Research on mechanism of optical signal regulation and control of red bayberry fruit anthocyanin synthesis and application thereof

Abstract

The invention provides research on a mechanism for regulating red bayberry fruit anthocyanin synthesis through optical signals and application of the mechanism. By treating Dongkui waxberries with different light-transmitting bags, the quality characteristics of mature fruits are analyzed, and comprehensive analysis is performed in combination with transcriptome and metabolome. The result shows that the bagging in the young fruit period significantly reduces the fruit quality, the black light-proof bag inhibits the fruit color change and anthocyanin synthesis, and the bagging influence in the color change period is small. Metabolome and transcriptome analysis shows that differential metabolites are enriched in anthocyanin synthesis and flavonoid metabolic pathways, related differential metabolites are identified, and core regulation transcription factors HY5 and DF1 participate in the photoregulation anthocyanin accumulation process. According to the invention, an optical signal regulation and control mechanism is defined, related factors and metabolites are identified, and a basis is provided for quality improvement and cultivation technology optimization of waxberries.

Description

Technical Field

[0001] This invention belongs to the field of plant cultivation and fruit quality regulation technology. Specifically, it relates to the study and application of a mechanism for regulating anthocyanin synthesis in bayberry fruit by light signal. Background Technology

[0002] The Chinese bayberry (Myrica rubra cv. DongKui Orient Pearl) is a fruit with extremely high economic and nutritional value, rich in anthocyanins that promote health. Sunlight is one of the most important environmental factors affecting fruit color, and the anthocyanin synthesis process during the ripening of the bayberry fruit is significantly regulated by sunlight. The Chinese bayberry (Myrica rubra cv. DongKui Orient Pearl) is a subtropical evergreen fruit tree belonging to the Myricaceae family and the Myrica genus. It is mainly distributed in southern China and other Asian countries. Its fruit is highly sought after for its unique flavor and nutritional value, possessing extremely high economic value (Zhang et al., 2024). It is rich in anthocyanins and other flavonoids, which, as important secondary metabolites in plants, not only regulate the plant's physiological functions in resisting ultraviolet radiation, high temperatures, and drought, but also provide humans with abundant nutritional and medicinal resources, helping to prevent various diseases (Tsuda et al., 2012). With the increasing demand for healthy foods from consumers, research on anthocyanins in the Chinese bayberry fruit is particularly important.

[0003] The color changes in bayberry fruit are mainly caused by changes in anthocyanin content, which is the most intuitive marker of ripening. Behind this change lies a complex pigment metabolism pathway and a delicate regulatory network. Previous studies have shown that the biosynthesis of anthocyanins is catalyzed stepwise by chalcone synthase (CHS), chalcone isomerase (CHI), flavonoid-3-hydroxylase (F3H), dihydroflavonol 4-reductase (DFR), and anthocyanin synthase (ANS), and is regulated by multiple transcription factors (Tsuda et al., 2012). R2R3-MYB, bHLH, and WDR transcription factors regulate anthocyanin synthesis through multiple pathways, among which genes such as MYB1, MYB2, MYB10, MYB90, and MYB113 play a central role in anthocyanin biosynthesis (Cui et al., 2023; Lim et al., 2016; Zhang et al., 2024; Sun et al., 2021; Liu et al., 2024).

[0004] Light signals play a crucial role in plant growth and development, especially during fruit ripening. Previous studies have shown that anthocyanin biosynthesis in eggplant pericarp is entirely dependent on light; under dark conditions, no anthocyanin accumulates in the pericarp. It has been discovered that the blue light receptors CRY1 / CRY2 interact with COP1, regulating the binding of the MYB1 transcription factor to downstream anthocyanin synthesis genes (CHS and DFR), thereby affecting the anthocyanin synthesis pathway in the fruit (Jiang et al., 2016). In kale, the light signaling factor BoMYB1R1 directly inhibits the promoter activity of the BoMYB4b gene, and its expression level is significantly downregulated by strong light signals (Liu et al., 2024). In reports on anthocyanin synthesis in tea plants, CsbHLH89 can bind to the G-box elements of the promoters of CsCHS, CsFLS, and CsDFR, positively regulating anthocyanin synthesis in tea plants. The phototransduction factor CsHY5 can bind to the promoter of CsbHLH89, indirectly promoting anthocyanin accumulation (Zhang et al., 2023).

[0005] Therefore, light signals activate a series of signal transduction pathways through the action of various photoreceptors, thereby affecting the biosynthesis and distribution of pigments. Although there are studies on the regulation of anthocyanin synthesis by light signals in other plants, the direct accumulation of substances and regulatory mechanisms among different species are significantly different. In the fruit of the Chinese bayberry, the pathway of anthocyanin accumulation is still unclear, and the mechanism by which light signals regulate anthocyanin synthesis remains ambiguous.

[0006] Therefore, it is urgent to explore the mechanism by which light signals regulate anthocyanin synthesis in bayberry fruit, investigate the effects of bagging and light treatment on pigment deposition in bayberry fruit, analyze their role in fruit ripening, color formation, and quality improvement, and use combined transcriptomics and metabolomics analysis to uncover the pathway by which light signals finely regulate anthocyanin synthesis in bayberry fruit, revealing their mechanism of action in fruit ripening, and providing a solid scientific foundation for improving the quality of bayberry fruit and optimizing facility cultivation techniques. Summary of the Invention

[0007] To address the problems existing in the prior art, this invention provides a study on the mechanism of light signal regulation of anthocyanin synthesis in bayberry fruit and its application. Through different light-transmitting bag treatments on Dongkui bayberries, combined with comprehensive analysis of transcriptomics and metabolomics, the regulatory mechanism of light signal on anthocyanin synthesis in bayberry fruit was revealed: light affects gene expression and metabolite accumulation, and related genes and metabolites are mainly enriched in specific pathways. HY5 and DF1 are identified as the core transcription factors in the light-regulated anthocyanin synthesis process of bayberry fruit. It was clarified that bagging during the young fruit stage reduces quality and inhibits color change and anthocyanin synthesis, while bagging during the color change period has little effect. Furthermore, the high content of some metabolites under white light-transmitting bag (WQ) treatment is related to the red color of the fruit. This provides a basis for improving the quality of bayberry fruit and optimizing cultivation techniques.

[0008] To achieve the above objectives, the present invention employs the following solution:

[0009] On the one hand, the present invention provides a method for regulating the anthocyanin content in bayberry fruit. In the method, the anthocyanin content in bayberry fruit is regulated by regulating the expression of the transcription factor HY5 gene or regulating the activity of the transcription factor HY5 protein. The nucleotide sequence of the HY5 gene is shown in SEQ ID NO.1, and the amino acid sequence of the HY5 protein is shown in SEQ ID NO.2.

[0010] Furthermore, by regulating the intensity of light signals, the expression of the transcription factor HY5 gene or the activity of the transcription factor HY5 protein can be regulated, thereby controlling the anthocyanin content in bayberry fruit.

[0011] Light signals play a crucial role in fruit growth, development, and quality formation, but the role of light in regulating the development of bayberry fruit remains unclear. The function of bagging, a common technique in horticultural cultivation, in the ripening process of bayberry fruit has not been previously elucidated.

[0012] Therefore, this invention employs different light-transmitting bagging treatments to study the effects of light quality on the ripening process of bayberry at the metabolic and molecular levels. In some embodiments, it was found that bagging significantly reduced the quality of bayberry fruit. Specifically, black opaque bagging during the young fruit stage inhibited color change during fruit development, resulting in a lack of pigmentation. However, black opaque bagging during the color-changing period did not affect fruit color change, indicating that the accumulation of color-changing substances in the fruit is completed before the color-changing period, and the conversion from colorless substances to colored anthocyanins during color change is not dependent on light. During bayberry fruit development, the color accumulation pattern may be related to light-mediated anthocyanin synthesis.

[0013] Anthocyanins are naturally occurring anthocyanins that accumulate in photogrowth plants. In dark environments, the ubiquitin ligase of the photomorphogenesis gene 1 / repressor PHYA-105 (COP1 / SPA) inhibits anthocyanin accumulation. Therefore, COP1 and SPA mutants also produce anthocyanins in the dark. Furthermore, anthocyanin biosynthesis relies on the stabilization of light-mediated PAP1 (Protection of Anthocyanin Pigment 1) and PAP2. Thus, COP1 can act as a switch in light signal transduction, interacting with upstream photoreceptors and downstream target proteins.

[0014] Furthermore, the intensity of the optical signal is adjusted by bagging.

[0015] In some implementations, experiments were conducted with different light-transmitting bagging treatments, along with transcriptomic and metabolomic analyses. The results showed that bagging significantly affected fruit quality and anthocyanin synthesis. Specifically, black, opaque bagging during the young fruit stage inhibited color change and anthocyanin synthesis, while bagging during the color-changing period had little effect on color change, and the accumulation of color-changing substances was completed before the color-changing period. Anthocyanin conversion during color change was independent of light. Furthermore, it was found that light regulates anthocyanin synthesis by influencing gene expression and metabolite accumulation. The core transcription factor HY5 participates in this process and is positively correlated with anthocyanin content and the expression of gene synthesis genes, while the core transcription factor DF1 participates in this process and is negatively correlated with anthocyanin content and the expression of gene synthesis genes. Therefore, regulating the expression or activity of HY5 and DF1 can regulate anthocyanin content.

[0016] Furthermore, by increasing the intensity of light signals, the expression of the transcription factor HY5 gene is increased or the activity of the transcription factor HY5 protein is enhanced, thereby increasing the anthocyanin content in bayberry fruit.

[0017] In some implementations, the intensity of light is controlled by different light-transmitting bag treatments to explore the regulation of anthocyanin synthesis.

[0018] Furthermore, through genetic engineering, the expression of transcription factor HY5-related genes, or the activity of transcription factor HY5 protein, can be regulated, thereby controlling the anthocyanin content in bayberry fruit.

[0019] Furthermore, in the method, the anthocyanin content in bayberry fruit can be regulated by regulating the expression of the transcription factor DF1 gene or the activity of the transcription factor DF1 protein; the nucleotide sequence of the DF1 gene is shown in SEQ ID NO.3, and the amino acid sequence of the DF1 protein is shown in SEQ ID NO.4.

[0020] Furthermore, by regulating the intensity of light signals, the expression of the transcription factor DF1 gene or the activity of the transcription factor DF1 protein can be regulated, thereby controlling the anthocyanin content in bayberry fruit.

[0021] Furthermore, by increasing the intensity of light signals, the expression of the transcription factor DF1 gene or the activity of the transcription factor DF1 protein can be reduced, thereby increasing the anthocyanin content in bayberry fruit.

[0022] Furthermore, through genetic engineering, the expression of transcription factor DF1-related genes or the activity of transcription factor DF1 protein are regulated, thereby controlling the anthocyanin content in bayberry fruit.

[0023] On the other hand, the present invention provides the use of transcription factor HY5 in the preparation of a formulation to enhance anthocyanin synthesis in bayberry fruit. The transcription factor HY5, as the active ingredient of the formulation, participates in regulating the anthocyanin synthesis process in bayberry fruit and is positively correlated with anthocyanin content and anthocyanin biosynthesis gene expression.

[0024] Furthermore, in the bayberry fruit, the anthocyanin synthesis gene includes any one or more of the following: chalcone synthase gene, flavonol synthase gene, and colorless anthocyanin plus dioxygenase gene, and the transcription factor HY5 is positively correlated with the expression of the gene.

[0025] In some implementations, experiments showed that light treatment significantly affected anthocyanin accumulation in fruit by regulating chalcone synthase (CHS), flavonol synthase (F3'H), and colorless anthocyanin plus dioxygenase (LDOX) genes. However, darkness treatment during the anthocyanin accumulation period did not affect the final anthocyanin content, indicating that the regulation of anthocyanin accumulation in bayberry fruit by light is not continuous but plays a role at specific times. Combined analysis of the transcriptome and metabolome revealed that transcription factor HY5 is a core regulatory gene in the regulatory network, potentially acting as a switch for light signal transduction and interacting with downstream target proteins.

[0026] In some embodiments, combined analysis revealed that transcription factors HY5 and ERF098 were positively correlated with anthocyanin content and anthocyanin biosynthesis gene expression, indicating that HY5 may synergistically promote anthocyanin synthesis with other transcription factors and genes. In bayberry fruit, transcription factor HY5 promotes anthocyanin synthesis through interaction with or regulation of the expression of anthocyanin biosynthesis-related genes (such as chalcone synthase gene, flavonol synthase gene, and colorless anthocyanin dioxygenase gene).

[0027] In WQ (white translucent bag) packaging, the fruit receives less light, and the expression level of flavonoid synthesis genes is significantly lower than in HQ packaging. However, the high expression level of the anthocyanin biosynthesis gene (LDOX) may be an important reason for maintaining the color of the bayberry fruit. Under these conditions, the expression level of the HY5 gene may be suppressed, thereby affecting its regulatory role on anthocyanin synthesis-related genes and leading to changes in gene expression patterns.

[0028] In some implementations, during HQ (black opaque bag) treatment, the fruit receives relatively ample light, leading to a significant increase in the expression levels of genes such as chalcone synthase (CHS) and flavonol synthase (F3'H), and a significant decrease in the expression level of the colorless anthocyanin plus dioxygenase gene (LDOX), consistent with the decrease in total anthocyanin content. In this case, HY5 may act as a regulatory factor, influencing the expression changes of these genes through interactions with other proteins and the regulation of gene expression, thereby affecting anthocyanin synthesis.

[0029] HY5 is a bZIP protein involved in photomorphogenesis and the regulation of growth and development. It interacts with COP1 through the BRLZ and WD40 domains of SmHY5. Experiments using different light-transmitting bagging methods in this invention showed that black bags, which deprived the fruit of light, reduced HY5 gene expression to almost zero. The HY5 transcription factor can also regulate anthocyanin accumulation in fruit through multiple pathways. Under low-light conditions, photoinhibition of SmCOP1 ubiquitination leads to the release of SmMYB5. The SmJAZ5 / 10 protein downregulates the gene expression levels of SmF3H and SmANS by interfering with the stability and transcriptional activation activity of the SmMYB5-SmTT8 complex, thereby preventing anthocyanin synthesis. Therefore, HY5 may directly or indirectly act as a light signaling receptor to regulate anthocyanin synthesis.

[0030] Furthermore, the formulation affects the activity of transcription factor HY5 by regulating the expression of genes related to the light signal transduction pathway in bayberry fruit, thereby regulating anthocyanin synthesis.

[0031] Furthermore, the light signal transduction pathway-related genes in the bayberry fruit include any one or more of photoreceptor genes and COP1 genes. Transcription factor HY5, as a downstream receptor of the related genes in the light signal transduction pathway, regulates anthocyanin synthesis by interacting with the COP1 gene and regulating anthocyanin synthesis genes.

[0032] In some implementations, experimental results showed that changes in HY5 gene expression directly affect its regulatory capacity on anthocyanin synthesis-related genes. Increased HY5 expression may more effectively promote the expression of anthocyanin synthesis-related genes, thereby increasing anthocyanin synthesis; conversely, decreased HY5 expression weakens its regulatory effect on anthocyanin synthesis-related genes, potentially inhibiting anthocyanin synthesis. Furthermore, a positive correlation between HY5 and anthocyanin content indicates that it plays a crucial positive regulatory role in anthocyanin synthesis.

[0033] Therefore, this invention reveals the precise regulatory mechanism of light signals on anthocyanin synthesis in bayberry fruit. First, the light signal is sensed and received by photoreceptors in plant cells (possibly including blue light receptors CRY1 / CRY2, etc.), and then transmitted into the cell through a series of complex signal transduction pathways.

[0034] In terms of gene expression regulation, light signals significantly affect genes related to anthocyanin synthesis. For example, under HQ (black opaque bag) treatment, the expression of chalcone synthase (CHS) and flavonol synthase (F3'H) genes increased, while the expression of colorless anthocyanin dioxygenase (LDOX) decreased; the opposite trend was observed in WQ (white opaque bag). The core transcription factor HY5 plays a crucial role in this process. It synergistically regulates anthocyanin content and the expression of synthesis genes with ERF098, while showing a negative correlation with the core transcription factor DF1, forming a complex transcriptional regulatory network. As a bZIP protein involved in photomorphogenesis and regulating growth and development, HY5 interacts with COP1 through its BRLZ and WD40 domains, affecting its own activity and function, thereby regulating anthocyanin synthesis. Transcriptome analysis also showed that differentially expressed genes were mainly enriched in the phenylpropane synthesis pathway, the MAPK signaling pathway, and the flavonoid metabolism pathway, with genes in these pathways cooperating in regulation.

[0035] Regarding the regulation of metabolite accumulation, based on metabolomics analysis, differentially expressed metabolites under different light-transmitting bag treatments were mainly enriched in signal transduction pathways, phenylpropanoid pathways, and carbon metabolism-related pathways. For example, under WQ treatment, the contents of proanthocyanidins (B2, B3, B4), pelargonidin glucoside, and paeoniflorin glucoside significantly increased, which may be the main reason for the red pigmentation in bayberry fruit. There are interconversion and regulatory relationships among metabolites; some metabolites can participate in anthocyanin synthesis as precursors or affect gene expression through feedback regulation mechanisms, thereby influencing anthocyanin synthesis.

[0036] The regulatory effect of light signals varies at different fruit development stages. Bagging during the young fruit stage (especially using black opaque bags) significantly inhibits the regulatory effect of light signals on anthocyanin synthesis-related genes and metabolites, leading to a decline in fruit quality, reduced contents of sucrose, glucose, fructose, malic acid, oxalic acid, total phenols, total flavonoids, vitamin C, and total anthocyanins, increased citric acid content, altered expression of anthocyanin synthesis-related genes, and impaired anthocyanin accumulation. However, bagging during the color-changing stage has little impact on fruit color change and quality, indicating that color-changing substances accumulate before color change, and the conversion from colorless substances to colored anthocyanins during color change is not dependent on light.

[0037] In another aspect, the present invention provides the use of transcription factor DF1 in preparing a formulation to enhance anthocyanin synthesis in bayberry fruit. The transcription factor DF1, as an active ingredient in the formulation, participates in regulating the anthocyanin synthesis process in bayberry fruit and is negatively correlated with anthocyanin content and anthocyanin biosynthesis gene expression.

[0038] In some implementations, overexpression vector construction and its effects on tomato fruits were verified. DF1 and HY5 overexpression vectors were constructed and injected into tomato fruits via Agrobacterium suspension for transient overexpression. An empty vector group and a blank control group were also included. Fruits were collected at maturity to detect relevant indicators. The expression levels of anthocyanin synthesis-related genes and the DF1 and HY5 genes themselves were analyzed using qRT-PCR.

[0039] The results showed that for HY5, qRT-PCR analysis revealed a significant increase in total anthocyanin content in tomato fruits and a significant increase in the expression levels of anthocyanin synthesis-related genes in the HY5 overexpression vector group, while the expression level of the HY5 gene itself was also significantly increased. This indicates that HY5 overexpression promotes anthocyanin synthesis, further validating the positive correlation between HY5 and total anthocyanin content and anthocyanin biosynthesis gene expression. For DF1, qRT-PCR analysis showed a significant decrease in total anthocyanin content in tomato fruits and a significant decrease in the expression levels of anthocyanin synthesis-related genes in the DF1 overexpression vector group, while the expression level of the DF1 gene itself was significantly increased. This indicates that DF1 overexpression inhibits anthocyanin synthesis, further validating the negative correlation between DF1 and total anthocyanin content and anthocyanin biosynthesis gene expression. Furthermore, while interfering with DF1 expression could increase anthocyanin content and related gene expression levels to some extent, the effect was not as significant as HY5 overexpression.

[0040] In the study of anthocyanin synthesis in bayberry fruit, due to current technological limitations, direct gene editing of bayberry is not possible. However, considering the potential similarities in gene regulatory mechanisms among different plants, this embodiment selected to conduct heterologous experiments on tomatoes. The experimental results are consistent with theoretical predictions made in bayberry fruit, providing important evidence for further understanding the regulatory mechanism of anthocyanin synthesis in bayberry fruit. Although direct gene editing experiments on bayberry are currently not possible, these heterologous experimental results indicate that DF1 and HY5 may have similar regulatory roles in the anthocyanin synthesis process of bayberry fruit, providing potential targets and methods for regulating bayberry fruit quality through genetic engineering. Further verification on bayberry can be conducted when the technology matures.

[0041] Furthermore, the formulation affects the activity of transcription factor DF1 by regulating the expression of genes related to the light signal transduction pathway in bayberry fruit, thereby regulating anthocyanin synthesis.

[0042] Furthermore, the light signal transduction pathway-related genes in the bayberry fruit include any one or more of photoreceptor genes and COP1 genes. Transcription factor DF1, as a downstream receptor of the related genes in the light signal transduction pathway, regulates anthocyanin synthesis by interacting with the COP1 gene and regulating anthocyanin synthesis genes.

[0043] The beneficial effects of this invention are as follows:

[0044] 1. This invention provides a study on the mechanism of light-induced regulation of anthocyanin synthesis in bayberry fruit and its application. It reveals the regulatory mechanism of light on anthocyanin synthesis in bayberry fruit, including the influence of light on gene expression and metabolite accumulation. Related genes and metabolites are mainly enriched in specific pathways, such as differentially expressed genes in the transcriptome enriched in the phenylpropanoid synthesis pathway, the MAPK signaling pathway, and the flavonoid metabolism pathway, and differentially expressed metabolites in the metabolome enriched in signal transduction pathways, phenylpropanoid pathways, and carbon metabolism-related pathways. Simultaneously, the key roles of core transcription factors HY5 and DF1 in the light-regulated anthocyanin synthesis process of bayberry fruit were identified. HY5 was positively correlated with total anthocyanin content and anthocyanin biosynthesis gene expression, while DF1 was negatively correlated with total anthocyanin content and anthocyanin biosynthesis gene expression, potentially acting as a switch for light signal transduction and interacting with downstream target proteins.

[0045] 2. This invention provides a study on the mechanism of light signal regulation of anthocyanin synthesis in bayberry fruit and its application. It clarifies the effects of different light-transmitting bag treatments on fruit quality and anthocyanin synthesis. Bagging during the young fruit stage significantly reduces fruit quality, inhibits fruit color change and anthocyanin synthesis, and reduces the content of sucrose, glucose, fructose, malic acid, oxalic acid, total phenols, total flavonoids, vitamin C, and total anthocyanins in the fruit, while increasing citric acid content. Bagging during the color change stage has no significant effect on fruit color change and quality. It was also found that the content of some metabolites (such as proanthocyanidins (PAs), pelargonidin glucoside, and peonidin glucoside) was higher under white light-transmitting bag treatment (WQ) than under black opaque bag treatment (HQ), which may be the reason for red pigment deposition in bayberry fruit.

[0046] 3. The core regulatory transcription factors HY5 and DF1, as well as related differential metabolites identified in this invention, provide targets for subsequent regulation of bayberry fruit quality through genetic engineering or cultivation measures. They also provide a theoretical basis for improving bayberry fruit quality and optimizing facility cultivation techniques, which helps to enhance the economic value and market competitiveness of bayberry fruit. Attached Figure Description

[0047] Figure 1 A is a comparison of the effects of different light-transmitting bag treatments on the color of Chinese bayberry fruit at maturity.

[0048] Figure 1B is a bar chart showing the effect of different light-transmitting bag treatments on the color of Chinese bayberry fruit at maturity.

[0049] Figure 1 C is a bar chart showing the effect of different light-transmitting bag treatments on the brightness of Chinese bayberry fruit at maturity.

[0050] Figure 2 A represents the effect of using different transparent bags on the total sugar content of Chinese bayberry; error bars represent the standard error of three biological replicates (n=3); different letters indicate statistically significant differences in one-way ANOVA (p<0.05).

[0051] Figure 2 B represents the effect of using different transparent bags to cover Chinese bayberries on the total flavonoid and anthocyanin content.

[0052] Figure 2 C represents the effect of using different transparent bags to cover Chinese bayberries on the total acid content.

[0053] Figure 2 D represents the effect of using different transparent bags to cover Chinese bayberries on the content of sucrose, glucose, and fructose.

[0054] Figure 2 E represents the effect of using different transparent bags to cover Chinese bayberries on the vitamin E content.

[0055] Figure 2 F represents the effect of using different transparent bags to cover Chinese bayberries on the content of malic acid, citric acid, and oxalic acid.

[0056] Figure 3A Principal component analysis plot for transcriptome analysis of waxberries grown using two different bagging methods (HQ and WQ).

[0057] Figure 3B This is a diagram showing the differential gene changes in the transcriptome of bayberries grown using two different bagging methods (HQ and WQ).

[0058] Figure 3C This is a KEGG enrichment analysis diagram of the transcriptome of bayberries grown using two different bagging methods (HQ and WQ).

[0059] Figure 3D Results of co-expressed gene counts for two different bagging methods (HQ and WQ) of waxberries.

[0060] Figure 4A Principal component analysis plots for metabolomics analysis of bayberries grown using two different bagging methods (HQ and WQ).

[0061] Figure 4B A differential gene volcano plot for metabolomics analysis of waxberries grown using two different bagging methods (HQ and WQ).

[0062] Figure 4C Figure showing the enrichment results of differential metabolites in bayberries grown under two different bagging conditions (HQ and WQ).

[0063] Figure 5 This describes the expression pattern of genes involved in anthocyanin biosynthesis.

[0064] Figure 6 A represents the relative expression of the NEC gene under two different bagging conditions.

[0065] Figure 6 B represents the relative expression of the PGIP gene under two different bagging conditions.

[0066] Figure 6 C represents the relative expression of the G-1,3-β-glucosidase gene under two different bagging conditions.

[0067] Figure 6 D represents the relative expression of MYB-like genes under two different bagging conditions.

[0068] Figure 6 E represents the relative expression of the CYP82D47 gene under two different bagging conditions.

[0069] Figure 6 F represents the relative expression of the CYP73A100 gene under two different bagging conditions.

[0070] Figure 6 G represents the relative expression of the CYP89A2 gene under two different bagging conditions; Figure 6 H represents the relative expression of the ERF098 gene under two different bagging conditions.

[0071] Figure 6 I represents the relative expression of the MYB30 gene under two different bagging conditions.

[0072] Figure 6 J represents the relative expression of the HY5 gene under two different bagging conditions.

[0073] Figure 6 K represents the relative expression of the flavonol synthase (F3'H) gene under two different bagging conditions.

[0074] Figure 6 L represents the relative expression of the colorless anthocyanin plus dioxygenase gene (LDOX) under two different bagging conditions;

[0075] Figure 7A A visualization heatmap of anthocyanins in bayberry fruits treated with different transmittance levels. Metabolite content is expressed as peak area.

[0076] Figure 7B To investigate the differences in anthocyanin content in bayberry fruits treated with different bagging methods.

[0077] Figure 8A This describes the expression pattern of genes involved in anthocyanin biosynthesis.

[0078] Figure 8B This represents the regulatory network of different transcription factors and genes involved in anthocyanin biosynthesis.

[0079] Figure 9 Phylogenetic analysis of HY5 in different plants. Detailed Implementation

[0080] The present invention will be further described in detail below with reference to the embodiments. It should be noted that the embodiments described below are intended to facilitate the understanding of the present invention and do not limit it in any way.

[0081] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0082] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0083] In this invention, IBM SPSS statistical software was used for statistical difference analysis, and graphs were generated using Prism 9.0.

[0084] Example 1: Effects of bagging treatments with different light transmittance on color and quality during fruit ripening.

[0085] I. Plant Materials and Experimental Treatment

[0086] The experimental material was the 'Dongkui' variety of bayberry. Bayberry trees of the same age and under the same growing conditions were selected and cultivated under identical management conditions. During the young fruit (green fruit) stage, the fruit was treated with white translucent bags (WQ), black opaque bags (HQ), and no bags (CK), with the CK group serving as the control. During the fruit ripening stage (also known as the color-changing stage), the fruit was treated with black opaque bags (HZQ). Fruits of uniform size were harvested at maturity. Each replicate consisted of 15 fruits, and three biological replicates were used for each sample point of each treatment. Transcriptome and metabolome sequencing samples were frozen in liquid nitrogen and stored at -80°C for further analysis.

[0087] After harvesting the bayberry fruits, the transverse and longitudinal diameters of the fruits were measured using vernier calipers; the weight of a single fruit was determined using an analytical balance; the soluble solids content of the fruits was determined using a PR-101 digital refractometer; and the color of the fruits was measured using a CR-10 handheld colorimeter (Konica Minolta Holdings, Inc., Japan), recording the brightness (L*), red-green value (a*), and blue-green value (b*). Five biological replicates were set up for each experiment, with 10 fruits per replicate. Simultaneously, the soluble sugar content, organic acid and vitamin C content, anthocyanin content, and total phenolic content of the bayberry fruits under different treatments were determined. The specific determination methods are as follows:

[0088] 1. Determination of soluble sugars in bayberry fruit

[0089] The soluble sugar components of bayberry fruit were determined by HPLC. 0.1 g of ground bayberry fruit sample was weighed and dissolved in 5 mL of extraction buffer (ethanol:water = 50:50). The mixture was then heated in a water bath at 80℃ for 30 minutes, centrifuged at 4500×g for 15 minutes, and the extraction was repeated three times. The extracts were combined and analyzed using a high-performance liquid chromatograph (Agilent 1100, USA).

[0090] 2. Determination of organic acid and vitamin C content in bayberry fruit

[0091] The contents of organic acids and vitamin C were determined by HPLC. 1 g of ground bayberry fruit sample was weighed, dissolved in 5 mL of extraction solution (dipotassium hydrogen phosphate), ultrasonically extracted for 30 min, centrifuged at 4500×g for 15 min, and detected by high performance liquid chromatography (Agilent 1100, USA).

[0092] 3. Determination of anthocyanin content in bayberry fruit

[0093] After grinding the sample with liquid nitrogen, weigh approximately 0.1 g of the sample and add 1 mL of extraction buffer (concentrated HCl: 80% ethanol solution = 3:97, v / v). Homogenize thoroughly, cover tightly, and extract ultrasonically for 30 min. Centrifuge at 8000 g for 10 min at room temperature, and bring the extract to a final volume of 0.5 mL. Maximum absorption wavelength determination: Take two 0.04 mL aliquots of the supernatant. Add 0.16 mL of potassium chloride buffer (0.025 mol / L, pH 1.0) to one aliquot and 0.16 mL of sodium acetate buffer (0.4 mol / L, pH 4.5) to the other. Let stand for 10 min, and perform a full wavelength scan between 400 nm and 700 nm to determine the maximum absorption wavelength (Amax = 520 nm). Take two 0.04 mL aliquots of the supernatant, add 0.16 mL of potassium chloride buffer and sodium acetate buffer respectively, mix well, let stand for 10 min, and measure the absorbance at 520 nm and 700 nm. ΔA=pH1.0(A520-A700)-pH4.5(A520-A700).

[0094] 4. Determination of total phenolic content in bayberry fruit

[0095] After grinding the sample with liquid nitrogen, weigh approximately 0.1 g of the sample and add 0.5 mL of 60% ethanol extraction solution. Extract by sonication at 60°C for 30 min, then centrifuge at 12000 rpm and 25°C for 10 min. Collect the supernatant for analysis. Take 10 μL of reagent, mix well, and let stand at room temperature for 2 min. Add 50 μL of 12% supernatant, 50 μL of Folin-Ciocalteu % Na₂CO₃ solution, and 90 μL of distilled water. Mix well, let stand at room temperature for 10 min, and measure the absorbance at 760 nm.

[0096] II. Experimental Results

[0097] Figure 1 Figure A shows a comparison of the effects of different light-transmitting bag treatments on the color of ripe Chinese bayberry. Figure 1 B is a bar chart showing the effect of different light-transmitting bag treatments on the fruit color of Chinese bayberry at maturity. Figure 1 C is a bar chart showing the effect of different light-transmitting bag treatments on the brightness of ripe Chinese bayberry. Error bars represent the standard error of three biological replicates (n=3), and different letters indicate statistically significant differences in one-way ANOVA (p<0.05). Figure 1 A- Figure 1As shown in C, the color (a* / b*) indicates the degree of red coloring of the fruit. Compared with the unbagging treatment (CK), the white transparent bag treatment in the young stage (WQ) and the black opaque bag treatment in the color-changing stage (HZQ) had no significant effect on the red color (a* / b*) of the bayberry fruit, but the color intensity was significantly increased. Under the black opaque bag treatment in the young stage (HQ), the pigment deposition in the mature bayberry fruit was significantly reduced, the (a* / b*) value was significantly reduced, and the color intensity was higher than other treatments.

[0098] To further understand the effects of bagging and light exposure on the commercial characteristics of bayberries, this example also measured the quality indicators of mature fruits. The results showed that, compared with the unbagged treatment (CK), bagging during the young fruit stage (WQ and HQ groups) had a significant impact on fruit quality, particularly on total sugar content. Figure 2 A) Sucrose ( Figure 2 D) Glucose ( Figure 2 D), Fructose ( Figure 2 The content of D) decreased, and the total acid ( Figure 2 C), malic acid ( Figure 2 F), Increased oxalate ( Figure 2 F), while bagging during the color-changing period (HZQ group) had an effect on the total sugar content of the fruit (F). Figure 2 A) and total acid ( Figure 2 The content of C) had no significant effect; compared with the white transparent bag (WQ) bagging treatment, the black opaque bag (HQ) treatment only slightly reduced the sugar and acid content in the fruit. Figure 2 A, Figure 2 C); It is worth noting that bagging treatments (WQ, HQ, and HZQ groups) all significantly reduced the vitamin C content in the fruit. Figure 2 E), especially the black opaque treatment (HQ). It is inferred that the period before fruit color change is an important period for the accumulation of sugar and acid substances, while the period after color change is the period for the conversion of sugar and acid and the synthesis of vitamin C in the fruit. Therefore, bagging treatment during the young fruit stage seriously affects the accumulation of photosynthetic products in the fruit, while bagging during the period from color change to maturity only affects the synthesis of vitamin C and the interconversion of sugar and acid in the fruit.

[0099] At the same time, from Figure 2As shown in section B, compared with the unbagging treatment (CK), the bagging treatments (WQ, HQ, and HZQ groups) significantly reduced the total flavonoid content in the fruit. Compared with the unbagging treatment (CK), the anthocyanin content in the WQ group remained basically unchanged, while the anthocyanin content in the HQ and HZQ groups was significantly reduced, especially in the black opaque treatment (HQ). Therefore, it can be concluded that bagging, especially the black opaque treatment, has an inhibitory effect on the synthesis of flavonoids and anthocyanins in the fruit. Bagging during the young fruit stage (WQ and HQ groups) may affect the expression of genes related to flavonoid and anthocyanin synthesis and the accumulation of metabolites by reducing light exposure, thereby leading to a decrease in the total flavonoid and anthocyanin content in the fruit. Bagging during the color-changing period (HZQ group) had no significant effect on the total sugar and total acid content of the fruit, but it still reduced the anthocyanin content. This may be because sufficient color-changing substances have already accumulated in the fruit before the color-changing period, but bagging treatment still affects the expression of genes related to anthocyanin synthesis or the stability of anthocyanins, thus leading to a decrease in anthocyanin content. Different light-transmitting bag treatments had different effects on the flavonoid and anthocyanin content in the fruit, further illustrating that light plays an important role in the synthesis of flavonoids and anthocyanins.

[0100] Example 2: Metabolomics analysis of the effects of light treatment on the content of anthocyanin-related metabolites during the ripening process of bayberry fruit.

[0101] In Example 1, the effects of bagging treatments with different light transmittance on the color and quality of fruit during ripening were studied. Therefore, in order to reveal the molecular mechanism by which light signals regulate anthocyanin synthesis, this example further explores the effects of light treatment on the content of anthocyanin-related metabolites during the ripening of bayberry fruit, aiming to gain a deeper understanding of the regulatory role of light signals on anthocyanin synthesis-related metabolites and their influence mechanism during the ripening process of bayberry fruit from a metabolomics perspective. The specific experimental procedure is as follows: transcriptomic and metabolomic analyses were performed on samples of ripe HQ and WQ fruits, and principal component analysis (PCA) and KEGG enrichment analysis were conducted.

[0102] Samples of bayberry fruit were collected, immediately frozen in liquid nitrogen, and stored at -80°C for further transcriptomic and metabolomic analysis. Five replicates were performed per treatment, with each replicate consisting of a mixture of 10 fruits. Total RNA was extracted from the samples using CTAB reagent (MEGAN, Guangzhou). RNA quality was assessed using the Agilent 2100 RNA Bioanalyzer (Agilent, Santa Clara, USA). RNA-Seq libraries were prepared using the VAHTS mRNA-Seqv2 library preparation kit (Vazyme, Nanjing). Sequencing was performed using the HiSeqXTen sequencing system, employing 150 bp sequencing at the strand pairing ends (Illumina, San Diego, CA, USA).

[0103] Non-target metabolite samples were extracted with methanol and analyzed under Agilent 1290 ultra-high performance liquid chromatography (UPLC) control according to the mobile phase parameters shown in the table below. The chromatographic column used was a Waters UPLC BEH Amide column (1.7 μm * 2.1 mm * 100 mm).

[0104] Table 1. Chromatographic parameters

[0105] Time (min) Flow rate (uL / min) A (%): 0.1% formic acid in water B (%): 0.1% formic acid in acetonitrile 0.0 400 98 2 0.25 400 98 2 10.0 400 2 98 13.0 400 2 98 13.1 400 98 2 15.0 400 98 2

[0106] The specific results are as follows:

[0107] Principal component analysis (PCA) results for transcriptomes obtained under different bagging treatments (HQ and WQ) Figures 3A - 3D ) and metabolome ( Figures 4A - 4C A comprehensive analysis of the parameters was conducted. The first principal component (PC1) explained the significant difference in the total variance between the metabolomics and transcriptomics data, while the second principal component (PC2) further revealed other variability in the data. Transcriptomics analysis showed that 14,851 genes were co-expressed in HQ and WQ. Figure 3D Compared to the black opaque bagging (HQ) treatment, the white translucent bagging (WQ) treatment showed 335 and 603 differentially regulated genes, respectively. Figure 3B KEGG enrichment analysis showed that photoinduced differential gene expression was mainly enriched in the phenylpropanoid biosynthesis pathway, the MAPK signaling pathway, and the flavonoid biosynthesis pathway. Metabolomics sequencing results indicated that differentially expressed metabolites were mainly enriched in signal transduction pathways, phenylpropanoid pathways, and carbon metabolism-related pathways.

[0108] The results indicate that different bagging treatments (HQ and WQ) significantly affect the transcriptome and metabolome during the ripening process of *Myrica rubra* fruit. At the transcriptome level, a large number of genes were co-expressed under both HQ and WQ treatments, but the expression of some genes changed significantly under the light-transmitting bag treatment, with many differentially expressed genes being upregulated and downregulated. These differentially expressed genes were mainly enriched in the phenylpropanoid synthesis pathway, the MAPK signaling pathway, and the flavonoid metabolism pathway, all related to anthocyanin synthesis. At the metabolome level, differentially expressed metabolites were mainly enriched in signal transduction pathways, phenylpropanoid pathways, and carbon metabolism-related pathways. This suggests that light treatment plays a crucial role in the synthesis and regulation of anthocyanin-related metabolites during the ripening process of *Myrica rubra* fruit by influencing gene expression and metabolite accumulation, and that this regulatory effect involves multiple metabolic pathways.

[0109] Example 3: Effects of light treatment on the expression of anthocyanin-related genes during the ripening process of bayberry fruit

[0110] In this embodiment, to further reveal the regulatory mechanism of light signals on anthocyanin synthesis in bayberry fruit, the effects of light treatment on the expression of anthocyanin-related genes during bayberry fruit ripening were investigated. The aim was to gain a deeper understanding of the regulatory role of light signals on anthocyanin synthesis-related genes and their impact mechanism during bayberry fruit ripening from the gene expression level. The specific experimental procedure is as follows:

[0111] All genes involved in anthocyanin biosynthesis and glycosylation were identified by transcriptome analysis, followed by KEGG analysis. RNA-Seq data were validated by qRT-PCR analysis to demonstrate the reliability of the RNA-Seq data. The real-time PCR analysis steps were as follows: gene sequences were obtained from NCBI, quantitative PCR primers were designed using Primers 5.0 software, and quantitative qRT-PCR was performed using the Green qPCR SuperMix quantitative PCR kit (Beijing). The quantitative qRT-PCR reaction included: 10 μL of 2×TipGreenq PCR SuperMix, 0.4 μL each of upstream and downstream quantitative primers (10 μmol L⁻¹), 2 μL of cDNA template, and ddH₂O added to 20 μL. The reaction conditions were: pre-denaturation at 94℃ for 30 s, 94℃ for 5 s, and 60℃ for 34 s, for a total of 40 cycles. Normalization was performed using the pear β-actin gene. The primer sequences used are shown in Table 2. -ΔΔCT The method calculates the relative expression level of genes.

[0112] Table 2. Primer sequences

[0113] Primer Sequence (5'→3') Primer-F Sequence (3'→5') Primer-R Actin (Myrica rubra) GCACCACTCAATCCTAAG GTCTCAACCTCTTGCTCATA HY5 CAAAGTAGAAGAGAGCGATG TGAGCAGACACCCTATTC MYB30 GAAGAGGAGACCATCATACA TGCTGTCACCTATCGTCA G-1,3-β GCCATAGACACCACTTTG GCCAACCACTCTCTGATAC PGIP CACTCTCCTTCCAAATCC AGGTTGAGGTAAGTCAGGT LDOX CGAGAGGAGTTGAAGAAAG AATGTAGTCGCTGGGTGT DF1 (MYB-like) AAGCCATAGCCCTTAGTG CAAGTCCATTGTCTCCAG ERF GGGTCATTTAGCCATCCT TTCCCTCGCTTATCCTCT CYP89A2 GTGTTTCACCACCAATGAC AACCAGCCTAAGAACCAC CYP82D47 GACCCGTTGTTCATTGAG CGTTGATGTTCTCCACTATG CYP73A100 TCTCCGTCGTAACTTCGT CTTGCTTCAACTTCCTGC F3’H ATCAGAAGGTTGAGTGGG GTCTTTGGATACTTGAAGGC NEC TGCTAACGCTCTACTATGC CTCCACGCTCTTTGTTCT

[0114] The specific experimental results are as follows:

[0115] KEGG analysis showed that the expression levels of genes such as chalcone synthase (CHS) and flavonol synthase (F3'H) were significantly increased in HQ (black opaque), while the expression level of colorless anthocyanin plus dioxygenase gene (LDOX) was significantly decreased, consistent with the decrease in total anthocyanin content. Figure 5 The above results indicate that the expression level of flavonoid synthesis genes in WQ (white light transmission) was significantly lower than that in HQ, suggesting that flavonoid synthesis was not inhibited under low light. Delphinidin was identified as an important colored anthocyanin in the fruit, and the high expression level of the anthocyanin biosynthesis gene (LDOX) in WQ may be the key reason for maintaining the color of the bayberry fruit. The qRT-PCR analysis results are as follows... Figure 6 A- Figure 6As shown in Figure L, the relative gene expression levels obtained from qRT-PCR analysis further validated the differences in gene expression patterns under different light conditions in transcriptome analysis. For example, in Figure 6 A- Figure 6 The results in Figure L show that the changes in the relative expression levels of each gene under two different bagging conditions, HQ and WQ, are consistent with the KEGG analysis results. That is, the relative expression levels of CHS and F3'H genes are higher under HQ, while the relative expression levels of flavonoid synthesis genes are lower under WQ. This further verifies the effect of light on the expression of anthocyanin-related genes and the differences in gene expression patterns under different light conditions.

[0116] The above results indicate that light treatment affects the expression of anthocyanin-related genes during the ripening process of bayberry fruit. The gene expression patterns differ under different light conditions, and the expression of anthocyanin biosynthesis genes has a significant impact on the color of bayberry fruit.

[0117] Example 4: Effects of light treatment on anthocyanin-related metabolites during the ripening process of bayberry fruit

[0118] In this embodiment, to further explore the regulatory role of light signals on metabolites during anthocyanin synthesis in bayberry fruit, the effects of light treatment on anthocyanin-related metabolites during bayberry fruit ripening were investigated. The aim was to reveal the mechanism by which light signals regulate anthocyanin synthesis and its role in the ripening process of bayberry fruit from a metabolite perspective. Specifically:

[0119] Metabolomics was used to identify relevant metabolites in the pulp of *Myrica rubra* (Chinese bayberry), ultimately identifying six major anthocyanin synthesis-related metabolites, including proanthocyanidins, anthocyanins, phenolic acids, flavonoids, flavonols, and coumarins. A total of 44 differentially expressed metabolites related to anthocyanin synthesis were also identified. Furthermore, the contents of proanthocyanidins (B2, B3, B4), pelargonidin glucoside, and paeoniflorin glucoside were significantly increased in the whole-fruited (WQ) culture. Figure 7A , Figure 7B This may be the main reason for the red pigmentation in bayberry fruits.

[0120] Therefore, it can be seen that different light treatments affect the content of anthocyanin synthesis-related metabolites. The increase in the content of certain metabolites under WQ (white light-transmitting bag) treatment may be related to the red pigment deposition in bayberry fruit.

[0121] Example 5: The core role of transcription factor HY5 in light-regulated anthocyanin synthesis in bayberry fruit

[0122] In Example 4, the effects of light treatment on anthocyanin-related metabolites were investigated, revealing differences in metabolite content under different light treatments. Transcription factors play a crucial regulatory role in the synthesis of plant secondary metabolites. Therefore, this study further investigates the transcription factors involved in light-regulated anthocyanin synthesis and their roles in this process, aiming to clarify the core transcription factors and their functions within the regulatory network. Details are as follows:

[0123] Analysis of the eight most significantly differentially expressed metabolites in Example 4, and correlation analysis, revealed that ten transcription factors and genes are involved in the light-regulated anthocyanin biosynthesis process. Figure 8A Among them, transcription factors HY5 and ERF098 were positively correlated with anthocyanin content and anthocyanin biosynthesis gene expression, while transcription factor DF1 (MYB-like) was negatively correlated. Transcription factors DF1 (MYB-like) and HY5 are core regulatory genes in the regulatory network. Figure 8B ).

[0124] Therefore, it can be concluded that transcription factors play a crucial role in the light-regulated anthocyanin synthesis process in bayberry fruit, with DF1 (MYB-like) and HY5 being the core transcription factors. They participate in regulating anthocyanin synthesis through interactions with other transcription factors and genes. This result further reveals the molecular mechanism by which light signals regulate anthocyanin synthesis, providing a theoretical basis for subsequent efforts to improve bayberry fruit quality by regulating transcription factors.

[0125] Example 6: Evolutionary analysis and functional differentiation of the HY5 gene in Myrica rubra

[0126] In Example 5, the core role of HY5 in photoregulated anthocyanin synthesis was clearly established. Therefore, in this example, to further explore the characteristics of the HY5 gene in bayberry, the evolutionary position and phylogenetic relationships of the HY5 protein in bayberry were analyzed to understand its evolutionary origin and possible functional differentiation. Details are as follows:

[0127] Phylogenetic trees of HY5 transcription factors in crops such as Myrica rubra (6), Arabidopsis thaliana (16), and rice (17) were constructed using MEGA 5.0. Figure 9 The results showed that there is only one HY5 gene in *Myrica rubra*, and no homologous genes exist. Based on sequence homology and genetic distance, the HY5 gene in other species is not in the same branch as the HY5 gene in *Myrica rubra*. It is more closely related to species such as *Juglans regia*, *Caryaillinoinensis*, *Juglans regia*, and *Alnus glutinosa*, with a similarity between 75% and 85%. It is speculated that this gene may have undergone functional differentiation.

[0128] Therefore, it can be concluded that the HY5 gene in *Myrica rubra* has a unique evolutionary position, differing from the HY5 genes in common plants such as *Arabidopsis thaliana* and rice, and lacking homologous genes. This uniqueness may suggest that the HY5 gene in *Myrica rubra* may have a certain degree of functional specificity, and the speculation on its functional differentiation provides a new direction for further research on the specific mechanism of action of this gene in the regulation of anthocyanin synthesis in *Myrica rubra* fruit.

[0129] Example 7: Verification of the regulation of anthocyanin content in bayberry by core transcription factors DF1 and HY5

[0130] 1. Constructing overexpression vectors

[0131] In this embodiment, DF1 overexpression vector and HY5 overexpression vector were constructed respectively.

[0132] Construction process of DF1 overexpression vector:

[0133] (1) First, total RNA was extracted from bayberry tissue and reverse transcribed into cDNA using a reverse transcription kit. Then, specific primers were designed based on the nucleotide sequence of the DF1 gene (as shown in SEQ ID NO.3) and the full-length coding sequence of the DF1 gene was obtained by PCR amplification.

[0134] Primer Sequence (5'→3') Primer-F Sequence (3'→5') Primer-R DF1 (MYB-like) ATGGAACCGAATGGTTTAGG TCAAGCCGTAATGGTGGA

[0135] (2) The amplified DF1 gene fragment was ligated to pCAMBIA1300. The ligation reaction was performed using homologous recombinase (Exnase II, Novizan Vazyme, Nanjing).

[0136] (3) The ligation product was transformed into competent E. coli cells, and positive clones were obtained by kanamycin resistance selection. The positive clones were sequenced to verify that the inserted DF1 gene sequence was correct.

[0137] Construction process of HY5 overexpression vector:

[0138] Total RNA was extracted from bayberry tissue and reverse transcribed into cDNA. Primers were designed based on the nucleotide sequence of the HY5 gene (as shown in SEQ ID NO.1), and the full-length coding sequence of the HY5 gene was amplified by PCR.

[0139] Primer Sequence (5'→3') Primer-F Sequence (3'→5') Primer-R HY5 (Myrica rubra) ATGACTCTTCCGAAAGCC [[ID=

[0140] (2) The amplified HY5 gene fragment was ligated to pCAMBIA1300. The ligation reaction was performed using homologous recombinase (Exnase II, Novizan Vazyme, Nanjing).

[0141] (3) The ligation product was transformed into competent Escherichia coli cells, and positive clones were obtained by kanamycin resistance screening. The accuracy of the inserted HY5 gene sequence was then verified by sequencing.

[0142] 2. Constructing a transient silence carrier

[0143] Construction process of DF1 transient silencing vector:

[0144] (1) First, total RNA was extracted from bayberry tissue and reverse transcribed into cDNA using a reverse transcription kit. Then, specific primers were designed based on the nucleotide sequence of the DF1 gene (as shown in SEQ ID NO.3) and the full-length coding sequence of the DF1 gene was obtained by PCR amplification.

[0145] ​ Sequence (5'→3') Primer-F Sequence (3'→5') Primer-R DF1 (MYB-like) ATGGAACCGAATGGTTTAGG TCAAGCCGTAATGGTGGA

[0146] (2) The amplified DF1 gene fragment was ligated to TRV2. The ligation reaction was performed using homologous recombinase (Exnase II, Vazyme, Nanjing).

[0147] (3) The ligation product was transformed into competent E. coli cells, and positive clones were obtained by kanamycin resistance selection. The positive clones were sequenced to verify that the inserted DF1 gene sequence was correct.

[0148] 3. Effects of overexpression vectors and transient silencing vectors on tomato fruit

[0149] During the tomato fruit ripening stage, Agrobacterium suspensions containing DF1 and HY5 overexpression vectors (Agrobacterium is a commonly used plant gene transformation tool that can introduce foreign genes into plant cells) were injected into tomato fruits for transient overexpression. The results were compared with an empty vector group and a blank control group (normal bayberry fruits without vectors). Fruits were collected at maturity, and the anthocyanin content and expression levels of related genes in each group were measured.

[0150] The expression levels of anthocyanin synthesis-related genes (such as chalcone synthase gene, flavonol synthase gene, colorless anthocyanin plus dioxygenase gene, etc.) and the DF1 and HY5 genes in each group were analyzed by qRT-PCR. The experimental results showed that: (1) Compared with normal tomato fruits, there was no significant difference in total anthocyanin content and related gene expression levels in the empty vector group, indicating that the empty vector itself had no significant effect on the anthocyanin synthesis process of bayberry fruit. (2) The total anthocyanin content of tomato fruits in the DF1 overexpression vector group was significantly reduced, and the expression level of anthocyanin synthesis-related genes was also significantly reduced, while the expression level of the DF1 gene itself was significantly increased. This indicates that DF1 overexpression inhibited anthocyanin synthesis, further verifying that DF1 was negatively correlated with total anthocyanin content and anthocyanin biosynthesis gene expression. (3) The total anthocyanin content of tomato fruits in the HY5 overexpression vector group was significantly increased, and the expression level of anthocyanin synthesis-related genes was also significantly increased, while the expression level of the HY5 gene itself was significantly increased. This indicates that HY5 overexpression promotes anthocyanin synthesis, further confirming the positive correlation between HY5 and total anthocyanin content and anthocyanin biosynthesis gene expression. (4) Simultaneously, after injecting Agrobacterium suspensions containing the transient silencing vectors TRV2-DF1 and TRV1 into tomato fruits, the total anthocyanin content of the tomato fruits increased slightly, and the expression level of anthocyanin synthesis-related genes also improved to some extent. However, compared with the HY5 overexpression group, the increase in color anthocyanin content and the increase in gene expression level were both smaller. This indicates that transient silencing of DF1 or overexpression of HY5 can increase the anthocyanin content in tomato fruits, but the effect of transient silencing of DF1 is not as good as the effect of overexpression of HY5. This may be because the effect of DF1 in the heterologous system is not good, resulting in a less obvious promoting effect on anthocyanin synthesis than HY5 overexpression.

[0151] Therefore, it can be concluded that transcription factors HY5 and DF1 play a crucial role in anthocyanin synthesis in fruits. Their effects on anthocyanin synthesis were verified using overexpression vectors and transient silencing vectors, and their regulatory effects on anthocyanin synthesis are opposite. HY5 is positively correlated with total anthocyanin content and anthocyanin biosynthesis gene expression, while DF1 is negatively correlated with both.

[0152] In this embodiment, the effects of both methods were verified by constructing an overexpression vector and injecting it into tomato fruits for transient overexpression, and by constructing a transient silencing vector to interfere with gene expression. For HY5, its overexpression promoted the expression of genes related to anthocyanin synthesis, thereby increasing the total anthocyanin content and deepening the fruit color. This indicates that the expression level of HY5 may be a key factor affecting anthocyanin synthesis during normal physiological processes, and its role may be regulated by multiple factors. For example, under light conditions, light signals can affect anthocyanin synthesis by regulating the expression of the HY5 gene or the activity of the protein.

[0153] Overexpression of DF1 led to a decrease in the expression of genes related to anthocyanin synthesis, a reduction in total anthocyanin content, and a lighter fruit color, verifying its inhibitory effect on anthocyanin synthesis. This suggests that under normal circumstances, DF1 may maintain an appropriate expression level through some mechanism to avoid excessive inhibition of anthocyanin synthesis. When DF1 expression is abnormally elevated, such as the overexpression in this experiment, it will have a significant inhibitory effect on anthocyanin synthesis. Furthermore, while interfering with DF1 expression can increase anthocyanin content and the expression level of related genes to some extent, the effect is not as significant as HY5 overexpression.

[0154] In the study of anthocyanin synthesis in bayberry fruit, due to current technological limitations, direct gene editing of bayberry is not possible. However, considering the potential similarities in gene regulatory mechanisms among different plants, this embodiment selected to conduct heterologous experiments on tomatoes. The experimental results are consistent with theoretical predictions made in bayberry fruit, providing important evidence for further understanding the regulatory mechanism of anthocyanin synthesis in bayberry fruit. Although direct gene editing experiments on bayberry are currently not possible, these heterologous experimental results indicate that DF1 and HY5 may have similar regulatory roles in the anthocyanin synthesis process of bayberry fruit, providing potential targets and methods for regulating bayberry fruit quality through genetic engineering. Further verification on bayberry can be conducted when the technology matures.

[0155] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A method for regulating the anthocyanin content in bayberry fruit, characterized in that, In the method, the anthocyanin content in bayberry fruit is regulated by adjusting the expression of the transcription factor HY5 gene or the activity of the transcription factor HY5 protein; the nucleotide sequence of the HY5 gene is shown in SEQ ID NO.1, and the amino acid sequence of the HY5 protein is shown in SEQ ID NO.

2.

2. The method as described in claim 1, characterized in that, By regulating the intensity of light signals, the expression of the transcription factor HY5 gene or the activity of the transcription factor HY5 protein can be modulated, thereby controlling the anthocyanin content in bayberry fruit.

3. The method as described in claim 2, characterized in that, By increasing the intensity of light signals, the expression of the transcription factor HY5 gene is increased, or the activity of the transcription factor HY5 protein is enhanced, thereby increasing the anthocyanin content in bayberry fruit.

4. The method as described in claim 1, characterized in that, By using genetic engineering techniques, the expression of transcription factor HY5-related genes or the activity of transcription factor HY5 protein can be regulated, thereby controlling the anthocyanin content in bayberry fruit.

5. The method as described in claim 1, characterized in that, In the method, the anthocyanin content in bayberry fruit can also be regulated by regulating the expression of the transcription factor DF1 gene or the activity of the transcription factor DF1 protein; the nucleotide sequence of the DF1 gene is shown in SEQ ID NO.3, and the amino acid sequence of the DF1 protein is shown in SEQ ID NO.

4.

6. The method as described in claim 5, characterized in that, In the method described above, the expression of transcription factor DF1 gene or the activity of transcription factor DF1 protein are regulated by adjusting the intensity of light signal, thereby controlling the anthocyanin content in bayberry fruit.

7. The use of a transcription factor HY5 in the preparation of a formulation to enhance anthocyanin synthesis in bayberry fruit, characterized in that, The transcription factor HY5, as the active ingredient in the preparation, participates in regulating the anthocyanin synthesis process in bayberry fruit and is positively correlated with anthocyanin content and anthocyanin biosynthesis gene expression.

8. The use as described in claim 7, characterized in that, In the bayberry fruit, the anthocyanin synthesis genes include any one or more of the following: chalcone synthase gene, flavonol synthase gene, and colorless anthocyanin plus dioxygenase gene. The transcription factor HY5 is positively correlated with the expression of the genes.

9. The use as described in claim 7, characterized in that, The formulation affects the activity of transcription factor HY5 by regulating the expression of genes related to the light signal transduction pathway in bayberry fruit, thereby regulating anthocyanin synthesis.

10. The use as described in claim 9, characterized in that, The light signal transduction pathway-related genes in the bayberry fruit include any one or more of photoreceptor genes and COP1 genes. Transcription factor HY5, as a downstream receptor of the related genes in the light signal transduction pathway, regulates anthocyanin synthesis by interacting with the COP1 gene and regulating anthocyanin synthesis genes.

Images