of strain CEN-Chol according to embodiments of this application, wherein... Figure 8 (a) shows the MS / MS mass spectra of compound 1. Figure 8 (b) in the image shows the MS / MS mass spectra of compound 2. Figure 8 (c) in the image shows the MS / MS mass spectra of compound 3. Figure 8 (d) in the image shows the MS / MS mass spectra of compound 4. Figure 8 (e) in the figure is the MS / MS mass spectrometry result of compound 5; Figure 9 A chromatogram of lanosterol and cholesterol titers in strains CEN-OS, CEN-4, CEN-Chol and CEN-CPR according to embodiments of this application; Figure 10The chromatograms, MS mass spectrometry results, and titer chromatograms of 22R-hydroxycholesterol in strains CEN-CPR, CEN-V1, CEN-V2, CEN-V3, and CEN-Vera according to embodiments of this application are shown below. Figure 10 (a) is a chromatogram of 22R-hydroxycholesterol detected by GC-MS in strains CEN-CPR, CEN-V1, CEN-V2, CEN-V3, and CEN-Vera. Figure 10 Image (b) shows the MS mass spectrometry results of 22R-hydroxycholesterol. Figure 10 (c) in the figure represents the titer of 22R-hydroxycholesterol; Figure 11 The chromatograms, MS mass spectrometry results, and titer chromatograms of 22R,26-dihydroxycholesterol in strains CEN-CPR, CEN-V1, CEN-V2, CEN-V3, and CEN-Vera according to embodiments of this application are shown below. Figure 11 (a) is a chromatogram of 22R,26-dihydroxycholesterol detected by GC-MS in strains CEN-CPR, CEN-V1, CEN-V2, CEN-V3, and CEN-Vera. Figure 11 Image (b) shows the MS mass spectrometry results of 22R,26-dihydroxycholesterol. Figure 11 (c) in the figure represents the titer of 22R,26-dihydroxycholesterol; Figure 12 The LC-MS chromatograms, MS mass spectrometry results, and titer chromatograms of 22-hydroxy-26-amino-cholesterol in strains CEN-CPR, CEN-V1, CEN-V2, CEN-V3, and CEN-Vera according to embodiments of this application are shown below. Figure 12 (a) is the LC-MS chromatogram of 22-hydroxy-26-amino-cholesterol in strains CEN-CPR, V1, V2, V3 and Vera. Figure 12 Image (b) shows the MS mass spectrometry results of 22-hydroxy-26-amino-cholesterol. Figure 12 (c) in the figure is the titer diagram of 22-hydroxy-26-amino-cholesterol; Figure 13 The LC-MS chromatograms, MS mass spectrometry results, and titer chromatograms of veratrazine in strains CEN-CPR, CEN-V1, CEN-V2, CEN-V3, and CEN-Vera according to embodiments of this application are shown below. Figure 13 (a) shows the LC-MS chromatograms of veratrazine in strains CEN-CPR, V1, V2, V3, and Vera. Figure 13 (b) in the image shows the MS mass spectrometry results of veratrazine. Figure 13 (c) in the figure is the titer of veratrazine. Detailed Implementation

[0027] To make the technical problems, solutions, and beneficial effects of this invention clearer, the invention will be further described in detail below with reference to embodiments and accompanying drawings. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without inventive effort are within the scope of protection of this invention.

[0028] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0029] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0030] The *Saccharomyces cerevisiae* strain CEN.PK2-1C, *Escherichia coli* DH5α, and pEASY®-Blunt Simple Cloning Kit used in the following examples were purchased from Shanghai Weidi Biotechnology Co., Ltd., Shanghai Weidi Biotechnology Co., Ltd., and Beijing Quanshijin Biotechnology Co., Ltd., respectively.

[0031] Example 1: Obtaining the target gene fragment, promoter, and terminator The target gene fragments include exogenous gene fragments and DNA fragments from the Saccharomyces cerevisiae genome other than promoters and terminators.

[0032] 1. Obtaining exogenous gene fragments The nucleotide sequences of the exogenous cholesterol C7 reductase DrDHCR7 gene are shown in SEQ ID NO.1; the nucleotide sequences of the cholesterol C24 reductase GgDHCR24 gene are shown in SEQ ID NO.2; the nucleotide sequences of the cytochrome P450 reductase VcCPR gene are shown in SEQ ID NO.3; the nucleotide sequences of the sterol C-22 hydroxylase VcCYP90B27 gene are shown in SEQ ID NO.4; the nucleotide sequences of the sterol C-26 hydroxylase VcCYP94N1 gene are shown in SEQ ID NO.5; the nucleotide sequences of the γ-aminobutyrate transferase VcGABAT gene are shown in SEQ ID NO.6; and the nucleotide sequences of the sterol C-22 ketoyltransferase VcCYP90G1 gene are shown in SEQ ID NO.7. These genes were synthesized by Genewiz after yeast codon optimization.

[0033] Paris polyphylla plants preserved in the laboratory (sampling location: Dali, Yunnan) Paris polyphylla SMITHvar. yunnanensis The 3-hydroxy-3-methylglutaryl-CoA reductase PptHMGR gene fragment was amplified using plasmid pEAQ-PptHMGR (FRANCH.) HARA as a template. The nucleotide sequence is shown in SEQ ID NO.8. This sequence was amplified by PCR according to the corresponding primers, reaction system and reaction procedure in Example 2.

[0034] 2. Obtaining the genomic DNA fragment of Saccharomyces cerevisiae Table 1: Genomic DNA fragments of Saccharomyces cerevisiae

[0035] The above-mentioned genes were amplified by PCR using the Saccharomyces cerevisiae genome as a template and cloning primers, following the corresponding primers, reaction system and reaction procedure in Example 2 below.

[0036] Example 2: Cloning of the target gene, promoter, and terminator fragments Using the promoter, terminator, and target gene fragment from Example 1 as templates, PCR amplification of the above promoter, terminator, and target gene fragment was performed using the corresponding primers shown in Tables 2 and 3 and 2×Phanta Max high-fidelity DNA polymerase (Phanta Max Master Mix high-fidelity enzyme, vazyme, catalog number: P515-02).

[0037] Table 2: Primers for Target Gene Cloning

[0038]

[0039]

[0040] Table 3: Primers for promoter and terminator cloning

[0041]

[0042] Table 4: PCR reaction system

[0043] PCR reaction conditions: 95°C pre-denaturation for 3 min; 95°C denaturation for 30 sec, 60°C annealing for 30 sec, 72°C extension for 1 min, for a total of 33 cycles; 72°C complete extension for 7 min.

[0044] After the reaction was completed, the PCR products were detected by 1% agarose gel electrophoresis.

[0045] Example 3: DNA Gel Recovery The target gene fragment was recovered using a DNA gel extraction kit (Omega, catalog number: D2500-02). The procedure was as follows: (1) Cut the agarose gel containing the target band in a UV gel cutter, take an equal volume of binding buffer, and incubate the mixture at 55°C for 7 min until the gel is completely melted; (2) Take 700 μL of the mixture and transfer it to the DNA adsorption column fitted with a 2 mL collection tube. Let it stand for 1 min, centrifuge at 10000g for 1 min, and discard the filtrate. (3) Place the adsorption column back into the collection tube, add 700 μL of SPW Wash Buffer diluted with anhydrous ethanol, centrifuge at 10000 g for 1 min, discard the filtrate, and repeat once; (4) Discard the filtrate, put the empty adsorption column back into the centrifuge tube, and centrifuge at 12000 g for 2 min; (5) Place the empty adsorption column in a sterile 1.5 mL centrifuge tube, open the tube cap and let it stand for 1 min. Add 30 μL of sterile water (preheated to 60°C) to the center of the adsorption membrane and let it stand at room temperature for 1 min. Centrifuge at 12000 g for 1 min to elute the DNA and obtain the promoter, terminator and target gene fragment.

[0046] Example 4: Construction of Expression Element Carrier Using the promoter and terminator fragments obtained from the above gel recovery as templates, and primers with overlapping PCR homologous arms (see Table 3), PCR was performed according to the reaction system and procedure of Example 2 to amplify gene fragments with various promoter and terminator combinations.

[0047] The system contains eight promoter and eight terminator templates, which can combine to amplify gene fragments with different promoter and terminator combinations. For example... Figure 1 As shown, Figure 1 Only a portion of the gene fragments amplifying various combinations of promoters and terminators are shown.

[0048] Subsequently, gene fragments amplified with various promoter and terminator combinations were ligated into the pEASY®-Blunt Simple vector, and the reaction system is as follows: Table 5: Reaction systems linked to pEASY®-Blunt Simple support

[0049] React at 37℃ for 30 minutes.

[0050] Example 5: Escherichia coli transformation (1) Take 100 μL of competent cells DH5α that have been thawed in an ice bath, add the gene fragment of the promoter and terminator combination amplified in Example 4, mix gently and place in an ice bath for 30 min; (2) Heat shock in a 42°C water bath for 60 seconds, then quickly transfer the centrifuge tubes to an ice bath for 2 minutes; (3) Add 200 μL of antibiotic-free LB culture medium to the centrifuge tube, mix well, and incubate at 37°C and 180 rpm for 1 h to allow the bacteria to recover. (4) Take the competent cells transformed in the previous step and add them to LB agar medium containing ampicillin (Amp, screening concentration 100 mg / L) resistance. Spread the cells evenly, blow off the liquid on the surface of the medium, and invert the plate to culture overnight at 37°C. (5) Pick a few single colonies and add them to 500 μL of LB liquid medium containing Amp resistance. Incubate at 37°C and 180 rpm for 4 h. Perform bacterial PCR identification. The identification primers are M13-F / R (M13-F: AGGGTTTTCCCAGTCACGAC, M13-R: CGGATAACAATTTCACACAGG). Send positive results to Ruiboxing Biotechnology Co., Ltd. for sequencing.

[0051] The sequencing results showed that the nucleotide sequence of the gene fragment containing the promoter and terminator combination inserted into the pEASY®-Blunt-Simple vector in the recombinant E. coli DH5α corresponding to the screened positive colonies was completely consistent with the pre-set target sequence, and no mutations such as base mismatches, deletions, or insertions were detected. This result confirms that the gene fragment containing the promoter and terminator combination has been successfully and accurately cloned into the vector, and that the recombinant vector can be stably carried and preserved in E. coli.

[0052] Example 6: Construction of gene expression vector The purpose of constructing this gene expression vector is to insert the target gene fragment amplified in Example 2 between the promoter and terminator carried in the expression element vector constructed in Example 4, thereby constructing different gene expression cassettes.

[0053] First, the expression element vector was rapidly linearized using the restriction endonuclease Xho I, as shown in the following system: Table 6: Enzyme digestion reaction system

[0054] The reaction was terminated after 1 hour at 37°C.

[0055] The linearized expression element vector was recovered after detection by agarose gel electrophoresis and recombined with the PCR amplification product of the target gene using a non-ligase-dependent single-fragment rapid cloning kit (ClonExpress II One Step Cloning Kit, vazyme, catalog number: C112-02). The reaction system is as follows: Table 7: Recombination Reaction System

[0056] The reaction was carried out at 37°C for 30 min, then cooled to 4°C or placed on ice, and sequenced after transformation of E. coli. The transformation procedure for E. coli was the same as that in Example 5.

[0057] Sequencing results showed that the recombinant product sequence of the expression element vector and the target gene was completely consistent with the pre-defined gene expression cassette sequence, and no base mismatches, deletions, insertions, or frameshift mutations were detected. This result confirms that the expression element vector and the target gene have successfully undergone gene recombination using the ClonExpress II One Step Cloning Kit, and the sequence correctness and structural integrity of the resulting gene expression vector meet experimental expectations.

[0058] Different gene expression vectors were obtained through the above steps, as shown in Table 8: Table 8: Constructed plasmids

[0059] Example 7: Construction of gRNA vector gRNA primers were designed using the CRISPRdirect website (https: / / crispr.dbcls.jp / ). Using the pRS426-SRN52 plasmid as a template, PCR amplification was performed using the gRNA primers (as shown in Table 9) (following the reaction system and conditions of Example 2) to obtain plasmids containing the corresponding knockout sites. The gRNA plasmids are shown in Table 10.

[0060] Table 9: Primers for gRNA plasmid construction

[0061] Table 10: gRNA plasmids

[0062] The plasmid obtained above was digested with DpnI to remove the template DNA. The reaction system is as follows: Table 11: Reaction system for gRNA vector construction

[0063] The enzyme-digested fragments were transformed into Escherichia coli DH5α (see Escherichia coli transformation in Example 5), and the bacteria were picked and sequenced.

[0064] Sequencing results showed that the gRNA vector was completely identical to the pre-defined sgRNA sequence, with no base mismatches, deletions, insertions, or frameshift mutations detected. These results confirm that the gRNA plasmid obtained by transformation with *E. coli* DH5α after effective removal of template DNA via Dpn I enzyme digestion was successfully constructed, possessing the correct nucleotide sequence and structural integrity, and can be used for subsequent gene editing experiments.

[0065] Example 8: Plasmid Extraction After the correctly sequenced strains in Examples 5-7 were preserved, plasmids were extracted using the EZNA Plasmid Mini Kit I (omega, catalog number: D6942-02). The procedure is as follows: (1) Take 5 mL of bacterial culture that has been cultured overnight at 37°C (12-16 h), centrifuge at 10000g for 1 min, and discard the supernatant; (2) Add 250 μL of Solution I (with added ribonuclease A) to the centrifuge tube and mix by pipetting; (3) Add 250 μL of Solution II, invert 4-6 times to mix, and let stand for 2 min to allow the cells to fully lyse (total time less than 5 min). (4) Add 350 μL of Solution III, and immediately invert the container 6-8 times to thoroughly mix the solution. At this point, a large amount of white flocculent precipitate will appear. Centrifuge at 13000g for 10 min; (5) Place the adsorption column in the collection tube, take the supernatant after centrifugation and add it to the adsorption column, centrifuge at 10000 g for 1 min, and discard the filtrate; (6) Add 700 μL of DNA Wash Buffer to the adsorption column, centrifuge at 10000 g for 1 min, and discard the filtrate. Repeat once; (7) Place the empty adsorption column back into the collection tube, centrifuge at 13000 g for 2 min, transfer the adsorption column to a new 1.5 mL centrifuge tube, open the tube cap and dry the adsorption column for 1 min to evaporate the residual washing liquid in the adsorption column. (8) Add 50 μL of sterile water preheated to 55°C to the center of the membrane of the adsorption column, let stand for 2 min, and centrifuge at 13000 g for 1 min. Discard the adsorption column and collect the liquid in the centrifuge tube, which is the purified plasmid DNA solution. Store the plasmid DNA solution at -20°C.

[0066] Example 9: Preparation of competent yeast cells and yeast transformation Yeast competent cells and yeast transformation were performed using the TaKaRa yeast transformation kit. Solution preparation: 1.1×TE / LiAc: 1.5 mL: 165 μL each of 10×TE and 10×LiAc, topped with sterile water to 1.5 mL; 600 μL: 66 μL each of 10×TE and 10×LiAc, topped with sterile water to 600 μL. 1 mL PEG / LiAc: 800 μL PEG (3350), 100 μL 10×TE, 100 μL 10×LiAc.

[0067] (1) Pick a single yeast colony and place it in 1 mL of YPD medium. Shake at 28°C for 8-12 h. Transfer 50 μL to 50 mL of YPD liquid medium and incubate overnight at 200 rpm. (2) Transfer the yeast in the shake flask to a 50 mL centrifuge tube, centrifuge at 3000 rpm for 6 min, discard the supernatant, resuspend and wash with 30 mL of sterile water, centrifuge at 3000 rpm for 6 min, and discard the supernatant. (3) Resuspend the yeast cells in 1.5 mL of 1.1×TE / LiAc, centrifuge at 10,000 rpm for 15 s, and discard the supernatant. Add 600 μL of 1.1×TE / LiAc and resuspend the yeast cells. (4) Take 20 μL of the above gene expression vector, 10 μL of gRNA plasmid and pTEF1-Cas9-CYC1t plasmid and add them to a rotary evaporator to evaporate to dryness, add 10 μL of sterile water to reconstitute, add 5 μL of salmon sperm DNA (pre-denatured at 100°C for 7 min), 50 μL of the above-prepared yeast competent cells, and 500 μL of PEG / LiAc; (5) Incubate at 30°C for 30 min, shaking once every 10 min. Add 20 μL DMSO; (6) Heat shock at 42°C for 15 minutes, shaking once every 5 minutes during the process; (7) Centrifuge at 10,000 rpm for 15 seconds, discard the supernatant, add 500 μL of YPDA plus liquid culture medium, and activate at 28°C and 200 rpm for 1 h; (8) Centrifuge at 10,000 rpm for 15 seconds, discard the supernatant, add 500 μL of sterile water to resuspend, spread on the corresponding SD defect type solid plate, and incubate at 28°C for about 48 h.

[0068] In this process, the aforementioned gene expression vectors are tandemly expressed in yeast cells using homologous sequences on corresponding primers, and then inserted as the inserted gene at the corresponding site.

[0069] Example 10: Yeast Genome Extraction Single yeast colonies were picked and cultured in 400 μL of SD liquid medium corresponding to the deficient type at 28°C and 200 rpm for 24 h. 10 μL of the culture was then transferred to 1 mL of YPD liquid medium and cultured at 28°C and 200 rpm for 48 h. The genome was then extracted for PCR identification (the reaction system and procedure of Example 2 were followed, and the primers for amplifying the genome are shown in Table 12, and the identification was performed using agarose gel electrophoresis as described in Example 2).

[0070] Table 12: Primers for recombinant yeast DNA gene expression vectors

[0071]

[0072]

[0073]

[0074]

[0075] Yeast genome extraction was performed using the Tiangen Yeast Genome Extraction Kit, and the steps are as follows: (1) Centrifuge yeast cells at 12000 rpm for 1 min and discard the supernatant; (2) Add 600 μL of sorbitol buffer, add 1 μL of lysozyme, mix thoroughly, and treat at 30°C for 1 h, inverting and mixing once every 10 min during the treatment. Centrifuge at 4000 rpm for 10 min and discard the supernatant; (3) Add 200 μL of GA buffer and mix thoroughly; (4) Add 20 μL of proteinase K solution and mix well; (5) Add 220 μL of GB buffer, mix thoroughly by inverting, and incubate at 70°C for 10 min; (6) Add 220 μL of anhydrous ethanol, mix thoroughly by inverting, then transfer all the solutions to the adsorption column CB3, centrifuge at 12000 rpm for 30 sec, and discard the waste liquid; (7) Add 500 μL of GD buffer, centrifuge at 12000 rpm for 30 sec, and discard the waste liquid; (8) Add 600 μL of PW rinsing solution, centrifuge at 12000 rpm for 30 sec, discard the waste liquid, and repeat once; (9) Centrifuge at 12000 rpm for 2 min, discard the waste liquid, and place the adsorption column CB3 at room temperature for several minutes; (10) Transfer the adsorption column CB3 to a sterile 1.5 mL centrifuge tube, add 50 μL of sterile water to the center of the adsorption membrane, place at room temperature for 2-5 min, and centrifuge at 12000 rpm for 2 min.

[0076] After PCR identification, 11 strains were obtained, which either knocked out specific gene fragments (as shown in Table 13) or used δDNA sites (nucleotide sequences as shown in SEQ ID NO.45) as insertion sites and expressed specific target genes, as shown in Table 14.

[0077] Table 13: Knockout Genes

[0078] Table 14: Constructed strains

[0079] As shown in Table 13, strain CEN-1 is based on strain CEN.PK2-1C as the chassis bacteria, with the YPL062w gene knocked out and the PptHMGR gene expressed simultaneously. Strain CEN-2 is based on strain CEN-1, with the DPP1 gene sequence knocked out while expressing the ERG10, ERG13 and tHMG1 genes. Strain CEN-3 is based on strain CEN-2, with the LPP1 gene knocked out while expressing the ERG12, ERG8, ERG19 and IDI1 genes; The strain CEN-OS is based on strain CEN-3, with the ROX1 gene knocked out while expressing the ERG20, ERG9 and ERG1 genes. Strain CEN-4 is based on strain CEN-OS, with the ARO10 gene knocked out while expressing the ERG11, ERG2 and ERG3 genes. The CEN-Chol strain is based on the CEN-4 strain, with the ERG1 gene, DrDHCR7 gene, GgDHCR24 gene, and selection gene LUE2 (nucleotide sequence shown in SEQ ID NO.46) inserted into the δDNA site. The δDNA site is a region rich in repetitive sequences and is usually used as an integration site for efficient expression of exogenous genes. It is integrated through homologous recombination and screened through SD-Trp-Leu defective culture. The strain CEN-CPR is based on the strain CEN-Chol, with the GAL80 gene knocked out and the VcCPR gene expressed simultaneously. Strain CEN-V1 is based on strain CEN-CPR, with the ATF2 gene knocked out and the VcCYP90B27 gene expressed simultaneously. Strain CEN-V2 is based on strain CEN-CPR, with the ATF2 gene knocked out while expressing the VcCYP90B27 and VcCYP94N1 genes. Strain CEN-V3 is based on strain CEN-CPR, with the ATF2 gene knocked out while expressing the VcCYP90B27 gene, VcCYP94N1 gene and VcGABAT gene. The strain CEN-Vera is based on the strain CEN-CPR, but with the ATF2 gene knocked out while expressing the VcCYP90B27, VcCYP94N1, VcGABAT, and VcCYP90G1 genes.

[0080] For example, strain CEN-1, such as Figures 2 to 4 As shown, Figure 2 The spectra of plasmid pTEF1-Cas9-CYC1t and plasmid pRS426-SRN52 are shown respectively. Figure 2 Image (a) shows the spectrum of plasmid pTEF1-Cas9-CYC1t. Figure 2 (b) in the image is the spectrum of plasmid pRS426-SRN52. Figure 3 This is a schematic diagram illustrating the integration of the target gene into strain CEN-1. Figure 3 It can be seen that by adding homologous arm sequences near the insertion site to both ends of the target gene, homologous recombination can be achieved with the corresponding sites on the chromosome after transformation of yeast. Figure 4 This is an electrophoresis image of the expression products of strain CEN-1. Figure 4 (a) and Figure 4 The PCR amplification results in (b) together validated the gene editing effect of strain CEN-1: Figure 4In (a), using YPL062-up / down as primers, the presence of the YPL062w gene was detected: a specific band corresponding to the YPL062w gene appeared in the amplification product of the CEN.PK2-1C chassis strain, indicating that its genome carries this endogenous gene; while the amplification product of strain CEN-1 did not show this band, suggesting that the YPL062w gene has been successfully knocked out; Figure 4 (b) Using PptHMGR-F / R as primers, the integration of the PptHMGR gene was detected (PC was the target fragment amplified from the PptHMGR plasmid as a positive control): the amplification product of the CEN.PK2-1C chassis strain did not show a band corresponding to the PptHMGR gene, indicating that it does not carry this exogenous gene; while the amplification product of strain CEN-1 showed a clear and specific band of the same size as the PC band, indicating that the PptHMGR gene had been successfully integrated into the CEN-1 genome. Therefore, the above electrophoresis results confirm that strain CEN-1 has achieved the knockout of the YPL062w gene and simultaneously achieved stable integration of the PptHMGR gene.

[0081] Taking strain CEN-Chol as an example, such as Figure 5 As shown, the electrophoresis diagrams of the expression products of strain CEN-Chol collectively verify the gene editing effect of strain CEN-Chol: Figure 5 In (a), the presence of the ERG1 gene was detected using pFBA1 / CPS1t as primers (where PC was the target fragment amplified from the ERG1 plasmid as a positive control): a clear and specific band of the same size as the PC band appeared in the amplification product of strain CEN-Chol, indicating that the ERG1 gene had been successfully integrated into the CEN-Chol genome. Figure 5 (b) Using DrDHCR7-F / R as primers, the presence of the DrDHCR7 gene was detected (where PC was the target fragment amplified from the DrDHCR7 plasmid as a positive control): a clear and specific band of the same size as the PC band appeared in the amplification product of strain CEN-Chol, indicating that the DrDHCR7 gene has been successfully integrated into the CEN-Chol genome. Figure 5 In (c), using GgDHCR24-F / R as primers, the presence of the GgDHCR24 gene was detected (where PC was the target fragment amplified from the GgDHCR24 plasmid as a positive control): a clear and specific band of the same size as the PC band appeared in the amplification product of strain CEN-Chol, indicating that the GgDHCR24 gene had been successfully integrated into the CEN-Chol genome. Therefore, the above electrophoresis results confirm that strain CEN-Chol has achieved stable integration of the ERG1 gene, DrDHCR7 gene, and GgDHCR24 gene.

[0082] Example 11: Yeast Product Extraction (1) The above strain was cultured in 20 mL of YPD liquid medium at 28°C and 200 rpm for 4-5 days. 2 mL of the bacterial culture was transferred to a 2 mL conical centrifuge tube and centrifuged at 10,000 rpm for 1 min. Then, it was resuspended and washed with 1 mL of ultrapure water and centrifuged at 10,000 rpm for 1 min. (2) Add 1 mL of saponification solution containing 10 μg / mL 5α-cholestane (10% KOH dissolved in 80% anhydrous ethanol), place at 70°C for 2-4 h, then open the lid and dry overnight; (3) Add 500 μL of chromatographic grade ethyl acetate, sonicate to suspend, and then add 500 μL of ultrapure water for extraction; (4) Centrifuge at 12000 rpm for 5 min, and try to transfer the ethyl acetate layer to a new centrifuge tube.

[0083] Example 12: GC-MS and LC-MS detection of yeast products 1) Detection of compounds other than 22-hydroxy-26-amino-cholesterol and veratrazine. Except for 22-hydroxy-26-amino-cholesterol and veratrine, all other compounds were detected by GC-MS. 50 μL of the ethyl acetate extract was pipetted into a sample vial and evaporated to dryness. 30 μL of TMS derivatization reagent was added, and derivatization was performed at 70°C for 1 h. The extract was then diluted with 70 μL of chromatographic-grade ethyl acetate before analysis. Analysis was performed using a Thermo Scientific™ TRACE™ 1310 gas chromatograph and a Thermo Scientific™ ISQ™ 7000 single quadrupole GC-MS system (GC-QQQ-MS). The column was a ZB-5 HT (0.25 mm × 30 m, Thermo Fisher Scientific); the carrier gas was helium at a flow rate of 1.0 mL / min; the temperature program was: initial temperature 170°C, ramping to 290°C at 6°C / min, holding for 4 min, and then ramping to 340°C at 10°C / min. The injector temperature was 280°C, the injection volume was 1 µL, and the split ratio was 20:1. The mass spectrometer detector was set at 70 eV, and the scan range was 60–800.

[0084] 2) Detection of 22-hydroxy-26-amino-cholesterol and veratrazine For 22-hydroxy-26-aminocholesterol and veratrazine, 100 μL of the ethyl acetate extract was pipetted into a sample vial, evaporated to dryness, dissolved in 100 μL of chromatographic methanol, and then analyzed. Analysis was performed using a Waters ACQUITY ultra-high performance liquid chromatography (LC) system coupled with a SCIEX TripleTOF 6600 mass spectrometer (AB Sciex, Milford, MA, USA). Chromatographic separation was performed using an ACQUITY BEH C18 column (100 mm × 2.1 mm, 1.7 µm) at 40 °C. Mobile phase A was an aqueous solution containing 0.1% formic acid, and mobile phase B was an acetonitrile solution containing 0.1% formic acid. The gradient elution program was as follows: 0–1 min, B phase concentration 5%–52%; 1–6 min, 52–56% B; 6–7 min, 56–95% B; 7–7.5 min, 95–95% B; 7.5–9 min, 95–5% B; 9–10 min, 5–5% B. The flow rate was 0.25 mL / min, and the injection volume was 1 µL. The SCIEX TripleTOF 6600 mass spectrometer was used in positive ion data acquisition mode under the following conditions: capillary voltage 3.6 kV, cone voltage 35 kV, ion source temperature 105°C, desolvation gas temperature 340°C, reverse cone gas flow rate 55 L / h, desolvation gas flow rate 650 L / h, and extraction cone voltage 4 V. The mass-to-charge ratio data scan range was 50–1500 m / z.

[0085] 3) Experimental results: By knocking out the YPL062w, DPP1, LPP1, and ROX1 genes, and inserting gene expression cassettes such as PptHMGR, ERG13, ERG10, tHMG1, ERG12, ERG8, ERG19, IDI1, ERG20, ERG9, and ERG1 into the knockout sites, strains CEN-1, CEN-2, CEN-3, and CEN-OS were constructed sequentially.

[0086] like Figure 6 As shown, GC-MS was used to detect squalene, ergosterol, and lanosterol products in strains CEN-1, CEN-2, CEN-3, and CEN-OS. Among them, as shown... Figure 6 (a) and Figure 6 As shown in (b), the products of strains CEN-2, CEN-3, and CEN-OS exhibited characteristic chromatographic peaks consistent with the retention time of squalene (13.5 min) of the standard. The accumulation of squalene in strains CEN-1, CEN-2, CEN-3, and CEN-OS gradually increased, with titers of 0.01 g / L, 0.41 g / L, 0.38 g / L, and 1.24 g / L, respectively. Among them, strain CEN-OS had the highest squalene content, reaching 1.24 g / L.

[0087] like Figure 6 (a) and Figure 6 As shown in (c), the products of strains CEN-1, CEN-2, CEN-3 and CEN-OS showed characteristic chromatographic peaks consistent with the retention time of 17.9 min for the standard ergosterol. The titers of ergosterol in each strain ranged from 50 to 85 mg / L, specifically 55.81 mg / L, 74.09 mg / L, 68.53 mg / L and 84.70 mg / L, respectively.

[0088] like Figure 6 (a) and Figure 6 As shown in (d), the products of strains CEN-2, CEN-3, and CEN-OS exhibited a characteristic chromatographic peak consistent with the retention time of lanosterol (18.8 min) of the standard. The accumulation of lanosterol in the products of strains CEN-1, CEN-2, CEN-3, and CEN-OS gradually increased, with titers of 4.47 mg / L, 36.62 mg / L, 33.11 mg / L, and 172.25 mg / L, respectively. Among these, strain CEN-OS showed the highest lanosterol titer, reaching 172 mg / L, approximately 170 times higher than the original strain, providing abundant precursors for the subsequent synthesis of triterpenoids and steroidal compounds.

[0089] The CEN-4 strain was constructed by inserting ERG11, ERG2, and ERG3 expression cassettes from the ergosterol upstream pathway into the yeast ARO10 site to further enhance the metabolic flux of sterol precursors in yeast. Yeast itself cannot synthesize cholesterol; however, the animal-derived cholesterol C7 reductase DrDHCR7 and cholesterol C24 reductase GgDHCR24 genes can be introduced to reduce the C7 and C24 double bonds of the ERG3 product, 5,7,24-cholesterol, to form cholesterol. The CEN-Chol strain was formed by integrating ERG1, the zebrafish-derived cholesterol C7 reductase DrDHCR7 gene, and the chicken-derived cholesterol C24 reductase GgDHCR24 gene into a δDNA multiple copy site in the yeast genome. Based on the CEN-Chol strain, the GAL80 transcription factor, which negatively regulates galactose metabolism, was knocked out, and the cytochrome P450 reductase VcCPR was inserted into this site, forming the CEN-CPR strain.

[0090] like Figure 7As shown, GC-MS was used to detect cholesterol products from strains CEN-OS, CEN-4, CEN-Chol, and CEN-CPR. The products from strains CEN-Chol and CEN-CPR showed characteristic chromatographic peaks consistent with the retention time of cholesterol standard (17.1 min), indicating the clear detection of cholesterol (compound 2). Furthermore, the products from strain CEN-Chol also contained sterol byproducts 1, 3, 4, and 5. Figure 8 The image shows the MS / MS mass spectra of the products from strain CEN-Chol, where... Figure 8 (a) Figure 8 (b) and Figure 8 As can be seen from (e) in the diagram, compound 1 is a sterol, compound 2 is cholesterol, and compound 5 isoflavone.

[0091] like Figure 9 As shown, the cholesterol titer of strain CEN-Chol was 79.92 mg / L, and the cholesterol production in strain CEN-CPR was further increased to 115.37 mg / L. Furthermore, lanosterol was present in the products of strains CEN-OS, CEN-4, CEN-Chol, and CEN-CPR, with titers of 172.25 mg / L, 175.80 mg / L, 121.56 mg / L, and 21.01 mg / L, respectively, falling within the range of 21–176 mg / L.

[0092] Based on strain CEN-CPR, the genes VcCYP90B27, VcCYP94N1, VcGABAT, and VcCYP90G1 were sequentially inserted into the ATF2 site to obtain strains CEN-V1, CEN-V2, CEN-V3, and CEN-Vera. The strains were cultured in YPD shake flasks, and the extracts were analyzed by GC-MS and LC-MS.

[0093] Figure 10 Chromatograms, MS mass spectrometry results, and cholesterol titer plots for GC-MS detection of 22R-hydroxycholesterol in strains CEN-CPR, CEN-V1, CEN-V2, CEN-V3, and CEN-Vera are shown. Figure 10 As shown in (a), GC-MS detection of 22R-hydroxycholesterol in strains CEN-CPR, CEN-V1, CEN-V2, CEN-V3, and CEN-Vera revealed characteristic chromatographic peaks in the products of strains CEN-V1, CEN-V2, CEN-V3, and CEN-Vera, consistent with the retention time of 18.5 min for the standard 22R-hydroxycholesterol. Among these, strain CEN-V1 showed a clearly detectable formation of 22R-hydroxycholesterol. Figure 10 As shown in (b), MS mass spectrometry detection of the components corresponding to the characteristic chromatographic peaks in the products of strains CEN-V1, CEN-V2, CEN-V3, and CEN-Vera revealed a characteristic ion peak of 22R-hydroxycholesterol at m / z 173.21, confirming that the components corresponding to the characteristic chromatographic peaks in the products of strains CEN-V1, CEN-V2, CEN-V3, and CEN-Vera are indeed 22R-hydroxycholesterol. Figure 10 As shown in (c), strain V1 produced the highest yield of 22R-hydroxycholesterol, approximately 3482.83 μg / L, while the product was consumed and produced in lower quantities in CEN-V2, CEN-V3, and CEN-Vera.

[0094] Figure 11 Chromatograms, MS mass spectra, and titers of 22R,26-dihydroxycholesterol for GC-MS detection in strains CEN-CPR, CEN-V1, CEN-V2, CEN-V3, and CEN-Vera are shown. Figure 11 As shown in (a), GC-MS detection of 22R,26-dihydroxycholesterol in strains CEN-CPR, CEN-V1, CEN-V2, CEN-V3, and CEN-Vera revealed characteristic chromatographic peaks in the products of strains CEN-V2, CEN-V3, and CEN-Vera, consistent with the retention time of 21.2 min for standard 22R,26-dihydroxycholesterol. Figure 11 As shown in (b), MS mass spectrometry detection of the components corresponding to the characteristic chromatographic peaks in the products of strains CEN-V2, CEN-V3, and CEN-Vera revealed a characteristic ion peak of 22R,26-dihydroxycholesterol at m / z 99.14, confirming that the component corresponding to the characteristic chromatographic peak in the products of strains CEN-V2, CEN-V3, and CEN-Vera is indeed 22R,26-dihydroxycholesterol. Figure 11 As shown in (c), strain CEN-V2 produced the highest yield of 22R,26-dihydroxycholesterol, approximately 1003.05 μg / L, while CEN-V3 and Vera produced lower yields, with titers of 672.92 μg / L and 433.24 μg / L, respectively.

[0095] The stability of dihydroxycholesterol is enhanced by linking it to an amino group, and the subsequent product is detected by LC-MS. Figure 12Chromatograms, MS mass spectra, and titers of 22-hydroxy-26-amino-cholesterol from strains CEN-CPR, CEN-V1, CEN-V2, CEN-V3, and CEN-Vera are shown for LC-MS detection. Figure 12 As shown in (a), GC-MS detection of 22-hydroxy-26-amino-cholesterol in strains CEN-CPR, CEN-V1, CEN-V2, CEN-V3, and CEN-Vera revealed characteristic chromatographic peaks in the products of strains CEN-V3 and CEN-Vera, consistent with the retention time of 7.74 min for the standard 22-hydroxy-26-amino-cholesterol. Figure 12 As shown in (b), MS mass spectrometry detection of the components corresponding to the characteristic chromatographic peaks in the products of strains CEN-V3 and CEN-Vera revealed a characteristic ion peak of 22-hydroxy-26-amino-cholesterol at 418.36 [M+H]. + This confirmed that the component corresponding to the characteristic chromatographic peak in the products of strains CEN-V3 and CEN-Vera was 22-hydroxy-26-amino-cholesterol. Strains CEN-CPR, CEN-V1, and CEN-V2 also showed similar ion peaks around 7.73 minutes, but the mass spectrometry result was 459.67 [M+H]. + This does not match the characteristic ion peak of 22-hydroxy-26-amino-cholesterol. For example... Figure 12 As shown in (c), strain CEN-V3 produced the highest yield of 22-hydroxy-26-amino-cholesterol at 662.98 μg / L, while CEN-Vera produced a lower yield of the product at a titer of 124.56 μg / L.

[0096] Figure 13 Chromatograms, MS mass spectrometry results, and veratridine titers for LC-MS detection of veratridine in strains CEN-CPR, CEN-V1, CEN-V2, CEN-V3, and CEN-Vera are shown. Figure 13 As shown in (a), GC-MS detection of veratrazine from strains CEN-CPR, CEN-V1, CEN-V2, CEN-V3, and CEN-Vera showed that the product from strain CEN-Vera exhibited a characteristic chromatographic peak with a retention time of 7.90 min consistent with that of the standard veratrazine. Figure 13 As shown in (b), MS mass spectrometry detection of the component corresponding to the characteristic chromatographic peak in the product of strain Vera revealed a characteristic ion peak of veratrazine at 398.34 [M+H]+, confirming that the component corresponding to the characteristic chromatographic peak in the product of strain Vera is veratrazine. Figure 13As shown in (c), veratrazine was synthesized in strain Vera at a titer of 265.38 μg / L.

[0097] Experiments of this invention demonstrate that, based on *Saccharomyces cerevisiae*, a corresponding recombinant strain was constructed, and recombinant strains that achieved high production of squalene, ergosterol, lanosterol, 22R-hydroxycholesterol, 22R,26-dihydroxycholesterol, and 22-hydroxy-26-amino-cholesterol were obtained. Furthermore, a recombinant strain for synthesizing veratrazine was constructed based on this strain, achieving heterologous and efficient veratrazine synthesis, as detailed below: 1) Squalene synthesis: The accumulation of squalene in recombinant strains CEN-1, CEN-2, CEN-3 and CEN-OS gradually increased, with the squalene content of recombinant strain CEN-OS reaching 1.24 g / L. 2) Ergosterol: Recombinant strains CEN-1, CEN-2, CEN-3 and CEN-OS can all accumulate ergosterol, with a content between 50 and 85 mg / L; 3) Synthesis of lanosterol: The lanosterol content in recombinant strains CEN-1, CEN-2, CEN-3, CEN-OS and CEN-4 also gradually increased. Among them, the lanosterol content of recombinant strain CEN-OS reached 172 mg / L, which was about 170 times higher than that of the original strain. The lanosterol content of recombinant strain CEN-4 reached 175.80 mg / L, which was about 174 times higher than that of the original strain. 4) Cholesterol synthesis: The cholesterol production in recombinant strains CEN-Chol and CEN-CPR was 79.92 mg / L and 115.37 mg / L, respectively; 5) Synthesis of 22R-hydroxycholesterol: 22R-hydroxycholesterol was detected in the products of recombinant strains CEN-V1, V2, V3 and Vera. Among them, the yield of 22R-hydroxycholesterol in recombinant strain CEN-V1 was 3482.83 μg / L. 6) Synthesis of 22R,26-dihydroxycholesterol: 22R,26-dihydroxycholesterol was detected in the products of recombinant strains CEN-V2, V3 and Vera. Among them, recombinant strain CEN-V2 had the highest yield, reaching 1003.05 μg / L. 7) Synthesis of 22-hydroxy-26-amino-cholesterol: 22-hydroxy-26-amino-cholesterol was detected in the products of recombinant strains V3 and Vera, with yields of 662.98 μg / L and 124.56 μg / L, respectively; 8) Synthesis of veratrazine: Veratrazine was detected in the product of strain CEN-Vera, with a yield of 265.38 μg / L.

[0098] Note that the above description is merely a preferred embodiment of the present invention and the technical principles employed. Those skilled in the art will understand that the present invention is not limited to the specific embodiments described herein, and various obvious changes, readjustments, and substitutions can be made without departing from the scope of protection of the present invention. Therefore, although the present invention has been described in detail through the above embodiments, the present invention is not limited to the above embodiments, and may include many other equivalent embodiments without departing from the concept of the present invention, the scope of which is determined by the scope of the appended claims.

Claims

1. A recombinant bacterial strain, characterized in that, The recombinant strain uses Saccharomyces cerevisiae as the starting strain, with the YPL062w gene knocked out in its genome and the PptHMGR gene integrated into the genome. The nucleotide sequence of the YPL062w gene is shown in SEQ ID NO.38, and the nucleotide sequence of the PptHMGR gene is shown in SEQ ID NO.

8.

2. The recombinant strain according to claim 1, characterized in that, The PptHMGR gene is inserted into the genome of the Saccharomyces cerevisiae via a PptHMGR gene expression cassette, wherein the PptHMGR gene expression cassette includes a promoter PGK1, the PptHMGR gene, and a terminator CPS1.

3. The recombinant strain according to claim 1, characterized in that, The brewer's yeast strain is CEN.PK2-1C.

4. The recombinant strain according to claim 1, characterized in that, The recombinant strain also knocks out the DPP1 gene in its genome, and integrates the ERG10 gene, ERG13 gene and tHMG1 gene into the genome. The nucleotide sequence of the DPP1 gene is shown in SEQ ID NO.39, the nucleotide sequence of the ERG10 gene is shown in SEQ ID NO.9, the nucleotide sequence of the ERG13 gene is shown in SEQ ID NO.10, and the nucleotide sequence of the tHMG1 gene is shown in SEQ ID NO.

11.

5. The recombinant strain according to claim 4, characterized in that, The ERG10, ERG13, and tHMG1 genes were inserted into the genome of the recombinant strain via the ERG10, ERG13, and tHMG1 gene expression cassettes, respectively. The ERG10 gene expression cassette includes the promoter TDH3, the ERG10 gene, and the terminator PDC1. The ERG13 gene expression cassette includes the promoter FBA1, the ERG13 gene, and the terminator ADH1. The tHMG1 gene expression cassette includes the promoter TEF1, the tHMG1 gene, and the terminator ENO2.

6. The recombinant strain according to claim 4, characterized in that, The recombinant strain also knocks out the LPP1 gene in its genome and integrates the ERG12, ERG8, ERG19 and IDI1 genes into its genome. The nucleotide sequence of the LPP1 gene is shown in SEQ ID NO.40, the nucleotide sequence of the ERG12 gene is shown in SEQ ID NO.12, the nucleotide sequence of the ERG8 gene is shown in SEQ ID NO.13, the nucleotide sequence of the ERG19 gene is shown in SEQ ID NO.14, and the nucleotide sequence of the IDI1 gene is shown in SEQ ID NO.

15.

7. The recombinant strain according to claim 6, characterized in that, The ERG12, ERG8, ERG19, and IDI1 genes were inserted into the genome of the recombinant strain via the ERG12, ERG8, ERG19, and IDI1 gene expression cassettes, respectively. The ERG12 gene expression cassette includes the promoter ENO2, the ERG12 gene, and the terminator THD2. The ERG8 gene expression cassette includes the promoter PDC1, the ERG8 gene, and the terminator PGK1. The ERG19 gene expression cassette includes the promoter TDH3, the ERG19 gene, and the terminator CYC1. The IDI1 gene expression cassette includes the promoter TPI1, the IDI1 gene, and the terminator ADH1.

8. The recombinant strain according to claim 6, characterized in that, The recombinant strain also knocks out the ROX1 gene in its genome and integrates the ERG20, ERG9 and ERG1 genes into its genome. The nucleotide sequence of the ROX1 gene is shown in SEQ ID NO.41, the nucleotide sequence of the ERG20 gene is shown in SEQ ID NO.16, the nucleotide sequence of the ERG9 gene is shown in SEQ ID NO.17, and the nucleotide sequence of the ERG1 gene is shown in SEQ ID NO.

18.

9. The recombinant strain according to claim 8, characterized in that, The ERG20, ERG9, and ERG1 genes were inserted into the genome of the recombinant strain via ERG20, ERG9, and ERG1 gene expression cassettes, respectively. The ERG20 gene expression cassette includes the promoter PGK1, the ERG20 gene, and the terminator TDH2. The ERG9 gene expression cassette includes the promoter TEF1, the ERG9 gene, and the terminator PGK1. The ERG1 gene expression cassette includes the promoter TDH3, the ERG1 gene, and the terminator ADH1.

10. The recombinant strain according to claim 8, characterized in that, The recombinant strain also knocks out the ARO10 gene in its genome and integrates the ERG11, ERG2, and ERG3 genes into its genome. The nucleotide sequence of the ARO10 gene is shown in SEQ ID NO.42, the nucleotide sequence of the ERG11 gene is shown in SEQ ID NO.19, the nucleotide sequence of the ERG2 gene is shown in SEQ ID NO.20, and the nucleotide sequence of the ERG3 gene is shown in SEQ ID NO.

21.

11. The recombinant strain according to claim 10, characterized in that, The ERG11, ERG2, and ERG3 genes were inserted into the genome of the recombinant strain via ERG11, ERG2, and ERG3 gene expression cassettes, respectively. The ERG11 gene expression cassette includes the promoter PYK1, the ERG11 gene, and the terminator FBA1. The ERG2 gene expression cassette includes the promoter TPI1, the ERG2 gene, and the terminator PDC1. The ERG3 gene expression cassette includes the promoter FBA1, the ERG3 gene, and the terminator CYC1.

12. The recombinant strain according to claim 10, characterized in that, The recombinant strain also integrates the ERG1 gene, DrDHCR7 gene, and GgDHCR24 gene at the δDNA site, wherein the nucleotide sequence of the δDNA site is shown in SEQ ID NO. 45, the nucleotide sequence of the ERG1 gene is shown in SEQ ID NO. 18, the nucleotide sequence of the DrDHCR7 gene is shown in SEQ ID NO. 1, and the nucleotide sequence of the GgDHCR24 gene is shown in SEQ ID NO.

2.

13. The recombinant strain according to claim 12, characterized in that, The ERG1, DrDHCR7, and GgDHCR24 genes were inserted into the genome of the recombinant strain via ERG1, DrDHCR7, and GgDHCR24 gene expression cassettes, respectively. The ERG1 gene expression cassette includes the promoter FBA1, the ERG1 gene, and the terminator CPS1. The DrDHCR7 gene expression cassette includes the promoter TEF1, the DrDHCR7 gene, and the terminator PDC1. The GgDHCR24 gene expression cassette includes the promoter TDH3, the GgDHCR24 gene, and the terminator ENO2.

14. The recombinant strain according to claim 12, characterized in that, The recombinant strain also knocks out the GAL80 gene in its genome and integrates the VcCPR gene into its genome, wherein the nucleotide sequence of the GAL80 gene is shown in SEQ ID NO.43 and the nucleotide sequence of the VcCPR gene is shown in SEQ ID NO.

3.

15. The recombinant strain according to claim 14, characterized in that, The VcCPR gene is inserted into the genome of the recombinant strain via a VcCPR gene expression cassette. The VcCPR gene expression cassette includes the promoter TEF1, the VcCPR gene, and the terminator CPS1.

16. The recombinant strain according to claim 14, characterized in that, The genome of the recombinant strain may be further modified in any of the following ways: (1) The ATF2 gene in its genome was knocked out while the VcCYP90B27 gene was expressed in its genome to obtain the recombinant strain CEN-V1; (2) While knocking out the ATF2 gene in its genome, the VcCYP90B27 gene and the VcCYP94N1 gene were expressed in its genome to obtain the recombinant strain CEN-V2; (3) While knocking out the ATF2 gene in its genome, the VcCYP90B27 gene, VcCYP94N1 gene and VcGABAT gene were expressed in its genome to obtain the recombinant strain CEN-V3. (4) While knocking out the ATF2 gene in its genome, the VcCYP90B27 gene, VcCYP94N1 gene, VcGABAT gene and VcCYP90G1 gene were expressed in its genome to obtain the recombinant strain CEN-Vera. The nucleotide sequence of the ATF2 gene is shown in SEQ ID NO.44, the nucleotide sequence of the VcCYP90B27 gene is shown in SEQ ID NO.4, the nucleotide sequence of the VcCYP94N1 gene is shown in SEQ ID NO.5, the nucleotide sequence of the VcGABAT gene is shown in SEQ ID NO.6, and the nucleotide sequence of the VcCYP90G1 gene is shown in SEQ ID NO.

7.

17. The recombinant strain according to claim 16, characterized in that, The VcCYP90B27, VcCYP94N1, VcGABAT, and VcCYP90G1 genes were inserted into the genome of the recombinant strain via the VcCYP90B27, VcCYP94N1, VcGABAT, and VcCYP90G1 gene expression cassettes, respectively. The VcCYP90B27 gene expression cassette includes the promoter TEF1, the VcCYP90B27 gene, and the terminator ADH1. The VcCYP94N1 gene expression cassette includes promoter FBA1, the VcCYP94N1 gene, and terminator TDH2; The VcGABAT gene expression cassette includes the promoter TDH3, the VcGABAT gene, and the terminator FBA1. The VcCYP90G1 gene expression cassette includes the promoter PGK1, the VcCYP90G1 gene, and the terminator CYC1.

18. The use of the recombinant strain according to any one of claims 1 to 17 in the production of veratrazine and veratrazine steroid precursors, or in increasing the yield of veratrazine and veratrazine steroid precursors.

19. The application according to claim 18, characterized in that, The veratrazine steroid precursors include squalene, ergosterol, lanosterol, 22R-hydroxycholesterol, 22R,26-dihydroxycholesterol, and 22-hydroxy-26-amino-cholesterol.

Images