Gene GmHDA11 capable of remarkably improving salt tolerance and yield of soybeans as well as encoded protein and application of gene GmHDA11
By cloning and overexpressing the soybean histone deacetylase gene GmHDA11 and its three transcripts, the multidimensional interference of salt stress on soybeans was solved, improving the salt tolerance and yield of soybeans, and providing molecular markers for screening and breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- NANJING AGRICULTURAL UNIVERSITY
- Filing Date
- 2026-01-27
- Publication Date
- 2026-05-01
AI Technical Summary
In existing technologies, salt stress causes multidimensional interference to soybean seed germination rate, seedling growth potential, photosynthetic pigment synthesis, photosynthetic system function and ion balance, leading to a decline in crop yield and quality. Furthermore, there is a lack of research on the epigenetic modification regulation of soybean salt stress response.
We cloned and provided the soybean salt tolerance-related histone deacetylase gene GmHDA11 and its three transcripts. We overexpressed this gene in soybeans using a recombinant expression vector to improve its salt tolerance and yield, and developed corresponding molecular markers for screening and breeding.
It significantly improves the salt tolerance and yield of soybeans, provides molecular markers for rapid screening of salt-tolerant and high-yielding soybean varieties, and realizes the genetic improvement of soybeans.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
A gene, GmHDA11, that significantly improves soybean salt tolerance and yield, its encoded protein, and its applications. Technical Field
[0001] This invention belongs to the field of genetic engineering, specifically relating to a soybean salt tolerance-related gene GmHDA11, its encoded protein, and its applications. Background Technology
[0002] Soybean (Glycine max) is the world's fourth largest crop and the most widely planted oilseed crop. Its stable production and supply security play a core supporting role in maintaining national strategic grain and oil reserves and ensuring the sustainable development of agricultural ecosystems. Currently, driven by a combination of factors such as frequent extreme weather events caused by global climate change, improper farmland irrigation patterns, and unbalanced fertilizer application intensity, more than 20% of arable land worldwide is affected by salt stress, and soil salinization is spreading at an accelerating pace, becoming one of the main abiotic stress factors restricting the improvement of grain production capacity.
[0003] Salt stress can disrupt a plant's seed germination rate, seedling vigor, photosynthetic pigment synthesis (such as chlorophyll degradation), photosynthetic system function (such as decreased photosynthetic rate and suppressed photosynthetic activity), ion balance (such as Na⁺ / K⁺ imbalance), and nutrient absorption (such as reduced utilization efficiency of nitrogen, phosphorus, and potassium). Ultimately, it significantly affects the normal growth and development of plants, leading to a decline in crop yield and quality. Screening and breeding superior salt-tolerant soybean varieties is of crucial practical value for improving the utilization efficiency of saline-alkali arable land resources and ensuring agricultural production benefits.
[0004] When plants are subjected to salt stress, they immediately undergo genome-wide transcriptional reprogramming. This transcriptional reprogramming in plant stress response is jointly regulated by numerous epigenetic modifying enzymes and transcription factors. Currently, conserved epigenetic modifying enzymes regulating plant stress response in multiple crops include DNA demethylase ROS1, histone acetyltransferase GCN5, and histone deacetyltransferases HDA19, HDA9, and HDA6. Over the past 20 years, the main soybean salt tolerance genes identified include ion transporters, signal transducers, and transcription factors. However, research on the role of epigenetic modifications regulating salt stress transcriptional reprogramming in soybean salt stress response is relatively limited. Identifying epigenetic modifying genes that play important roles in soybean salt stress response is crucial for understanding transcriptional reprogramming in soybean salt stress response and elucidating the soybean salt tolerance regulatory network. Summary of the Invention
[0005] To address the aforementioned technical problems in the prior art, the present invention aims to disclose a soybean salt tolerance and yield-related histone deacetylase gene GmHDA11, its encoded protein, and its applications.
[0006] The first objective of this invention is to provide a salt-tolerant enhanced transcript of the salt-tolerance-related gene GmHDA11, GmHDA11. I ,
[0007] The three transcripts are DNA molecules as follows: 1) or 2) or 3):
[0008] 1) GmHDA11 shown in SEQ ID No. 1 I DNA molecules;
[0009] 2) GmHDA11 shown in SEQ ID No. 2 II DNA molecules;
[0010] 3) GmHDA11 shown in SEQ ID No. 3 III DNA molecules;
[0011] GmHDA11 exists in three transcripts: the full-length transcript GmHDA11. I Transcript GmHDA11 missing 72 bases II And the transcript GmHDA11, which is missing 159 bases. III Transcript GmHDA11 I This is a salt-tolerant enhanced variety.
[0012] A second objective of this invention is to provide proteins encoded by three transcripts of the aforementioned gene GmHDA11:
[0013] 1) GmHDA11 shown in SEQ ID No. 4 I The amino acid sequence;
[0014] 2) GmHDA11 shown in SEQ ID No. 5 II The amino acid sequence;
[0015] 3) GmHDA11 shown in SEQ ID No. 6 III The amino acid sequence;
[0016] A third objective of this invention is to provide a method containing the aforementioned gene GmHDA11. I Recombinant expression vectors, expression cassettes, or recombinant bacteria.
[0017] Furthermore, the recombinant expression vector or cassette is inserted into the gene GmHDA11 by digesting the vector pBA002 with XbaI at the recombination site. I The recombinant expression vector or expression cassette is then transferred into engineered bacteria to obtain the recombinant bacteria shown.
[0018] Recombinant expression vectors containing any of the genes described above are also within the scope of protection of this invention.
[0019] Recombinant expression vectors containing the gene can be constructed using existing plant expression vectors.
[0020] The plant expression vectors include binary Agrobacterium vectors and vectors that can be used for plant microbombardment. These vectors may also contain the 3' untranslated region of a foreign gene, i.e., a polyadenylated signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylated signal can guide the addition of polyadenylated acid to the 3' end of the mRNA precursor; similar functions exist in the untranslated regions transcribed at the 3' end of Agrobacterium crown gall tumor-inducing (Ti) plasmid genes (such as the Nos gene for lipase) and plant genes (such as the soybean storage protein gene).
[0021] When constructing a recombinant plant expression vector using the gene described above, any enhanced or constitutive promoter, such as the cauliflower mosaic virus (CAMV) 35S promoter or the maize ubiquitin promoter, can be added before its transcription initiation nucleotide. These can be used alone or in combination with other plant promoters.
[0022] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes). From a safety perspective, transgenic plants can be screened directly under stress without adding any selective marker genes.
[0023] The recombinant expression vector can be a vector into which the gene GmHDA11 is inserted at the recombination site of the restriction endonuclease XbaI single digestion vector pBA002. I The resulting recombinant plasmid was named pBA002-GmHDA11. I .
[0024] GmHDA11 contains any of the genes mentioned above I Expression cassettes, transgenic cell lines, and recombinant bacteria are all within the scope of protection of this invention.
[0025] A fourth objective of this invention is to provide primers for amplifying the aforementioned gene GmHDA11. Primer pairs for amplifying the full length or any fragment of the gene GmHDA11 are also within the scope of protection of this invention.
[0026] A fifth objective of this invention is to provide the genetic engineering applications of the aforementioned gene GmHDA11, the aforementioned protein, the aforementioned recombinant expression vector, expression cassette or recombinant bacteria, or the aforementioned primers, expression vector or recombinant bacteria in regulating soybean salt tolerance and / or in genetic engineering.
[0027] Furthermore, overexpression of the transcript GmHDA11 of the aforementioned gene GmHDA11 I This can improve the salt tolerance and / or yield of soybeans.
[0028] Preferably, the aforementioned recombinant expression vector, expression cassette, or recombinant bacteria are introduced into soybean to overexpress the aforementioned gene GmHDA11. I .
[0029] The sixth objective of this invention is to provide a method for regulating salt tolerance and / or yield in soybeans, wherein the method involves overexpressing the aforementioned gene GmHDA11 in soybean plants. I This improves the salt tolerance and / or yield of soybeans.
[0030] Overexpression of the aforementioned gene GmHDA11 in soybean plants I The aforementioned recombinant expression vector, expression cassette, or recombinant bacteria can be used to introduce the gene GmHDA11 into soybean plants for overexpression. I .
[0031] The seventh objective of this invention is to provide a method for identifying salt-tolerant and salt-sensitive soybean materials. The GmHDA11 gene has three transcripts, and the full-length transcript GmHDA11 is overexpressed in salt-sensitive varieties. I Soybean salt tolerance is significantly enhanced; the transcript GmHDA11 is overexpressed in salt-tolerant soybean varieties. II Transcript GmHDA11 III Soybeans exhibit reduced salt tolerance. Among salt-tolerant soybean varieties, the transcript GmHDA11... I The content of the transcript GmHDA11 II or GmHDA11 III The content is comparable, while GmHDA11 is present in salt-sensitive soybeans. II or GmHDA11 III The transcriptional level was significantly higher than that of GmHDA11. I .
[0032] On one hand, the present invention provides a substance for detecting the content of three transcripts, comprising: A1) a set of primers, said set of primers being a single-stranded DNA molecule or a derivative thereof shown in SEQ ID NO. 7 and a single-stranded DNA molecule or a derivative thereof shown in SEQ ID NO. 8; A2) a PCR reagent containing said set of primers; and A3) a kit containing either A1) or A2).
[0033] On the other hand, substances that provide the ability to detect different transcript levels after salt stress can be used for any one or more of the following applications:
[0034] A1: To identify or assist in the identification of salt-tolerant soybean varieties;
[0035] A2: Reagents for preparing, identifying, or assisting in the identification of salt-tolerant soybean varieties;
[0036] A3: Soybean breeding or assisted soybean breeding;
[0037] A4: Preparation of soybean breeding reagents or auxiliary soybean breeding reagents.
[0038] Beneficial effects:
[0039] This invention marks the first discovery and cloning of a histone deacetylase gene, GmHDA11, which significantly enhances salt tolerance in soybeans. Furthermore, three transcripts of GmHDA11 were identified. The full-length transcript of this gene, GmHDA11, is overexpressed. I It can significantly improve soybean salt tolerance and / or yield. The transcript GmHDA11 in salt-tolerant soybean varieties... I The content of the transcript GmHDA11 II The content is comparable, while GmHDA11 is present in salt-sensitive soybeans. II The transcriptional level was significantly higher than that of GmHDA11. I This invention also provides molecular markers for detecting three transcripts of soybean GmHDA11. These markers can be used to cultivate salt-tolerant transgenic plants and to rapidly screen for salt-tolerant, high-yielding soybean varieties. The proteins and their encoding genes can be applied to plant genetic improvement. Attached Figure Description
[0040] Figure 1 shows the expression level of the GmHDA11 gene in the rooted soybean plants of the GmHDA11-OE combination.
[0041] Figure 2 shows the phenotypes (Figures A and B) of the soybean hybrid rooted plants of GmHDA11-OE under salt stress, as well as plant height (Figure C), root length (Figure D), leaf sodium ion content (Figure E), and hairy root sodium ion content (Figure F).
[0042] Figure 3 shows a semi-quantitative schematic diagram (Figure A) and a structural schematic diagram (Figure B) of the three transcripts of GmHDA11.
[0043] Figure 4 shows GmHDA11 I -OE、GmHDA11 II -OE、GmHDA11 III Phenotypic characteristics of soybean hybrid rooting plants under salt stress with -OE. (A) Overexpression of GmHDA11 in Qiandou 6. IPhenotype after salt treatment. (E) Overexpression of GmHDA11 in Huachun 2. II and GmHDA11 III Phenotype after salt stress. (BD) Overexpression of GmHDA11 I The chlorophyll content (B) and aboveground Na content of Qiandou No. 6 after salt treatment + Content (C) and Na in roots + Content (D). (FH) overexpression of GmHDA11 in Huachun 2. II and GmHDA11 III After salt stress, the chlorophyll content (F) and aboveground Na content were... + Content (G) and Na in roots + Content (H)
[0044] Figure 5 shows the expression levels of different transcripts of GmHDA11 in salt-tolerant (C, D) and salt-sensitive (A, B) soybean varieties. C represents the control growth conditions; S represents the salt stress growth conditions. (EF) After salt treatment, the expression levels of transcripts of GmHDA11... I and GmHDA11 II Relative content in salt-tolerant and salt-sensitive varieties. (G) In salt-tolerant varieties, GmHDA11 I Varieties with high content have a large weight per 100 grains.
[0045] Figure 6 shows the overexpression of GmHDA11 I The expression level of the GmHDA11 gene in stable transgenic soybean materials was identified, with GmELF used as an internal control.
[0046] Figure 7 (AD) shows the results of the field experiment, and (A) shows the results of overexpression of GmHDA11. I Phenotypic characteristics of stable transgenic soybeans (OE-4, OE-11) at adult stage, with WM82 as the empty vector control. (B) Number of pods per plant in WM82, OE-4, and OE-11. (C) Grain weight per plant in WM82, OE-4, and OE-11. (D) Grain size in WM82, OE-4, and OE-11. (EH) Results of greenhouse pot experiments simulating saline-alkali soil, with a salt treatment concentration of 3 grams of sodium chloride per kilogram of soil. (E) Overexpression of GmHDA11. I Phenotypic characteristics of stable transgenic soybeans (OE-4, OE-11) at adult stage, with WM82 serving as the empty vector control. (F) Number of pods per plant in WM82, OE-4, and OE-11. (G) Grain weight per plant in WM82, OE-4, and OE-11. (H) Grain size in WM82, OE-4, and OE-11. Detailed Implementation
[0047] The following examples are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores.
[0048] Example 1: Cloning of the soybean gene GmHDA11
[0049] Design the following primers:
[0050] Primer1: 5'-ATGGAAAGTGGAGGGAACTC-3';
[0051] Primer2: 5'-TCATCGTGACCTGTGATCAGA-3'.
[0052] Using primers 1 and 2, and root cDNA from soybean Williams82 seedlings as a template, PCR amplification was performed to obtain the target gene GmHDA11.
[0053] PCR amplification was performed in a Bio-rad T100 PCR instrument. The reaction system (50 μL) consisted of: 25 μL of 2×Phanta MaxMaster Mix, 2 μL of primer 1 (10 μM), 2 μL of primer 2 (10 μM), 2 μL of template cDNA (50 ng / μL), and 19 μL of ddH2O. The program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 55℃ annealing for 15 s, and 72℃ extension for 1 min, for 35 cycles; 72℃ extension for 5 min; and storage at 15℃.
[0054] The PCR products were recovered and purified, then ligated into pEASY-Blunt (Beijing TransGen Biotech Co., Ltd.), transformed into E. coli DH5α competent cells (Beijing Tiangen CB101), and positive clones were selected for sequencing.
[0055] Sequencing results showed that GmHDA11 obtained by PCR reaction I The gene fragment has the nucleotide sequence shown in SEQ ID NO. 1 and encodes a protein consisting of 497 amino acid residues (SEQ ID NO. 4).
[0056] Example 2: Obtaining and identifying rooting combinations of soybean GmHDA11 gene overexpression
[0057] I. Construction of GmHDA11 gene overexpression vector
[0058] Using root genomic cDNA from Williams82 seedlings as a template, PCR amplification was performed using primer1 and primer2 to obtain the full-length CDS sequence fragment of the GmHDA11 gene (SEQ ID NO. 1).
[0059] Primer1:5'-ATGCCAGAAAACTGCATAGC-3';
[0060] Primer2: 5'-CTACCTCACTCTCAGTAGTGC-3'.
[0061] The amplified product was ligated into the pBA002 vector by XbaI single enzyme digestion, transformed into E. coli DH5α, and the positive plasmid was extracted and sequenced. The sequencing results showed that a recombinant expression vector containing the sequence shown in SEQ ID NO. 1 was obtained and named pBA002-GmHDA11.
[0062] II. Obtaining Recombinant Agrobacterium
[0063] pBA002-GmHDA11 was transformed into Agrobacterium K599 using the heat shock method to obtain recombinant strains. Plasmids were extracted and identified by PCR and enzyme digestion. The correctly identified recombinant strains were named K5-pBA002-GmHDA11.
[0064] III. Obtaining Transgenic Plants
[0065] The K5-pBA002-GmHDA11 strain was transformed into the soybean variety Williams82. The specific method was as follows:
[0066] (1) Select large, plump, and disease-free mature seeds and wash them with deionized water. Spray clean filter paper with water and place it in a petri dish. Spread the selected soybean seeds evenly on the filter paper and germinate them in the dark at 26°C.
[0067] (2) After the soybean seeds germinate, select those with uniform growth and sow them in a turnover box containing vermiculite. Place them in a 26℃ incubation room for 3-4 days to germinate. When the soybean cotyledons are about to open but have not yet opened (the color is light green and there are lateral roots growing), hairy root infection can be carried out.
[0068] (3) When the seeds germinate for 2-3 days, culture the K5-pBA002-GmHDA11 strain overnight at 28℃ and 200 rpm for about 12 h; inoculate the bacterial solution 1:100 into a new LB medium and culture at 28℃ and 200 rpm with shaking until OD. 600 =0.6-0.8, collect bacterial cells;
[0069] (4) Resuspend the centrifuged cells in an equal volume of prepared and sterilized co-culture medium.
[0070] (5) Select uncontaminated, intact, and undamaged germinated seeds, cut them off at the base with a scalpel, leaving about 2 cm of the hypocotyl, and immerse the soybean hypocotyl in the above-mentioned resuspended bacterial solution for 1 h. Then transplant the infected explants into moist vermiculite and culture them in a 26℃ incubator.
[0071] (6) After one week of cultivation, when white callus tissue grows at the wound of the soybean hypocotyl, it is cultured in 1 / 2 Hoagland nutrient solution. After another week of cultivation, soybean roots grow at the callus tissue, and a soybean plant with transgenic roots is obtained.
[0072] IV. Identification of Transgenic Plants
[0073] 1. PCR molecular identification
[0074] DNA was extracted from the roots of soybean rooting combination plants and used as a template for PCR amplification. The PCR primers are as follows:
[0075] Primer3: 5'-AAGTGGATTGATGTGATATCTCCA-3';
[0076] Primer4: 5'-CAGCACAATGTCATTAACATAGC-3'.
[0077] The primers described above, primer 3 and primer 4, are located in the CDS sequence of the GmHDA11 gene shown in SEQ ID NO. 1.
[0078] The PCR products were detected by 1% agarose gel electrophoresis. The target band could be detected in positive plants, but not in negative plants.
[0079] 2. Detection of GmHDA11 gene expression level
[0080] Root samples were collected from soybean plants of the GmHDA11 rooting combination. After homogenization in liquid nitrogen, RNA was extracted using the TRIzol method. An appropriate amount of RNA was used to obtain cDNA using a transcription kit, which was then used as a template for quantitative RT-PCR detection. An appropriate amount of template cDNA was taken, and soybean GmELF was used as an internal control gene for analysis using Hieff. TM qPCR SYBR ®The Green Master Mix (No RoxPlux) kit was used to detect the expression level of the GmHDA11 gene in a Bio-Rad CFX96 real-time PCR instrument. The sequences of the primers used for quantitative detection of the GmELF gene (primer 5 and primer 6) and the primers used for quantitative detection of the GmHDA11 gene (primer 7 and primer 8) are as follows:
[0081] Primer5:5'-GGCTCAAGCCTCATCCAGTT-3';
[0082] Primer6: 5'-ATGAAGGGAGGGATCTGTTGT-3'.
[0083] Primer7: 5'-ATGGAAAGTGGAGGGAACTC-3';
[0084] Primer8: 5'-GTCATTCGAATCCTATGAGG-3'.
[0085] Relative expression level was 2 -△△CT Quantitative calculations were performed using this method, and the results are shown in Figure 1 (HDA11-OE in Figure 1). The results indicate that the expression level of the transgenic plant is significantly increased.
[0086] Example 3: Salt tolerance identification of rooting combination plants overexpressing GmHDA11 gene
[0087] The successfully identified GmHDA11-OE rooting combination plants were further cultured in 1 / 2 Hoagland nutrient solution until the second and third compound leaves unfolded. Soybean rooting combination plants transfected with pBA002 empty vector were used as controls. Then, soybean rooting combination plants with relatively uniform growth were selected and transferred to 1 / 2 Hoagland nutrient solution and 1 / 2 Hoagland nutrient solution containing 120 mM NaCl for further culture. After 7-10 days of continued growth, the phenotype of soybean rooting combination plants was observed by photographing, and relevant physiological indicators were measured.
[0088] The experimental results in Figure 2 show that, compared with the soybean rooting combination plants transformed with empty vectors, the GmHDA11-OE soybean rooting plants exhibited milder leaf chlorosis and wilting symptoms under salt stress, and the root length and plant height of the plants were significantly higher than those of the control group.
[0089] Therefore, based on these results, it is clear that the GmHDA11 gene plays an important positive regulatory role in soybean salt tolerance, and overexpression of this protein-encoding gene can improve soybean salt tolerance.
[0090] Example 4: Salt tolerance identification of rooting combination plants overexpressing three transcripts of the GmHDA11 gene
[0091] GmHDA11 has three transcripts: the full-length transcript GmHDA11. I Transcript GmHDA11, which has lost exon 6 II Transcripts of exons 5 and 6, GmHDA11 III (Figure 3).
[0092] Using primers 3 and 4, and with cDNA from the leaves of Qiandou 6 and Huachun 2 seedlings as templates, PCR amplification was performed to clone the transcript GmHDA11. I GmHDA11 II and GmHDA11 III .
[0093] To identify the effects of three transcripts on soybean salt tolerance, the target transcript GmHDA11 was obtained. I (Identical to the CDS sequence of gene GmHDA11), GmHDA11 II (SEQ ID No. 2) and GmHDA11 III (SEQ ID No. 3). The overexpression vector GmHDA11 was constructed using the method described in Example 2. I -OE、GmHDA11 II -OE and GmHDA11 III -OE, and GmHDA11 was infected using the soybean root infection method described in Example 2. I -OE conversion of salt-sensitive variety Qiandou 6, using GmHDA11 II -OE and GmHDA11 III -OE conversion of salt-tolerant variety Huachun 3. GmHDA11 was converted according to the method in Example 3. I -OE、GmHDA11 II -OE and GmHDA11 III Transformed plants overexpressing -OE were treated with 120 mM NaCl, and salt stress phenotypes were observed. It was found that the transformation of GmHDA11... I -OE significantly improved the salt tolerance of salt-sensitive varieties, while the conversion of GmHDA11 II -OE and GmHDA11 III -OE salt-tolerant varieties showed significantly reduced salt tolerance compared to wild types (Figure 4). The results indicate that the transcript GmHDA11... I It can significantly improve the salt tolerance of soybeans, while GmHDA11 lacks exons. II and GmHDA11 IIITranscript overexpression makes salt-tolerant soybeans salt-intolerant.
[0094] Example 5: Development and application of molecular markers for identifying GmHDA11 transcripts
[0095] 1. This invention provides molecular markers for identifying the relative amounts of the three GmHDA11 transcripts in soybean materials.
[0096] The upstream primer (primer9) is: AGATGCCTCAACATGAGTATTACG (SEQ ID NO. 7)
[0097] The downstream primer (primer 10) is: CGTGACCTGTGATCAGAAAGCTC (SEQ ID NO. 8)
[0098] The PCR amplification system consisted of: 10 μL of 2×Phanta Max Master Mix, 1 μL of primer 9 (10 μM), 1 μL of primer 10 (10 μM), 1 μL of template cDNA (50 ng / uL), and 7 μL of ddH2O.
[0099] The amplification program for this molecular marker was as follows: performed in a Bio-rad T100 PCR instrument, with pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 s, annealing at 55℃ for 15 s, extension at 72℃ for 1 min, for 27 cycles; extension at 72℃ for 5 min; and storage at 15℃.
[0100] 2. Validation and specific applications of molecular markers
[0101] Using leaf cDNA from seedlings of the salt-tolerant variety Huachun 3 and the salt-sensitive variety Qiandou 6 before and after salt treatment as templates, PCR amplification was performed, revealing that GmHDA11 in Qiandou 6 was... II Transcript expression levels were significantly higher than those of the full-length transcript GmHDA11. I It also contains the transcript GmHDA11 III The bands. However, Huachun 3 only contained the transcript GmHDA11. I and GmHDA11 II Furthermore, there was no significant difference in the content of the two transcripts. This indicates that the relative content of the three transcripts after salt stress affects the salt tolerance of soybean.
[0102] Nineteen salt-tolerant soybean samples and 20 salt-sensitive soybean samples were treated with salt. cDNA from seedling leaves before and after 31 hours of salt treatment was used as a molecular marker for PCR amplification. Some of the varieties used are shown in Table 1, and the results are shown in Figure 5.
[0103] Table 1. Soybean varieties used in the development of the GmHDA11 transcript molecular marker and the number of leaf scorches after salt treatment.
[0104]
[0105] GmHDA11 was found in salt-tolerant soybeans after salt treatment. I Transcript content was significantly higher in salt-sensitive varieties (Figures 5A-E). In salt-sensitive soybean varieties, GmHDA11... II The content of transcripts was significantly higher in salt-tolerant soybeans (Figures 5A-D and F). This molecular marker can effectively distinguish between salt-tolerant and salt-sensitive varieties and can be used for pre-screening of salt tolerance traits in soybeans and for molecular-assisted breeding. Furthermore, in salt-tolerant varieties, the content of GmHDA11 was higher. I Varieties with a content (higher than the average of 0.4246) had a lower 100-seed weight of GmHDA11. I The content of this molecular marker was 19.96% in the highest-yielding varieties (Figure 5G). This molecular marker can effectively distinguish high-yielding varieties among salt-tolerant varieties and can be used for pre-screening and molecular-assisted breeding of salt-tolerant and high-yielding soybeans.
[0106] Example 6, GmHDA11 I Stable transgenic lines: yield per plant and grain size
[0107] GmHDA11 I Two stable transgenic overexpression lines, OE-4 and OE-11, were obtained by introducing the gene into the soybean variety Williams82 (Figure 6). The two overexpression lines and the empty vector-transformed line (WM82) were planted under normal and salt stress conditions. Phenotypic characteristics such as plant height, pod number, yield, and seed size were investigated at the adult stage for both overexpression and control materials. It was found that under control conditions and salt stress, overexpression of GmHDA11 was more effective. I All of these significantly increased soybean plant height, pod number, seed size, and yield per plant (Figure 7). This indicates that the GmHDA11 gene plays an important role in soybean salt tolerance and high yield, and can be used for breeding salt-tolerant and high-yielding soybeans.
Claims
1. Gene GmHDA11 I The sequence is shown in SEQ ID No.
1.
2. The protein GmHDA11 as described in claim 1 I The encoded protein, the sequence of which is shown in SEQ ID No.
4.
3. A gene comprising the GmHDA11 described in claim 1 I Recombinant expression vectors, expression cassettes, or recombinant bacteria.
4. The gene GmHDA11 shown in SEQ ID No. 1 I Or may contain the gene GmHDA11 I Application of recombinant expression vectors, expression cassettes, or recombinant bacteria in improving soybean salt tolerance and / or yield.
5. The application according to claim 4, characterized in that, Overexpression of the gene GmHDA11 shown in SEQ ID No. 1 I This improves the salt tolerance of soybeans.
6. The application according to claim 5, characterized in that, The recombinant expression vector, expression cassette, or recombinant bacteria described in claim 3 are introduced into soybean to overexpress the gene GmHDA11 shown in SEQ ID No.
1. I .
7. A method for improving the salt tolerance and / or yield of soybeans, characterized in that, The method described is to overexpress the gene GmHDA11 shown in SEQ ID No. 1 in soybean plants. I This improves the salt tolerance and / or yield of soybeans.
8. Application of substances detecting different transcriptomic contents of GmHDA11 in one or more of the following A1-A4: A1: Identification or auxiliary identification of salt-tolerant soybean varieties and soybean materials, when GmHDA11 I The content of GmHDA11 is higher than or equal to the content of the other two transcripts, indicating a salt-tolerant variety. II or GmHDA11 III The content is higher than that of GmHDA11 I At that time, it was a salt-sensitive variety; A2: preparation of reagents for identification or auxiliary identification of salt-tolerant soybean varieties; A3: soybean breeding or auxiliary soybean breeding; A4: preparation of soybean breeding reagents or auxiliary soybean breeding reagents; the different transcripts of GmHDA11 are the gene GmHDA11 shown in SEQ ID No.
1. I The gene GmHDA11 shown in SEQ ID No. 2 II The gene GmHDA11 shown in SEQ ID No. 3 III .
9. The application as described in claim 8, characterized in that, The substance for detecting the content of different transcripts of GmHDA11 includes: a set of primers, wherein the set of primers consists of single-stranded DNA molecules or derivatives thereof shown in SEQ ID NO. 7 and single-stranded DNA molecules or derivatives thereof shown in SEQ ID NO.
8.
10. The application as described in claim 9, characterized in that, The substance used to detect the content of different transcripts of GmHDA11 is a PCR reagent containing the complete set of primers, or a PCR reagent kit containing the complete set of primers.