Rapid detection method for echinococcus multilocularis based on RPA-CRISPR / Cas

By using the RPA-CRISPR/Cas system, combined with recombinase polymerase amplification and CRISPR/Cas12a protein, sgRNA sequences were designed for the detection of Echinococcus multilocularis var. multilocularis, achieving high specificity and sensitivity. This solves the problems of insufficient sensitivity and complex operation of existing detection methods and is suitable for primary healthcare institutions and on-site quarantine.

CN121992079APending Publication Date: 2026-05-08QINGHAI ACAD OF ANIMAL SCI & VETERINARY MEDICINE
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
QINGHAI ACAD OF ANIMAL SCI & VETERINARY MEDICINE
Filing Date
2026-02-06
Publication Date
2026-05-08

AI Technical Summary

Technical Problem

Existing methods for detecting Echinococcus multilocularis tapeworm have insufficient sensitivity, are complex to operate, are time-consuming, and are difficult to apply to primary healthcare institutions and on-site quarantine, thus failing to meet the needs of early screening.

Method used

Using the RPA-CRISPR/Cas system, combined with recombinase polymerase amplification (RPA) and CRISPR/Cas12a protein, a specific single-stranded guide RNA (sgRNA) was designed. DNA amplification and specific cleavage were performed under isothermal conditions, and rapid detection was achieved by combining it with a fluorescent reporter probe.

Benefits of technology

It achieves highly specific and sensitive detection of Echinococcus multilocularis taeniae, can identify it at the single copy number level, simplifies the operation process, is suitable for primary medical institutions and on-site quarantine, and improves the efficiency of early identification and diagnosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121992079A_ABST
    Figure CN121992079A_ABST
Patent Text Reader

Abstract

The invention discloses a rapid detection method for echinococcus multilocularis based on RPA-CRISPR / Cas, and belongs to the technical field of molecular diagnosis. The method comprises the following steps: extracting DNA of a sample to be detected; the specific primers are used for RPA isothermal amplification, a reaction system comprises a buffer solution, upstream and downstream primers, RPA enzyme, magnesium acetate and template DNA, and reaction is carried out at 39 DEG C for 20 minutes; and mixing the amplification product with Cas12a protein, sgRNA and a fluorescence report probe, carrying out CRISPR / Cas reaction at 37 DEG C for 30 minutes, and judging the result through a real-time fluorescence signal. Constant-temperature rapid amplification is achieved through RPA, high-sensitivity and high-specificity detection of echinococcus multilocularis can be achieved under the site condition by combining high-specificity recognition and cleavage activity of CRISPR / Cas12a, the sensitivity reaches the single-site copy number, operation is easy and convenient, complex instruments are not needed, and the method is suitable for primary medical treatment and site quarantine.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular diagnostic technology, specifically to a rapid detection method for Echinococcus multilocularis taeniae based on the combination of recombinase polymerase amplification (RPA) and clustered regularly spaced short palindromic repeats / CRISPR-related proteins (CRISPR / Cas). Background Technology

[0002] Echinococcosis multilocularis is a serious zoonotic parasitic disease caused by the larvae (hydatid larvae) of the worm *Echinococcus multilocularis*. It is widespread in temperate and subarctic regions globally, with high incidence rates in the developed livestock areas of Northwest and Southwest my country, as well as parts of the Qinghai-Tibet Plateau. Hydatid larvae are highly invasive and metastatic, primarily parasitizing the human liver (approximately 90% or more), but can also affect multiple organs such as the lungs, brain, and bones. Early symptoms are often subtle; as the worm proliferates and spreads, it can lead to liver tissue destruction, cirrhosis, jaundice, and in later stages, organ failure or distant metastasis often threatens life. Its mortality rate is significantly higher than that of *Echinococcus granulosus*.

[0003] Currently, the detection methods for Echinococcus multilocularis disease have many limitations: imaging tests (CT, ultrasound, MRI) can only identify invasive lesions with a diameter >1cm, and are not sensitive enough for early small lesions (<0.5cm) and occult metastatic lesions, and are difficult to distinguish from space-occupying lesions such as Echinococcus granulosus and liver cancer; serological tests (ELISA, Western Blot) rely on cystococcosis-specific antigens, which are prone to cross-reaction with parasites such as Echinococcus granulosus and Fasciola hepatica, with a false positive rate of 12%-18%, which cannot meet the early screening needs of asymptomatic infected persons; conventional PCR testing requires a real-time quantitative PCR instrument, which involves a temperature cycle of "denaturation-annealing-extension", which is complicated to operate, takes 2-3 hours, and requires high professional skills from operators, making it difficult to adapt to the scenarios of on-site quarantine in primary medical institutions and epidemiological investigations in remote areas. Therefore, there is an urgent need to develop a rapid and accurate detection method suitable for on-site use to solve the pain points of existing detection technologies. Summary of the Invention

[0004] This invention addresses the shortcomings of existing methods for detecting Echinococcus multilocularis var. ... var. var. var var. var. var var. var. var var. var var. var. var var. var var. var var. var var

[0005] The purpose of this invention is to provide a rapid detection method for Echinococcus multilocularis based on RPA-CRISPR / Cas, the method comprising the following steps: S1. Extract DNA from the sample to be tested; S2. RPA Amplification: Configure the RPA reaction system and amplify the products using the RPA method; S3. CRISPR / Cas system reaction detection: Take the above RPA amplification product, add fluorescent reporter probe, Cas12a protein and sgRNA, perform CRISPR reaction detection, and read the detection signal; The Cas12a protein is LbCas12a, the RPA primer combination is F5'- GGTTTGTTATGCGTTATGATTATTTGTTGCA-3', R5'- CGACAACATAACATCACCAAAAATCAAGTAC-3', the sgRNA sequence is UAAUUUCUACUAAGUGUAGAUUAACUGGAUUUAGGAGGUUGUUU, the fluorescent reporter probe sequence is 5'-TTATT-3', and the RPA amplification reagent contains RPA enzyme and magnesium acetate. The RPA amplification reaction system includes RPA buffer, ddH2O, upstream and downstream primers, RPA enzyme lyophilized powder, template DNA, and magnesium acetate; the RPA amplification reaction conditions are 39℃ for 20 min. The CRISPR / Cas system reaction system includes 10×LbCas12a Reaction Buffer, LbCas12a, template, fluorescent reporter probe, and sgRNA; the CRISPR / Cas system reaction conditions are 37℃ for 30 min.

[0006] The components of the RPA amplification reaction system were prepared in the following proportions: 29.5 μL RPA buffer, 2.5 μL 280 mM magnesium acetate, 2.4 μL 10 μM upstream primer, 2.4 μL 10 μM downstream primer, 3 μL DNA template, and RPA enzyme lyophilized powder.

[0007] The reaction system of the CRISPR / Cas system was prepared in the following proportions: 2 μL of RPA amplification product, 2 μL of 10×LbCas12a Reaction Buffer, 1 μL of 1 μM LbCas12a, 1 μL of 10 μM fluorescent reporter probe, and 1 μL of 1 μM sgRNA, with ddH2O added to a final volume of 20 μL. The reaction conditions were: qPCR program set to 37℃ for 30 min, with FAM channel fluorescence signal collected every 30 s using a real-time quantitative PCR instrument.

[0008] Recombinase polymerase amplification (RPA) technology, as an isothermal nucleic acid amplification technique, can amplify target genes within 15-30 minutes under isothermal conditions of 37-42℃, without the need for complex temperature control equipment. The CRISPR / Cas (Clustered Regularly Interspaced Short Palindromic Repeats, CRISPR, Cas protein) system (especially Cas12a protein) possesses highly specific sequence recognition capabilities and "trans-cutting" activity, enabling non-specific cleavage of single-stranded DNA (ssDNA) after recognizing the target sequence. Combined with a fluorescent reporter probe, it allows for the visual detection of the target. The combined use of these two technologies achieves integrated detection of "isothermal amplification + specific cleavage + rapid reading," significantly improving the specificity, sensitivity, and convenience of the detection.

[0009] This invention targets Echinococcus multilocularis and develops a rapid detection method for the disease based on RPA technology combined with CRISPR and the CRISPR-related protein system CRISPR / Cas12. By designing sgRNA (single-stranded guide RNA) sequences, the method guides the Cas12 bound to it to cleave specific gene sites, thereby further increasing the specificity and sensitivity of the detection on the basis of RPA. It has extremely high detection sensitivity, can be carried out under isothermal conditions, and does not require complex instruments and equipment.

[0010] This invention establishes a specific method for the combined RPA-CRISPR detection of *Echinococcus multilocularis*, possessing high sensitivity and strong specificity (detection sensitivity is in the single copy number range). It enables rapid and accurate on-site differentiation of *Echinococcus multilocularis* from its closely related species and other common parasites, achieving highly specific, highly sensitive, and isothermal-controlled rapid detection of *Echinococcus multilocularis* infection. This method is simple to operate, has a short detection cycle, and requires no complex equipment, making it particularly suitable for primary healthcare institutions and on-site quarantine procedures. It can significantly improve the efficiency of early identification and diagnosis of *Echinococcus multilocularis* infection. The establishment of this technology provides a reliable technical means for the clinical diagnosis, epidemiological investigation, and rapid on-site screening of *Echinococcus multilocularis* infection, effectively meeting the urgent needs of clinical diagnosis and on-site quarantine. It has significant practical application value in promoting the improvement of parasitic disease control capabilities and ensuring public health security. Attached Figure Description

[0011] Figure 1 The diagram shows the sgRNA primer design sites in Example 1, with the yellow box indicating the sgRNA design site and the black ellipse indicating the PAM site.

[0012] Figure 2The results show the specificity verification of the Echinococcus multilocularis RPA-CRISPR system in Example 1, where A is the fluorescence growth rate of the entire reaction, B is the fluorescence growth curve of the entire reaction, and C is a photograph taken by a blue light gel cutter after the reaction is completed.

[0013] Figure 3 The results of sensitivity detection of the Echinococcus multilocularis RPA-CRISPR system in Example 1 are shown. A represents the fluorescence intensity curves at different plasmid concentrations, and B represents the photograph taken under a portable blue light gel cutter after the reaction. Detailed Implementation

[0014] The present invention will be further described below with reference to this example, but this does not limit the invention. Unless otherwise specified, the experimental methods in the following examples are conventional methods. The reagents and instruments used in the following examples can all be purchased commercially. Example

[0015] I. Experimental Materials and Main Reagents 1. Experimental materials

[0016] 2. Main reagents RPA amplification kit: TwistAmp Basic Kit (TwistDX Inc., catalog number: TABAS03KIT); Cas12a protein: GenCRISPR LbCas12a Nuclease (Nanjing GenScript Biotech Co., Ltd., catalog number: Z03753-100); sgRNA and fluorescent reporter probe: synthesized by Beijing Aoke Dingsheng Biotechnology Co., Ltd.; DNA extraction kit: SPARKeasy whole blood / tissue / cell genomic DNA rapid extraction kit (Shandong Cisco Biotechnology Co., Ltd., catalog number: AA0901-A); PCR amplification kit: 2×Spark Taq PCR Master Mix (with dye) (Shandong Cisco Biotechnology Co., Ltd., catalog number: AF0102-B).

[0017] 3. Main Instruments Real-time PCR instrument; portable blue light gel cutter; constant temperature metal bath.

[0018] II. Nucleic Acid Extraction and Primer Design 1. DNA extraction Serum / plasma samples: DNA extraction using a column-based DNA extraction kit; Tissue samples (liver / lung cyst tissue, livestock muscle tissue): 100 mg of tissue was ground into powder in liquid nitrogen and then extracted using a column-based DNA extraction kit, following the instructions, with a final elution volume of 20-50 μL; Fecal samples: DNA was extracted using a fecal DNA extraction kit after removing inhibitors from the feces.

[0019] 2. Nucleic acid sequence preparation The DNA of Echinococcus multilocularis in Table 1 was amplified to obtain the partial ND5 sequence. The amplification primer sequences were ND5-F: 5'-GGTTTGTTATGCGTTATGATTATTTGTTGCA-3'; ND5-R: 5'-CGACAACATAACATCACCAAAAATCAAGTAC-3'.

[0020] The partial sequence of Echinococcus multilocularis ND5 obtained by amplification sequencing is as follows: GGTTTGTTATGCGTTATGATTATTTGTTGCATTTTAGTAGGTCAATAATTATTTTTAGTGTTATGCTTTTGTTGACTGTGTTTGTAACTGGATTTAGGAGGTTGTTTTTTTATGATTTGAAGAAGATTGTAGCTCTGTCAACATGTAATAATGTTTCTTGATGTGTTCTGTACTTGATTTTTGGTGATGTTATGTTGTCG 3. Design of crRNA primers Target sequences containing the CRISPR-Cas12a recognition sequence (PAM) TTTN were identified. Based on the PAM location, sgRNA primers were designed at differentially expressed sites using CRISPR software (http: / / crispor.tefor.net / ). The spacer sequence of the designed sgRNA was analyzed for coverage and specificity using NCBI BLAST. The sgRNA sequence is UAAUUUCUACUAAGUGUAGAUUAACUGGAUUUAGGA GGUUGUUU. The alignment results showed that the designed sgRNA spacer sequence had 100% coverage within the tested species and good specificity.

[0021] 4. Template preparation Using the sample DNA in Table 1 as a template, PCR amplification was performed using ND5-F / R according to the recommended system in the Cisco reagent manual to obtain high-concentration products. The specific amplification system is shown in Table 2, and the corresponding PCR program is shown in Table 3. Plasmids were extracted after cloning and expression.

[0022]

[0023] 5. RPA amplification Using the plasmid from step "4. Template Preparation" as a template, the *Echinococcus multilocularis* ND5 gene fragment was amplified by RPA technology: RPA reaction system (50 μL): 25 μL RPA buffer, 2.5 μL 280 mM magnesium acetate, 2.4 μL 10 μM upstream primer F, 2.4 μL 10 μM downstream primer R, 3 μL template, 1 part of RPA enzyme lyophilized powder, and ddH2O to make up to 50 μL; the reaction system was incubated in a 39℃ constant temperature box for 20 min to obtain the RPA amplification product (containing the *Echinococcus multilocularis* ND5 gene specific fragment).

[0024] The RPA buffer formulation is as follows: Tris-HCl (pH 7.6-8.0, 25℃) 50mM, potassium acetate 50mM, PEG35000 (w / v) 5.5%, BSA 0.1mg / ml, DTT 1mM, dNTPs (each type, dATP / dCTP / dGTP / dTTP) 0.2mM, creatine phosphate 40mM, creatine kinase 1× working concentration (approximately 0.5-1U / μL), and nuclease-free purified water.

[0025] 6. CRISPR detection After measuring the plasmid concentration as described in "4. Template Preparation", dilute it 10 times. 3 10 2 10 1 10 0 10 - 1 The plasmid (copies / μL) and negative template were used to prepare the CRISPR reaction system according to the system in Table 4.

[0026]

[0027] The qPCR instrument was programmed at 37℃ for 30 min, with FAM channel fluorescence signals collected every 30 s. The changes in the fluorescence signal curve reflected the progress of the reaction. After the reaction was completed, the reaction tubes were placed on a portable blue light gel cutter to observe the fluorescence.

[0028] III. Specificity Detection of Echinococcus multilocularis RPA-CRISPR System Using the DNA samples from the 10 samples listed in Table 1 as templates, RPA amplification was performed on the DNA using the selected RPA primers F / R. The RPA reaction system and conditions were the same as those described in Section II, "Nucleic Acid Extraction and Primer Design". The RPA reaction products were then used to prepare the CRISPR system shown in Table 4 and placed in a qPCR instrument. The qPCR instrument was programmed at 37°C for 30 min, with the FAM channel fluorescence signal collected every 30 s.

[0029] result( Figure 2 The results showed that only the *Echinococcus multilocularis* sample exhibited fluorescence, while other samples showed no fluorescence. This indicates that the detection method established in this experiment has good specificity and can effectively distinguish the target species.

[0030] IV. Sensitivity Detection of the RPA-CRISPR System for Echinococcus multilocularis Tape After amplifying the DNA extracted from sample S2, a plasmid was constructed. The plasmid was then extracted and serially diluted 10-fold. 3 10 2 10 1 10 0 10 -1 A total of 5 concentrations were tested, following the reaction system and methods described in Section III, "Specific Detection of Echinococcus multilocularis RPA-CRISPR System".

[0031] The results are as follows Figure 3 As shown, the detection sensitivity of the Echinococcus multilocularis RPA-CRISPR system of this invention is single copy number.

Claims

1. A rapid detection method for Echinococcus multilocularis based on RPA-CRISPR / Cas, characterized in that... The method includes the following steps: S1. Extract DNA from the sample to be tested; S2.RPA Amplification: Configure the RPA reaction system and amplify the products using the RPA method; S3. CRISPR / Cas system reaction detection: Take the above RPA amplification product, add fluorescent reporter probe, Cas12a protein and sgRNA, perform CRISPR reaction detection, and read the detection signal; The Cas12a protein is LbCas12a, the RPA primer combination is F5'- GGTTTGTTATGCGTTATGATTATTTGTTGCA-3', R5'- CGACAACATAACATCACCAAAAATCAAGTAC-3', the sgRNA sequence is UAAUUUCUACUAAGUGUAGAUUAACUGGAUUUAGGAGGUUGUUU, the fluorescent reporter probe sequence is 5'-TTATT-3', and the RPA amplification reagent contains RPA enzyme and magnesium acetate. The RPA amplification reaction system includes RPA buffer, ddH2O, upstream and downstream primers, RPA enzyme lyophilized powder, template DNA, and magnesium acetate; the RPA amplification reaction conditions are 39℃ for 20 min. The CRISPR / Cas system reaction system includes: 10×LbCas12a Reaction Buffer, LbCas12a, template, fluorescent reporter probe, and sgRNA; the CRISPR / Cas system reaction conditions are 37℃ for 30 min. The components of the RPA amplification reaction system were prepared in the following proportions: 29.5 μL RPA buffer, 2.5 μL 280 mM magnesium acetate, 2.4 μL 10 μM upstream primer, 2.4 μL 10 μM downstream primer, 3 μL DNA template, and RPA enzyme lyophilized powder. The reaction system of the CRISPR / Cas system was prepared in the following proportions: 2 μL of RPA amplification product, 2 μL of 10×LbCas12a Reaction Buffer, 1 μL of 1 μM LbCas12a, 1 μL of 10 μM fluorescent reporter probe, and 1 μL of 1 μM sgRNA, with ddH2O added to a final volume of 20 μL. The reaction conditions were: qPCR program set to 37℃ for 30 min, with FAM channel fluorescence signal collected every 30 s using a real-time quantitative PCR instrument.