Mesenchymal stem cell serum-free medium with limited chemical components as well as application and method of mesenchymal stem cell serum-free medium
By using a serum-free culture medium with clearly defined chemical composition, the problems of unclear composition and senescence in MSC culture have been solved, resulting in enhanced proliferation capacity and extended telomere length, making it suitable for the industrial production and clinical application of mesenchymal stem cells.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- WENZHOU INST UNIV OF CHINESE ACAD OF SCI
- Filing Date
- 2025-12-26
- Publication Date
- 2026-05-01
AI Technical Summary
Existing MSC culture systems rely on fetal bovine serum, which has a complex composition and does not meet GMP requirements, leading to cell senescence and functional decline, making it difficult to achieve clear control of chemical composition and quality assurance.
A chemically defined serum-free culture medium for mesenchymal stem cells, comprising DMEM/F12 medium, ITS-X, TGF-β1, recombinant human albumin, sodium ascorbate-2-phosphate, arachidonic acid, cholesterol, Tween 80, tocopheryl acetate, Pluronic F-68, and 7-hydroxytriptylide, was used to maintain MSC proliferation and telomere length.
It has achieved enhanced MSC proliferation capacity, extended telomere length, and increased multi-directional differentiation potential, meeting GMP requirements and is suitable for industrial production and clinical application.
Smart Images

Figure CN121950689A_ABST
Abstract
Description
A chemically defined serum-free culture medium for mesenchymal stem cells, its application and method Technical Field
[0001] This invention relates to the field of cell culture technology, specifically to a chemically defined serum-free culture medium for mesenchymal stem cells, its application, and methods. Background Technology
[0002] Mesenchymal stem cells (MSCs) are widely used in tissue repair, immune regulation, and regenerative medicine due to their self-renewal capacity and multi-lineage differentiation potential. However, during long-term in vitro culture, MSCs are prone to aging phenomena such as slowed proliferation, flattened morphology, loss of stemness, and shortened telomeres, which seriously affect their clinical application value.
[0003] Currently, most commonly used MSC culture systems rely on fetal bovine serum (FBS). However, serum has complex components, significant batch-to-batch variability, and poses a risk of pathogen contamination, failing to meet GMP production requirements. In recent years, although some serum-free culture media have been commercialized, they often contain unknown components (such as plant hydrolysates and lipid mixtures), making it difficult to achieve true "chemical composition limitation," which is detrimental to quality control and mechanism research.
[0004] Furthermore, existing serum-free systems still struggle to effectively maintain MSC stemness and telomere length during long-term passages, leading to functional decline in high-passage cells. Therefore, developing a chemically defined culture medium with well-defined components, high safety, and the ability to consistently support stable MSC function has become an urgent industry need. Summary of the Invention
[0005] To address the shortcomings and deficiencies of existing technologies, this invention provides a chemically defined serum-free culture medium for mesenchymal stem cells, which contains no animal-derived serum or undefined components, has a clearly defined and controllable composition, and is suitable for clinical-grade cell preparation.
[0006] The technical solution adopted in this invention is: a serum-free culture medium for mesenchymal stem cells with defined chemical composition, wherein the serum-free culture medium comprises DMEM / F12 medium, 1×ITS-X, 2-10 ng / mL TGF-β1, 0.5-5% w / v recombinant human albumin, 0.1-10 mM sodium ascorbate-2-phosphate, 2-10 μg / mL arachidonic acid, 0.22-1 mg / mL cholesterol, 2.2-10 mg / mL Tween 80, 20-50 μg / mL tocopheryl acetate, 50-100 mg / mL Pluronic F-68, and 30-90 ng / mL 7-hydroxytriptolide.
[0007] Preferably, the serum-free culture medium comprises DMEM / F12 medium, 1×ITS-X, 2 ng / mL TGF-β1, 0.5% w / v recombinant human albumin, 0.1 mM sodium ascorbate-2-phosphate, 2 μg / mL arachidonic acid, 0.22 mg / mL cholesterol, 2.2 mg / mL Tween 80, 20-50 μg / mL tocopheryl acetate, 100 mg / mL Pluronic F-68, and 60 ng / mL 7-hydroxytriptolide.
[0008] The 7-hydroxytriptylide alcohol is a small molecule compound extracted and modified from Tripterygium wilfordii, with the molecular formula C2. 20 H 24 O7.
[0009] The application of the chemically defined serum-free culture medium for mesenchymal stem cells in the preparation of reagents for maintaining the proliferation, telomere length and multi-lineage differentiation capacity of mesenchymal stem cells.
[0010] The mesenchymal stem cells mentioned are mesenchymal stem cells derived from human umbilical cord or adipose tissue.
[0011] The use of a chemically defined serum-free mesenchymal stem cell culture medium in the preparation of cell culture system reagents for tissue engineering or regenerative medicine products.
[0012] A method for culturing mesenchymal stem cells includes the following steps: (1) seeding primary mesenchymal stem cells into a culture flask coated with fibronectin, adding the serum-free culture medium, and culturing at 37°C, 5% CO2, and saturated humidity; (2) replacing the serum-free culture medium with fresh medium every 2–3 days; and passage the cells by digestion with 0.25% trypsin when the cell confluence reaches 80–90%.
[0013] The ratio of generations in step (2) is 1:2–3.
[0014] The beneficial effects of this invention are as follows: This invention provides a chemically defined serum-free culture medium for mesenchymal stem cells, its application, and a method thereof. It is completely serum-free and has clearly defined components: all additives are known chemical substances that meet cGMP production requirements; it can significantly delay telomere shortening by activating TERT expression and slowing down replicative senescence; it can also enhance proliferation capacity: P10 generation cells still have active division capacity; it supports multi-lineage differentiation: osteogenic differentiation efficiency is superior to traditional serum-containing systems; it is cost-controllable and easy to scale up: suitable for industrial production and clinical translation. Attached Figure Description
[0015] Figure 1 is a comparative morphological feature diagram of P5 generation mesenchymal stem cells cultured in the culture media described in Examples 1 to 3 under an inverted microscope, where a–g correspond to Examples 1, 2, 3, 1, 2, and 3, respectively.
[0016] Figure 2 shows the in vitro proliferation and growth curves of P3 generation mesenchymal stem cells in each group. The horizontal axis represents the culture time (days), and the vertical axis represents the average cell number (×10). 4 / mL).
[0017] Figure 3 shows the average fluorescence intensity of telomeres in P10 generation cells detected by qFISH technology, reflecting changes in telomere length.
[0018] Figure 4 shows the percentage of alizarin red staining positive area in mesenchymal stem cells. Detailed Implementation
[0019] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative effort are all within the scope of protection of the present invention.
[0020] Example 1 (Optimal Formulation) A serum-free culture medium for mesenchymal stem cells, composed of the following components: - DMEM / F12 basal medium; - 1×ITS-X; - TGF-β1: 2 ng / mL; - Recombinant human albumin: 0.5%; - Sodium ascorbate-2-phosphate: 0.1 mM; - Arachidonic acid: 2 μg / mL; - Cholesterol: 0.22 mg / mL; - Tween 80: 2.2 mg / mL; - Tocopheryl acetate: 70 μg / mL; - Pluronic F-68: 100 mg / mL; - 7-hydroxytriptylide: 60 ng / mL.
[0021] Example 2 (low concentration formulation): Except for the concentration of 7-hydroxytriptylide alcohol being 30 ng / mL, the other components are the same as in Example 1.
[0022] Example 3 (high concentration formulation): Except for the concentration of 7-hydroxytriptylide alcohol being 90 ng / mL, the other components are the same as in Example 1.
[0023] Comparative Example 1 (lacking 7-OH-TPL) differs from Example 1 only in that 7-hydroxytriptylide alcohol is removed, while the other components remain the same.
[0024] Comparative Example 2 (overcompensation): Compared with Example 1, 7-hydroxytriptylide alcohol was removed, while the TGF-β1 concentration was increased to 5 ng / mL in an attempt to compensate for its function.
[0025] Comparative Example 3 (positive control) used conventional DMEM / F12 medium containing 10% FBS as a control.
[0026] Application Example: Mesenchymal stem cell culture was performed using umbilical cord tissue from healthy postpartum women. After washing three times with PBS, the tissue was minced into 1 mm³ pieces. 0.1% collagenase II was added, and the tissue was digested at 37°C with shaking for 1 hour. The tissue was then centrifuged (1500 rpm, 5 min), and the supernatant was discarded. The pellet was resuspended in the corresponding culture media of Examples 1–3 and Comparative Examples 1–3, and seeded into fibronectin-coated T25 culture flasks. The flasks were incubated at 37°C in a 5% CO2 incubator. The medium was changed for the first time after 24 hours, and then every 2 days thereafter. When the confluence reached 80%, the tissue was digested and passaged, and cultured continuously until passage P10.
[0027] Example 1: Cell Morphology and Growth Curve The P3 generation umbilical cord mesenchymal stem cells obtained from Examples 1-3 and Comparative Examples 1-3 were observed under an inverted microscope and photographed. The results are shown in Figure 1 (ag corresponds to each group). Figure 1 shows that the cells in Examples 1-3 were all slender spindle-shaped, with clear outlines, regular arrangement, uniform distribution, and good growth status, and the cell density was significantly higher than that of the other groups. In contrast, the number of cells in Comparative Examples 1 and 2 was significantly reduced due to the lack of 7-hydroxytriptylide; although FBS was added to Comparative Example 3, the cell density was still lower than that of Example 1, suggesting that 7-hydroxytriptylide can significantly promote the proliferation of umbilical cord mesenchymal stem cells.
[0028] Further testing of cell proliferation activity: P3 generation cells from each group were collected and prepared into 2×10⁻⁶ cells using the corresponding culture medium. 4 Cells / mL suspension were seeded into 96-well plates with three replicates per group and cultured at 37°C and 5% CO2. Cells were counted daily for 7 consecutive days, and growth curves were plotted (Figure 2). In Examples 1-3, cells were in the lag phase on days 1-2, entered the logarithmic growth phase on days 3-5, and plateaued on days 6-7, with no significant difference in proliferation rate among the examples. In Comparative Examples 1-3, the proliferation rate decreased significantly due to component changes, with the most significant difference observed in Comparative Example 3. In conclusion, 7-hydroxytriptylide alcohol, in synergy with the components, can significantly enhance the proliferative capacity of umbilical cord mesenchymal stem cells.
[0029] Example 2: Telomere length determination. Total RNA was extracted from cells using the GeneJET RNA purification kit, and then cDNA was synthesized by reverse transcription using the PrimeScript RT kit. Quantitative PCR was then performed using the SYBR Green Master Mix kit on an Applied Biosystems 7500 real-time quantitative PCR system. Primer names and sequences are as follows: H-telomere-F: CGGTTTGTTTGGGTTTGGGTTTGGGTTIGGGTTTGGGTTH-telomere-R: GCCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCTH-β-globin-F: GCTTCTGACACAACTGTGTTCACTAGCH-6-globi-R: CACCAACTTCATCCACGTTCACC; Telomere length calculation method (T / S): First, calculate ΔCT for the standard and sample respectively: CT = CT (telomere) - CT (internal control); then calculate T / S = 2. -(△CT(样品)-△CT(标准品)) The results showed that the average telomere length of P10 generation cells in Example 1 group was approximately 18% longer than that in Control Example 1, and the difference was statistically significant.
[0030] Experimental Example 3: Assessment of Multi-lineage Differentiation Capacity; Osteogenic Differentiation Capacity Detection: P3 generation umbilical cord mesenchymal stem cells obtained from Examples 1-3 and Comparative Examples 1-3 were used to detect osteogenic differentiation capacity at a concentration of 1×10⁻⁶. 5 Cells / mL were seeded in 12-well plates and amplified to 80% confluence in the corresponding culture medium, then replaced with osteogenic induction medium (DMEM / F12, 0.2 μmol / L dexamethasone, 0.45 mmol / L vitamin C, 10% FBS, 20 mmol / L sodium β-glycerophosphate). Induction lasted 21 days, followed by fixation with 4% paraformaldehyde for 15 min, and alizarin red staining at room temperature in the dark for 30 min. Image J was used to calculate the percentage of mineralized area. Figure 4 shows that the mineralized nodule area in the example group was significantly larger than that in the control group, suggesting better osteogenic differentiation potential.
Claims
1. A serum-free culture medium for mesenchymal stem cells with defined chemical composition, characterized in that, The serum-free culture medium includes DMEM / F12 medium, 1×ITS-X, 2-10 ng / mL TGF-β1, 0.5-5% w / v recombinant human albumin, 0.1-10 mM sodium ascorbate-2-phosphate, 2-10 μg / mL arachidonic acid, 0.22-1 mg / mL cholesterol, 2.2-10 mg / mL Tween 80, 20-50 μg / mL tocopheryl acetate, 50-100 mg / mL Pluronic F-68, and 30-90 ng / mL 7-hydroxytriptolide.
2. The serum-free culture medium for mesenchymal stem cells with defined chemical composition according to claim 1, characterized in that, The serum-free culture medium includes DMEM / F12 medium, 1×ITS-X, 2 ng / mL TGF-β1, 0.5% w / v recombinant human albumin, 0.1 mM ascorbic acid-2-phosphate sodium, 2 μg / mL arachidonic acid, 0.22 mg / mL cholesterol, 2.2 mg / mL Tween 80, 20-50 μg / mL tocopheryl acetate, 100 mg / mL Pluronic F-68, and 60 ng / mL 7-hydroxytriptolide.
3. The serum-free culture medium for mesenchymal stem cells with defined chemical composition according to claim 1, characterized in that, The 7-hydroxytriptylide alcohol is a small molecule compound extracted and modified from Tripterygium wilfordii, with the molecular formula C. 20 H 24 O7.
4. The use of the chemically defined serum-free culture medium for mesenchymal stem cells as described in claim 1 in the preparation of reagents for maintaining the proliferation, telomere length, and multi-lineage differentiation capacity of mesenchymal stem cells.
5. The application according to claim 4, characterized in that, The mesenchymal stem cells mentioned are mesenchymal stem cells derived from human umbilical cord or adipose tissue.
6. The use of the chemically defined serum-free mesenchymal stem cell culture medium of claim 1 in the preparation of cell culture system reagents for tissue engineering or regenerative medicine products.
7. A method for culturing mesenchymal stem cells, characterized in that, The procedure includes the following steps: (1) seeding primary mesenchymal stem cells into a culture flask coated with fibronectin, adding the serum-free culture medium as described in claim 1, and culturing at 37°C, 5% CO2, and saturated humidity; (2) replacing the serum-free culture medium with fresh medium every 2–3 days; and passage the cells when the cell confluence reaches 80–90%, digesting them with 0.25% trypsin.
8. The application according to claim 7, characterized in that, The ratio of generations in step (2) is 1:2–3.