Protein for regulating and controlling yield of grain crops and application of protein
By regulating the expression levels of GSN7 protein and/or GSN7 gene in cereal crops, the negative correlation between yield traits in cereal crops was resolved, resulting in improvements in grain number per ear, yield per plant, and yield per plot, demonstrating significant potential for breeding applications.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
- Filing Date
- 2026-01-13
- Publication Date
- 2026-05-08
AI Technical Summary
In existing technologies, yield improvement in cereal crops mainly relies on the complex interrelationships between traits such as number of grains per spike, number of grains per spike, and thousand-grain weight, resulting in negative correlations between yield traits. There is a lack of key genes that can directly break the negative correlations between traits.
Increased yields in cereal crops can be achieved by regulating the expression levels of GSN7 protein and/or the GSN7 gene in cereal crops, including gene editing and the use of weak promoters, to reduce the activity and/or expression levels of GSN7 protein.
It effectively increases the number of grains per ear, yield per plant, and yield per plot in cereal crops, breaks the negative correlation between yield traits, achieves trait decoupling, and improves yield without affecting other related traits.
Smart Images

Figure CN121992015A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular genetic breeding technology, and in particular to a protein that regulates the yield of cereal crops and its uses. Background Technology
[0002] Rice ( Oryza sativa Rice (L.) is a major food crop, and increasing its yield is crucial for ensuring food security and sustainable agricultural development. Rice yield is determined by three main factors: effective panicle number, number of grains per panicle, and thousand-grain weight. Among these, the number of grains per panicle is directly related to rice yield and has always been a hot topic in high-yield rice breeding research. These traits are mostly typical quantitative traits, controlled by complex quantitative trait loci (QTLs). With the completion of rice genome sequencing and the development of molecular genetics, those skilled in the art have discovered several important QTLs or genes related to rice yield, for example, DEP1 , APO1 , LAX1 , OsCKX2 , Ghd7 , RCN1 and RCN2 The molecular mechanisms by which traits such as effective panicle number, grain number per panicle, and thousand-grain weight regulate rice yield are gradually being understood. However, due to the complex and interdependent relationships among yield-related agronomic traits such as effective panicle number, grain number per panicle, and thousand-grain weight (e.g., grain number per panicle and thousand-grain weight), breaking the negative correlation between yield traits and achieving trait decoupling is a key research direction for those skilled in the art.
[0003] Genes controlling the number of grains per ear often simultaneously control multiple other yield traits, exhibiting pleiotropic effects, for example... IPA1 Simultaneously, traits such as the number of grains per ear, the number of tillers, and the thickness of the stem are regulated. DEP1 While controlling traits such as number of grains per panicle, plant height, and grain weight, there is still a lack of key genes that can break the negative correlation between traits and can be directly used for high-yield rice breeding. Summary of the Invention
[0004] In view of the above-mentioned defects or improvement needs in the existing technology, the present invention provides a protein for regulating the yield of cereal crops and its uses, so as to break the negative correlation between yield traits.
[0005] The first object of the present invention is to provide the use of the GSN7 protein and / or the GSN7 gene in increasing the yield of cereal crops.
[0006] A second object of the present invention is to provide the use of the GSN7 protein and / or the GSN7 gene in increasing the number of grains per ear, yield per plant and / or yield per plot in cereal crops.
[0007] A third objective of this invention is to provide the use of biomaterials that reduce GSN7 protein expression or activity and / or GSN7 gene expression levels in increasing cereal crop yields.
[0008] A fourth object of the present invention is to provide the use of biomaterials that reduce GSN7 protein expression or activity and / or GSN7 gene expression levels in increasing the number of grains per ear, yield per plant and / or plot yield of cereal crops.
[0009] The fifth objective of this invention is to provide a method for increasing the yield of cereal crops.
[0010] To achieve the above objectives, the specific technical solution of the present invention is as follows: The use of GSN7 protein and / or GSN7 gene in increasing cereal crop yield, wherein the amino acid sequence of said GSN7 protein is as shown in SEQ ID NO:3 or SEQ ID NO:6; or has at least 80%, 85%, 90%, 95%, 98% or 99% identity with the amino acid sequence shown in SEQ ID NO:3 or SEQ ID NO:6 and has the same function.
[0011] As a preferred embodiment, increasing cereal crop yield includes: increasing the number of grains per ear, yield per plant, and / or yield per plot.
[0012] As a preferred approach, the expression or activity of GSN7 protein and / or the expression level of the GSN7 gene in the cereal crops are reduced.
[0013] As a preferred embodiment, the nucleotide sequence of the GSN7 gene is as shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.4 or SEQ ID NO.5; or has at least 80%, 85%, 90%, 95%, 98% or 99% identity with the nucleotide sequence shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.4 or SEQ ID NO.5, and is capable of encoding a protein with the same function.
[0014] As a preferred embodiment, the biomaterial is selected from nucleic acid molecules, expression cassettes, recombinant vectors, genetically engineered host cells, or microorganisms.
[0015] As a preferred embodiment, the cereal crop is rice. As a more preferred embodiment, the rice is indica rice, or japonica rice, or a hybrid offspring of japonica and indica rice.
[0016] The use of the GSN7 protein and / or the GSN7 gene in increasing the number of grains per spike, yield per plant, and / or plot yield in cereal crops, wherein the amino acid sequence of the GSN7 protein is as shown in SEQ ID NO:3 or SEQ ID NO:6; or has at least 80%, 85%, 90%, 95%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO:3 or SEQ ID NO:6, and has the same function.
[0017] As a preferred embodiment, the nucleotide sequence of the GSN7 gene is as shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.4 or SEQ ID NO.5; or has at least 80%, 85%, 90%, 95%, 98% or 99% identity with the nucleotide sequence shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.4 or SEQ ID NO.5, and is capable of encoding a protein with the same function.
[0018] As a preferred embodiment, the biomaterial is selected from nucleic acid molecules, expression cassettes, recombinant vectors, genetically engineered host cells, or microorganisms.
[0019] As a preferred embodiment, the cereal crop is rice. As a more preferred embodiment, the rice is indica rice, or japonica rice, or a hybrid offspring of japonica and indica rice.
[0020] The use of biomaterials that reduce GSN7 protein expression or activity and / or GSN7 gene expression levels in increasing cereal crop yield, wherein the amino acid sequence of the GSN7 protein is as shown in SEQ ID NO:3 or SEQ ID NO:6; or has at least 80%, 85%, 90%, 95%, 98% or 99% identity with the amino acid sequence shown in SEQ ID NO:3 or SEQ ID NO:6 and has the same function.
[0021] As a preferred embodiment, increasing cereal crop yield includes: increasing the number of grains per ear, yield per plant, and / or yield per plot.
[0022] As a preferred embodiment, the nucleotide sequence of the GSN7 gene is as shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.4 or SEQ ID NO.5; or has at least 80%, 85%, 90%, 95%, 98% or 99% identity with the nucleotide sequence shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.4 or SEQ ID NO.5, and is capable of encoding a protein with the same function.
[0023] As a preferred embodiment, the biomaterial is selected from nucleic acid molecules, expression cassettes, recombinant vectors, genetically engineered host cells, or microorganisms.
[0024] As a preferred embodiment, the cereal crop is rice. As a more preferred embodiment, the rice is indica rice, or japonica rice, or a hybrid offspring of japonica and indica rice.
[0025] The use of biomaterials that reduce GSN7 protein expression or activity and / or GSN7 gene expression levels in increasing the number of grains per spike, yield per plant, and / or plot yield of cereal crops, wherein the amino acid sequence of the GSN7 protein is as shown in SEQ ID NO:3 or SEQ ID NO:6; or has at least 80%, 85%, 90%, 95%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO:3 or SEQ ID NO:6, and has the same function.
[0026] As a preferred embodiment, the nucleotide sequence of the GSN7 gene is as shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.4 or SEQ ID NO.5; or has at least 80%, 85%, 90%, 95%, 98% or 99% identity with the nucleotide sequence shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.4 or SEQ ID NO.5, and is capable of encoding a protein with the same function.
[0027] As a preferred embodiment, the biomaterial is selected from nucleic acid molecules, expression cassettes, recombinant vectors, genetically engineered host cells, or microorganisms.
[0028] As a preferred embodiment, the cereal crop is rice. As a more preferred embodiment, the rice is indica rice, or japonica rice, or a hybrid offspring of japonica and indica rice.
[0029] As a preferred embodiment, the biomaterial includes nucleic acid molecules, expression cassettes, vectors, cells, or microorganisms; More preferably, the biological material comprises sgRNA that targets and knocks out the GSN7 gene. The nucleotide sequences of the primers for synthesizing the sgRNA are shown in SEQ ID NO.11 and SEQ ID NO.12.
[0030] More preferably, the biological material includes a weak promoter that drives the expression of the GSN7 gene, including but not limited to a promoter with a nucleotide sequence as shown in SEQ ID NO.13, wherein the weak promoter is used to replace the wild-type promoter of the GSN7 gene, and the nucleotide sequence of the wild-type promoter of the GSN7 gene is shown in SEQ ID NO.14.
[0031] A method for increasing cereal crop yield includes the following steps: reducing the expression or activity of GSN7 protein and / or the expression level of the GSN7 gene in a target cereal crop, wherein the amino acid sequence of the GSN7 protein is as shown in SEQ ID NO:3 or SEQ ID NO:6; or has at least 80%, 85%, 90%, 95%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO:3 or SEQ ID NO:6, and has the same function.
[0032] As a preferred embodiment, the nucleotide sequence of the GSN7 gene is as shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.4 or SEQ ID NO.5; or has at least 80%, 85%, 90%, 95%, 98% or 99% identity with the nucleotide sequence shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.4 or SEQ ID NO.5, and is capable of encoding a protein with the same function.
[0033] As a preferred embodiment, the target cereal crop is a cereal crop. As a more preferred embodiment, the cereal crop is rice. As a further preferred embodiment, the rice is indica rice, or japonica rice, or a hybrid offspring of japonica and indica rice.
[0034] As a preferred approach, methods for reducing GSN7 protein expression or activity and / or GSN7 gene expression levels include: gene editing of the GSN7 gene; or introducing a weak promoter through genetic hybridization.
[0035] More preferably, the gene editing method includes knocking out the GSN7 gene. Even more preferably, an sgRNA targeting the knockout of the GSN7 gene is synthesized, and the nucleotide sequences of the primers used are shown in SEQ ID NO.11 and SEQ ID NO.12.
[0036] More preferably, the gene editing method includes: editing the wild-type promoter of the GSN7 gene to a weak promoter. More preferably, the nucleotide sequence of the wild-type promoter is shown in SEQ ID NO.14, and the nucleotide sequence of the weak promoter is shown in SEQ ID NO.13. In this case, the expression level of the GSN7 gene is reduced. Through this regulatory approach, the number of grains per ear and yield can be increased.
[0037] More preferably, the method for introducing a weak promoter via genetic hybridization includes: introducing a weak promoter into the target plant via genetic hybridization, wherein the nucleotide sequence of the weak promoter is shown in SEQ ID NO. 13. More preferably, the promoter is introduced by hybridizing the target plant with 9311 rice, wherein the nucleotide sequence of the 9311-derived GSN7 gene is shown in SEQ ID NO. 13.
[0038] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention discovers that GSN7 is a functional protein involved in regulating cereal crop yield. Reducing the expression of this protein or its gene can effectively increase the number of grains per spike, yield per plant, and plot yield in cereal crops, without significantly negatively impacting other yield-related traits such as plant height, tiller number, and thousand-grain weight. This invention overcomes the common negative correlations among yield traits and breaks through the technical bottleneck of mutual constraints among multiple yield traits, which is of great value for driving progress in high-yield breeding technology and germplasm innovation. Attached Figure Description
[0039] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0040] Figure 1 This is a comparison chart of ear type and number of grains per ear for NIP-GSN7 and NIP-gsn7 provided in Example 1 of this invention; A is a comparison chart of ear type, with a scale bar of 5 cm; B is a comparison chart of number of grains per ear; C is a comparison chart of expression level of GSN7 gene; the values in the figure are mean ± standard error (n = 30), and the P value is obtained from Student's t-test analysis.
[0041] Figure 2 The figures show the expression levels of the GSN7 gene provided in Example 2 of this invention in different rice tissues (root, stem, leaf, 0.2 cm panicle (YP0.2), 2 cm panicle (YP2), 8 cm panicle (YP8), 15 cm panicle (YP15), and 20 cm panicle (YP20)); the values in the figures are mean ± standard error (n=3), and the OsACTIN1 gene is an internal reference gene.
[0042] Figure 3This is a phenotypic analysis of the transgenic lines with overexpression of the GSN7 gene provided in Example 3 of the present invention; A shows the comparison results of plant type and ear type, with scale bars of 20 cm and 5 cm respectively; B shows the comparison results of the expression level of the GSN7 gene; C shows the comparison results of the number of grains per ear; the values in the figure are mean ± standard error (n = 8), different letters indicate significant differences (P<0.05), and the significance analysis was performed using the Duncan test.
[0043] Figure 4 This is a phenotypic analysis of the GSN7 gene knockout line (gsn7-c) under the WYJ7-DEP1 (WT) background provided in Example 4 of this invention; A is the comparison result of plant type, scale bar is 20 cm; B is the comparison result of ear type, scale bar is 5 cm; C is the comparison of grain shape, scale bar is 2 mm; D is the comparison of tiller number; E is the comparison of thousand-grain weight; F is the comparison result of grains per ear; G is the comparison of yield per plant; H is the comparison result of yield per plot; the values in D to H are the mean ± standard error (n=8), different letters indicate significant differences (P<0.05), and the significance analysis adopts Duncan's test method.
[0044] Figure 5 This is a haplotype analysis of the GSN7 gene provided in Example 5 of the present invention; A represents the haplotype analysis result of GSN7, the black rectangles represent exons, Indica represents indica rice, Trp represents tropical japonica rice, Tmp represents temperate japonica rice, AUS represents AUS rice, Bas represents Basmati rice, and GJ-admix represents mixed japonica rice. Japonica (Admix) represents mixed rice. In the table, columns 1, 2, 3, and 4 represent four different haplotypes: Hap1, Hap2, Hap3, and Hap4, respectively. B shows the analysis results of the number of grains per panicle for different haplotypes of GSN7. Different letters in the violin plot represent the results of significance difference analysis using Tukey's HSD test. C shows the utilization of different haplotypes in rice local varieties and modern varieties. LAN represents local varieties, and MV represents modern cultivars. Detailed Implementation
[0045] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.
[0046] Unless otherwise specified, the experimental methods involved in the following embodiments are conventional methods in the art. For example, you can refer to the experimental manual in the art or follow the conditions recommended in the manufacturer's instructions.
[0047] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available.
[0048] Example 1: Localization and Cloning of the GSN7 Gene 1. Selection and breeding of rice lines and localization of the GSN7 gene This invention utilizes a set of chromosome segment substitution lines (CSSLs) obtained by crossing indica rice donor 9311 with japonica rice recurrent parent Nipponbare (NIP) to identify a line N78 that has no significant difference from NIP in terms of plant height, number of tillers, or thousand-grain weight, but has increased number of grains per panicle and length-to-width ratio of grains.
[0049] To clone candidate genes controlling grain number and grain shape per panicle, this invention backcrossed N78 with Nipponbare (NIP) and constructed an F2 mapping population. Through fine mapping of 1,593 progeny, the candidate region controlling grain number per panicle was located to an 8.3 kb region on chromosome 7 of the rice genome (https: / / rice.uga.edu / ). The increase in grain number per panicle co-segregated with the elongated grain phenotype, indicating that this locus simultaneously regulates grain number and grain shape; therefore, this invention named it Grain Shape and Number 7 (GSN7). The primers used for mapping are shown in Table 1.
[0050] Table 1 Primer sequences used for gene mapping
[0051] In indica rice 9311, the cDNA sequence of the GSN7 gene is shown in SEQ ID NO.1, the genomic DNA sequence of the GSN7 gene is shown in SEQ ID NO.2, the amino acid sequence of the protein encoded by the GSN7 gene is shown in SEQ ID NO.3, and the promoter sequence of the GSN7 gene is shown in SEQ ID NO.13.
[0052] In Nipponbare (NIP) japonica rice, the cDNA sequence of the GSN7 gene is shown in SEQ ID NO.4, the genomic DNA sequence of the GSN7 gene is shown in SEQ ID NO.5, the amino acid sequence of the protein encoded by the GSN7 gene is shown in SEQ ID NO.6, and the promoter sequence of the GSN7 gene is shown in SEQ ID NO.14.
[0053] Rice plants carrying the GSN7 gene fragment from Nipponbare were named NIP-GSN7, and rice plants carrying the GSN7 gene fragment from 9311 were named NIP-gsn7. The panicle phenotypes of both are as follows: Figure 1 As shown in A in the diagram.
[0054] 2. Cloning of the GSN7 gene To clone the GSN7 gene, this invention further sequenced and analyzed the aforementioned 8.3 kb region, discovering only two genes within this region. Specifically, the promoter region of LOC_Os07g06570 exhibits multiple single nucleotide polymorphisms (SNPs) and insertion-deletion variations (InDels). Furthermore, an SNP in exon 7 resulted in a premature stop codon, ultimately leading to a 3-amino acid deficiency at the C-terminus of the protein encoded by the LOC_Os07g06570 gene derived from 9311. Therefore, it is hypothesized that the LOC_Os07g06570 gene is the GSN7 gene regulating the number and shape of grains per ear, and differences in its promoter region may lead to differences in gene expression levels, thus resulting in differences in the number and shape of grains per ear between 9311 and Nipponbare varieties.
[0055] Furthermore, to demonstrate that differences in the promoter region of the GSN7 gene lead to differences in its gene expression levels in 9311 and Nipponbare varieties, this invention selected 3 cm young spikelets of NIP-GSN7 and NIP-gsn7, extracted RNA, and reverse transcribed it to synthesize cDNA. Using primers GSN7-qRT-F:5'-TCCAAGGAGCTTCGGAACCT-3' (SEQ ID NO.7) and primers GSN7-qRT-R:5'-TGCCACCTTCCCTTGCAAAT-3' (SEQ ID NO.8), Real-time PCR was used to analyze the GSN7 gene expression level and found that, as Figure 1 As shown in C, the expression level of the LOC_Os07g06570 gene is significantly lower in NIP-gsn7 than in NIP-GSN7. Therefore, LOC_Os07g06570 is the GSN7 gene, and the promoter mutation of the gsn7 gene in NIP-gsn7 (the mutated nucleotide sequence is shown in SEQ ID NO. 13) leads to its reduced gene expression level.
[0056] To verify the effect of GSN7 on the number of grains per panicle in rice, this invention planted a pair of near-isogenic lines, NIP-GSN7 and NIP-gsn7, in the field and statistically analyzed the panicle phenotype at maturity. Figure 1As shown in B, compared with NIP-GSN7, NIP-gsn7 increased the number of grains per panicle, indicating that GSN7 regulates the number of grains per panicle in rice, and the gsn7 gene derived from indica rice 9311 can increase the number of grains per panicle in rice.
[0057] Example 2: High expression of the GSN7 gene during rice panicle development 1. Experimental Methods To further clarify the regulatory role of the GSN7 gene in rice panicle development, this invention selected different parts of NIP materials (roots, young stems, mature leaves, and young panicles at different developmental stages (0.2 cm, 2 cm, 8 cm, 15 cm, and 20 cm panicles)). Following the method in Example 1, RNA was extracted and cDNA was synthesized by reverse transcription. The mRNA level of the GSN7 gene in rice roots, stems, leaves, and young panicles at different developmental stages (0.2 cm, 2 cm, 8 cm, 15 cm, and 20 cm) was detected by Real-time PCR. The primers used were the same as in Example 1.
[0058] 2. Experimental Results like Figure 2 As shown, the GSN7 gene is expressed in roots, stems, leaves, and young panicles at different developmental stages, but its expression level is higher in young panicles at different developmental stages, especially in 8 cm panicles, indicating that the GSN7 gene is involved in regulating the development of rice young panicles.
[0059] Example 3: Overexpression of the GSN7 gene reduces the number of grains per panicle in rice. 1. Creation of transgenic lines with GSN7 gene overexpression To clarify the regulatory role of the GSN7 gene on grain number in rice panicles, this invention created transgenic lines with overexpression of the GSN7 gene. The specific method is as follows: Using Nipponbare cDNA as a template, the full-length cDNA sequence of the GSN7 gene (SEQ ID NO. 5) was amplified using primers GSN7-F: 5'-ACAAGTTTGTACAAAAAAGCAGGCTTCATGGGCTGCCTGAGCCGGCAT-3' (SEQ ID NO. 9) and GSN7-R: 5'-ACCACTTTGTACAAGAAAGCTGGGTCCACAGATAATTCACAAATGTTTTC-3' (SEQ ID NO. 10). This cDNA was then assembled into the binary expression vector pCAMBIA2300 (which was preserved in the inventor's laboratory), and the resulting vector was denoted as pActin1::GSN7.
[0060] The pActin1::GSN7 gene was transformed into the WYJ7-DEP1 rice material (hereinafter referred to as WT, which is the wild-type rice material of this invention; this material is the Wuyunjing 7 rice variety with the DEP1 gene introduced into it, which has been disclosed in the following literature: Huang X, Qian Q, Liu Z, Sun H, He S, Luo D, XiaG, Chu C, Li J, and Fu X. Natural variation at the DEP1 locus enhances grainyield in rice. Nat Genet. 2009:41(4):494-497. https: / / doi.org / 10.1038 / ng.352) using Agrobacterium-mediated transformation, and transgenic lines GSN7-OX1 and GSN7-OX2 with overexpression of the GSN7 gene were obtained.
[0061] 2. Phenotypic analysis of transgenic lines with GSN7 gene overexpression This invention involves planting WT, GSN7-OX1, and GSN7-OX2 rice materials in the field, and photographing the whole plant and panicle at maturity. The phenotypes of the whole plant and panicle are shown below. Figure 3 As shown in A in the diagram.
[0062] Furthermore, to detect the expression level of GSN7 in overexpressing transgenic lines, this invention selected 3 cm young panicles of WT, GSN7-OX1, and GSN7-OX2 rice materials, extracted RNA, and reverse transcribed it to synthesize cDNA. Following the method in Example 1, the expression level of the GSN7 gene was detected using Real-time PCR. Figure 3 As shown in B, compared with WT, the expression levels of the GSN7 gene in GSN7-OX1 and GSN7-OX2 were significantly increased. The primers used were the same as in Example 1.
[0063] To analyze the effect of GSN7 gene overexpression on the number of grains per panicle in rice, this invention planted WT, GSN7-OX1, and GSN7-OX2 rice materials in the field and counted the number of grains per panicle at maturity. Figure 3 As shown in C, compared to WT, the number of grains per ear of the transgenic lines GSN7-OX1 and GSN7-OX2 was significantly reduced.
[0064] The above results indicate that increasing the expression level of the GSN7 gene leads to a decrease in the number of grains per panicle in rice, thus the GSN7 gene negatively regulates the number of grains per panicle in rice.
[0065] Example 4: Increased rice yield after GSN7 gene knockout 1. Creation of GSN7 gene knockout lines To clarify the regulatory role of the GSN7 gene on the number of grains per panicle and yield in rice, this invention created a GSN7 gene knockout mutant, the specific method of which is as follows: Primers were designed using the GSN7 gene (SEQ ID NO.5) to amplify the target sequence and ligate it into an sgRNA expression cassette (the sequences of primers GSN7sgRNA-F are shown in SEQ ID NO.11, and the sequences of primers GSN7sgRNA-R are shown in SEQ ID NO.12). The sgRNA expression cassette was then inserted into the vector pYLCRISPR / Cas9Pubi-MH (a vector kindly provided by the laboratory of Liu Yaoguang at South China Agricultural University) using a method of restriction enzyme digestion and ligation simultaneously, resulting in a gene knockout vector, denoted as pYLCRISPR / Cas9Pubi-GSN7.
[0066] Using Agrobacterium-mediated transformation, pYLCRISPR / Cas9Pubi-GSN7 was transformed into WYJ7-DEP1 (WT) to obtain the GSN7 gene knockout line, which was named gsn7-c.
[0067] 2. Phenotypic analysis of GSN7 gene knockout lines This invention involves planting WT and gsn7-c rice materials in the field, and photographing the whole plant and panicle at maturity. The phenotypes of the whole plant, panicle, and grain shape are shown in the following figures. Figure 4 As shown in A, B, and C.
[0068] Further phenotypic analysis revealed that, compared to WT, the gsn7-c knockout mutant showed no changes in other traits such as plant height, tiller number, and thousand-grain weight, in the following order: Figure 4 As shown in A, D, and E, the number of grains per ear, yield per plant, and yield per plot all increased significantly, in the following order: Figure 4 As shown in F, G, and H.
[0069] The above results indicate that knocking out the GSN7 gene does not change other yield traits of rice such as plant height, number of tillers, and thousand-grain weight, but increases the number of grains per panicle, yield per plant, and yield per plot, breaking the negative correlation between yield traits, achieving trait decoupling, and realizing an overall increase in rice yield.
[0070] Example 5GSN7 Hap.3 Haplotypes have potential applications in high-yield rice breeding. 1. Haplotype analysis This invention utilizes 4.8 M single nucleotide polymorphism (SNP) data published on the Rice Genome Project website (https: / / rfgb.rmbreeding.cn / index) to perform GSN7 haplotype analysis, such as... Figure 5 As shown in Figure A, most of the SNPs in this gene are located in the promoter region, with only two base mutations in the gene body region. Haplotype analysis of GSN7 using these SNPs revealed that the gene is mainly divided into four major haplotypes (Hap. 1–4): Hap.1 sequence: GATAAAGCCTTGTATTTTAAACTGT (SEQ ID NO.15); Hap.2 sequence: TGCGCGATTGCACGTTTTGGTTGAA (SEQ ID NO.16); Hap.3 sequence: GATAAAGCCTTGTANNTTAAACTGT (SEQ ID NO.17); Hap.4 sequence: GATAAAGCCTTGTANTTTAAACTGT (SEQ ID NO.18).
[0071] 2. Phenotypic analysis of haplotype rice materials Comparative analysis of the yields of rice materials carrying different haplotypes revealed that, for example Figure 5 As shown in B, it carries GSN7 Hap.3 Haplotype rice exhibited higher yields, indicating that GSN7 Hap.3 It is an excellent haplotype with high-yield breeding application potential.
[0072] Further analysis revealed that, for example Figure 5 As shown in C, among the four haplotypes, GSN7 Hap.3 The haplotype occurs less frequently in modern cultivars, at only 21%, far lower than its frequency in local varieties (78%), while GSN7... Hap.2 The frequency of occurrence in modern cultivars is 87.1%, far higher than the 12.9% frequency in local varieties, indicating that GSN7... Hap.3 Haplotypes have great potential for future applications in rice breeding.
[0073] In summary, this invention provides a key gene, GSN7, that controls the number of grains per panicle and yield in rice, and that reducing the expression of this gene can increase rice yield. Furthermore, this invention provides an excellent haplotype of GSN7 for increasing rice yield. Hap.3 It has broad application prospects in high-yield rice breeding.
[0074] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. The use of GSN7 protein and / or GSN7 gene in increasing cereal crop yield, characterized in that, The amino acid sequence of the GSN7 protein is shown in SEQ ID NO:3 or SEQ ID NO:6; or It has at least 80%, 85%, 90%, 95%, 98% or 99% identity with the amino acid sequence shown in SEQ ID NO:3 or SEQ ID NO:6, and has the same function.
2. The use of GSN7 protein and / or GSN7 gene in increasing grains per spike, yield per plant, and / or plot yield in cereal crops, characterized in that, The amino acid sequence of the GSN7 protein is shown in SEQ ID NO:3 or SEQ ID NO:6; or It has at least 80%, 85%, 90%, 95%, 98% or 99% identity with the amino acid sequence shown in SEQ ID NO:3 or SEQ ID NO:6, and has the same function.
3. The use of biomaterials that reduce GSN7 protein expression or activity and / or GSN7 gene expression levels in increasing cereal crop yield, characterized in that, The amino acid sequence of the GSN7 protein is shown in SEQ ID NO:3 or SEQ ID NO:6; or It has at least 80%, 85%, 90%, 95%, 98% or 99% identity with the amino acid sequence shown in SEQ ID NO:3 or SEQ ID NO:6, and has the same function.
4. The use of biomaterials that reduce GSN7 protein expression or activity and / or GSN7 gene expression levels in increasing the number of grains per spike, yield per plant, and / or plot yield in cereal crops, characterized in that, The amino acid sequence of the GSN7 protein is shown in SEQ ID NO:3 or SEQ ID NO:6; or It has at least 80%, 85%, 90%, 95%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO:3 or SEQ ID NO:6, and has the same function.
5. The use as described in claim 1 or 3, characterized in that, The improvement of cereal crop yield includes: increasing the number of grains per ear, yield per plant, and / or yield per plot.
6. The use as described in claim 1, 3, or 5, characterized in that, The biomaterials include nucleic acid molecules, expression cassettes, vectors, cells, or microorganisms.
7. The use as described in any one of claims 1 to 6, characterized in that, The nucleotide sequence of the GSN7 gene is shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.4 or SEQ ID NO.5; or It has at least 80%, 85%, 90%, 95%, 98%, or 99% identity with the nucleotide sequence shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.4, or SEQ ID NO.5, and is capable of encoding a protein with the same function.
8. The use as described in any one of claims 1 to 6, characterized in that, The target cereal crop includes rice.
9. A method for increasing the yield of cereal crops, characterized in that, Includes the following steps: Reduce the expression or activity of GSN7 protein and / or the expression level of GSN7 gene in target cereal crops; The amino acid sequence of the GSN7 protein is shown in SEQ ID NO:3 or SEQ ID NO:6; or It has at least 80%, 85%, 90%, 95%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO:3 or SEQ ID NO:6, and has the same function.
10. The method as described in claim 9, characterized in that, The target cereal crop includes rice.