Biosensor detection reagent for detecting salmonella typhimurium and preparation method

Abstract

The invention discloses a biosensor detection reagent for detecting salmonella typhimurium and a preparation method, and belongs to the technical field of biomedicine. According to the invention, a DNA sequence of an amino-modified nucleic acid aptamer for detecting salmonella typhimurium is screened out and is shown as SEQ ID No: 1. Based on the nucleic acid aptamer, amino modified aptamer-fluorescent nano-enzyme serving as an energy donor and sulfydryl modified aptamer-gold nanoparticles serving as an energy receptor are mixed according to the volume ratio of 1: 1, and the biosensor detection reagent is prepared. The linear detection range of the biosensor detection reagent on salmonella typhimurium is 101-107 CFU / mL, the linear correlation coefficient R2 is equal to 0.9981, and the detection limit is as low as 1.527 CFU / mL. The biosensor detection reagent disclosed by the invention still keeps good selectivity and stability in a complex environment with high protein, high fat and high salt, and is suitable for rapid field detection in the fields of food safety and medical diagnosis.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a nucleic acid aptamer and biosensor detection reagent for detecting Salmonella typhimurium. Background Technology

[0002] Salmonella Typhimurium is a Gram-negative bacterium belonging to the genus Salmonella in the family Enterobacteriaceae. It easily causes serious foodborne illnesses globally. Widely distributed in contaminated food, water, and the environment, it is transmitted via the fecal-oral route, primarily causing gastroenteritis and sepsis, posing a significant threat, especially to infants, the elderly, and those with weakened immune systems. According to data from the World Health Organization (WHO), there are approximately 94 million cases of Salmonella infection globally each year, with Salmonella Typhimurium accounting for over 30%. The pathogenic mechanism of Salmonella Typhimurium involves virulence factor secretion systems, biofilm formation, and multidrug resistance. These characteristics enable it to survive and spread within the host, increasing the difficulty of diagnosis and treatment. This bacterium can evade antibiotic attack through various mechanisms, with the efflux pump system playing a central role. The main efflux pumps of Salmonella Typhimurium belong to the family of efflux pump systems (RNDs), with the multidrug efflux pump system AcrAB-TolC being the most representative. The outer membrane channel protein TolC, as an outer membrane channel component of the multiple drug efflux pump system (AcrAB-TolC), has become a focal point in antimicrobial strategies due to its structural and functional studies. TolC is a β-barrel-shaped outer membrane protein composed of approximately 418 amino acids with a molecular weight of about 46 kDa. It not only participates in drug efflux but also mediates the secretion of virulence factors in the type III secretion system. Studies have shown that strains lacking TolC exhibit a more than 50% decrease in biofilm formation capacity, reduced motility, and weakened resistance to oxidative stress. Therefore, when the surface domains of TolC are exposed to the environment and recognized by targeting molecules, they can serve as ideal targets for developing specific probes.

[0003] Methods for detecting Salmonella typhimurium primarily rely on microbiological culture, immunological detection, and molecular biology techniques. Culture methods, such as those using ISO 6579 standards, isolate strains through selective culture media, offering high sensitivity but being time-consuming and unsuitable for rapid on-site detection. Immunological methods, such as enzyme-linked immunosorbent assays (ELISA) or lateral flow immunochromatographic strips, use antibodies targeting the O or H antigens, shortening detection time but exhibiting strong cross-reactivity and a high false-positive rate. Molecular biology methods, such as real-time polymerase chain reaction (PCR), require expensive equipment and specialized operation, and are severely affected by inhibitors (such as fats and proteins in the food matrix). In complex samples, such as pre-marinated beef, the high salt, high fat, and high ferritin environment can easily lead to signal attenuation and reduced accuracy. A common limitation of these methods is the lack of specific targeted recognition mechanisms and the inability to monitor live bacteria in real time, making them ill-equipped to address the prevalence of multidrug-resistant strains.

[0004] Therefore, there is an urgent need to develop an economical, rapid, and convenient detection method. Nucleic acid aptamer technology, as an emerging molecular recognition tool, offers a new path to solving these problems. Nucleic acid aptamers are single-stranded DNA or RNA molecules obtained through in vitro exponential enrichment ligand phylogenetic analysis, capable of binding to targets with high affinity and specificity. In the detection of Salmonella typhimurium, aptamers can target surface markers, such as flagellin or outer membrane proteins, achieving specific recognition of live bacteria. However, traditional exponential enrichment ligand phylogenetic analysis relies on experimental iteration, is inefficient, and is susceptible to sequence variations. Summary of the Invention

[0005] To achieve rapid, sensitive, and convenient detection of Salmonella typhimurium in food, this invention provides a biosensor detection reagent for detecting Salmonella typhimurium, and also provides a method for preparing the biosensor detection reagent for detecting Salmonella typhimurium.

[0006] The present invention has screened out a DNA sequence of an amino-modified Salmonella typhimurium nucleic acid aptamer for the detection of Salmonella typhimurium, as shown in SEQ ID No: 1. The 5' end of the amino-modified Salmonella typhimurium nucleic acid aptamer is modified with an amino group.

[0007] A biosensor detection reagent for detecting Salmonella Typhimurium using an amino-modified Salmonella Typhimurium nucleic acid aptamer:

[0008] It is prepared by uniformly mixing a fluorescent probe as an energy donor and a quenching probe as an energy acceptor at a volume ratio of 1:1.

[0009] The fluorescent probe is a fluorescent nanozyme detection reagent modified with a first aptamer at a concentration of 10 μmol / L;

[0010] The first aptamer is the amino-modified Salmonella typhimurium nucleic acid aptamer;

[0011] The quenching probe is a gold nanoparticle detection reagent modified with a second aptamer at a concentration of 10 μmol / L;

[0012] The second aptamer is a Salmonella typhimurium nucleic acid aptamer, wherein the 5' end of the Salmonella typhimurium nucleic acid aptamer is modified with a thiol group;

[0013] The biosensor detection reagent has a linear detection range of 10 for Salmonella typhimurium. 1 ~10 7 CFU / mL, linear fitting correlation coefficient R 2 =0.9981, with a detection limit as low as 1.527 CFU / mL.

[0014] The preparation steps of a biosensor detection reagent for detecting Salmonella typhimurium are as follows:

[0015] (1) Preparation of the first activation mixture

[0016] 19.2 mg of 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride and 5.75 mg of N-hydroxysuccinimide were dissolved in pure water and the volume was adjusted to 10 mL to obtain the first activation mixture.

[0017] (2) Preparation of the second activation mixture

[0018] 0.2867 g of tris(2-carboxyethyl)phosphonic acid hydrochloride was added to 100 mL of pure water to obtain the second activation mixture;

[0019] (3) Preparation of fluorescent probes

[0020] (3.1) Dissolve 0.242 g copper nitrate, 0.404 g ferric nitrate, 0.251 g manganese nitrate, 0.291 g nickel nitrate, 0.297 g zinc nitrate and 0.434 g cerium nitrate in 20 mL of deionized water and stir at 4 °C for 10 min; then sonicate at the same temperature to obtain a nitrate mixed solution.

[0021] (3.2) Add 1 mL of N-(β-aminoethyl-γ-aminopropyl)methyldimethoxysilane and 2 mL of 10% tannic acid solution to the nitrate mixed solution, then add 10 mL of deionized water, and adjust the pH value to 5 with 0.1 mol / L dilute nitric acid to obtain the mixed solution.

[0022] (3.3) Stir the mixed solution at 85℃ for 2h, add 4mL of tetraethyl orthosilicate and 15mL of deionized water, stir in an oil bath at 80℃ for 2h, and centrifuge at 8000rpm for 5min to obtain the precipitate;

[0023] (3.4) The precipitate was washed three times with 10 mL of ethanol solution. The washed product was then freeze-dried under vacuum to obtain a dry powder.

[0024] (3.5) The dry powder is calcined to obtain calcined powder; 1 mg of calcined powder is mixed with 100 mL of deionized water and cooled to room temperature to obtain a fluorescent nanozyme solution;

[0025] (3.6) Mix 400 μL of fluorescent nanozyme solution and 250 μL of the first activation mixture by vortexing and incubate on a shaker at room temperature to obtain the fluorescent nanozyme incubation solution;

[0026] (3.7) Mix the first aptamer with distilled water to prepare a first aptamer solution with a concentration of 10 μmol / L. Take 200 μL of the first aptamer solution and add it to the fluorescent nanozyme incubation solution. Vortex mix for 2 min and incubate on a shaker at room temperature to obtain the fluorescent probe. Wrap it in tin foil at 4℃ and store it in the dark.

[0027] When the fluorescence emission wavelength of the fluorescent nanozyme solution shifts from 514 nm to 516 nm, it indicates that the first aptamer in the fluorescent probe has been successfully modified into the fluorescent nanozyme in the fluorescent solution.

[0028] (4) Preparation of quenching probe

[0029] (4.1) Add 1 mL of 1% chloroauric acid solution to 100 mL of distilled water and boil; quickly add 3.5 mL of 1% trisodium citrate solution and continue boiling for 15 min, then cool naturally to room temperature to obtain the quenching solution containing gold nanoparticles.

[0030] (4.2) Take 80 μL of the second aptamer solution with a concentration of 10 μM, bathe it in a water bath at 95 °C for 5 min, and then cool it at 4 °C for 5 min to obtain the annealing solution;

[0031] (4.3) Add 15 μL of the second activation mixture to the annealing solution and let it stand at room temperature for 30 min to obtain the reaction solution;

[0032] (4.4) Add 1 mL of quenching solution containing gold nanoparticles to the reaction solution, incubate at 37°C for 12 h, centrifuge at 10000 rpm for 20 min, remove the supernatant, and obtain the precipitate;

[0033] (4.5) Add 500 μL of 0.1 M phosphate buffer solution (PBS) with pH 7.4 to the precipitate, wrap it in tin foil at 4°C to protect it from light, and prepare the quenching probe;

[0034] When the ultraviolet absorption wavelength shifts from 521 nm to 523 nm, it indicates that the second aptamer in the quenching probe has been successfully modified onto the gold nanoparticles.

[0035] (5) Preparation of biosensor detection reagents

[0036] At room temperature, the fluorescent probe and the quenching probe are mixed at a volume ratio of 1:1 to prepare a biosensor detection reagent for detecting Salmonella typhimurium.

[0037] The technical solution for further preparation steps is as follows:

[0038] In step (3.1), the ultrasound conditions are: frequency 40kHz, power 150W, and time 60min.

[0039] In step (3.4), the vacuum freeze-drying conditions are: vacuum degree 1 Pa, temperature -50℃, and time 24 h.

[0040] In step (3.5), the calcination conditions are: temperature 800℃, time 6h.

[0041] In step (3.6), the room temperature shaker incubation conditions are: 180 rpm and 30 min.

[0042] In step (3.7), the room temperature shaker incubation conditions are: 180 rpm and 2.5 h.

[0043] The beneficial technical effects of this invention are reflected in the following aspects:

[0044] 1. Highly stable amino-modified Salmonella typhimurium nucleic acid aptamers

[0045] The amino-modified Salmonella typhimurium nucleic acid aptamer designed in this invention has several outstanding advantages: its design is innovative, rationally targeting bacterial outer membrane channel proteins through computational virtual screening and biomimetic optimization algorithms. These outer membrane channel proteins are key components of multidrug-resistant efflux pumps, enabling the aptamer not only to recognize bacteria but also to differentiate between drug-resistant strains. Furthermore, the amino-modified Salmonella typhimurium nucleic acid aptamer exhibits significant performance data. Flow cytometry verification showed a binding rate of up to 79.52% for the target bacteria and an affinity constant of 12.50 nM, superior to known published sequences (binding rate 73.9%, Kd 16.73 nM), demonstrating higher affinity. It also possesses excellent specificity, with binding rates against five common non-target bacteria, including Listeria monocytogenes, Escherichia coli, and Staphylococcus aureus, all below 20%, effectively avoiding cross-reactivity. Amino-modified Salmonella typhimurium nucleic acid aptamers, as chemically synthesized DNA molecules, are structurally stable, resistant to degradation, and can be stored for extended periods at 4°C in the dark, offering convenient use. Furthermore, in practical applications, they maintain stable and efficient recognition capabilities in complex food matrices such as high-protein, high-fat, and high-salt environments, demonstrating strong environmental adaptability. These characteristics collectively make them an ideal molecular recognition tool that is highly specific, highly affinity, stable, and practical.

[0046] 2. Highly reliable detection reagents for dual-aptamer fluorescence sensing

[0047] This invention provides a biosensor detection reagent for detecting Salmonella Typhimurium based on a novel "dual aptamer recognition-fluorescence quenching" sensing mechanism. Compared with existing detection techniques that rely on culture, immunoassay, or PCR, this reagent offers significant advantages in overall performance. Firstly, two aptamers, modified with amino and thiol groups respectively, are directionally coupled to the surfaces of fluorescent nanozymes and gold nanoparticles, forming structurally stable probe pairs. Secondly, the dual aptamers can simultaneously target different epitopes of bacterial outer membrane channel proteins, enhancing recognition specificity and binding stability, thereby triggering a highly efficient fluorescence resonance energy transfer (FRET) signal response in the presence of Salmonella Typhimurium. This mechanism endows the reagent kit with a wide linear range (10¹~10⁻⁶). 7 With a detection limit of 1.527 CFU / mL and an extremely low detection limit (1.527 CFU / mL), the standard curve regression equation is y = -0.1170x + 1.0197, with a correlation coefficient of 0.9981, demonstrating excellent quantitative accuracy. Regarding specificity, due to the high selectivity of the aptamer for external membrane channel proteins, the kit showed a significant response to the target bacteria (F / F0 = 0.2214), while the signal ratios for five non-target bacteria, including Listeria monocytogenes, were close to 1 (0.9321~0.9860), effectively avoiding cross-reactivity. In complex food matrices (such as pre-marinated beef with 25g / 100g protein, 15g / 100g fat, and 2.5g / 100g salt), the strong affinity of the aptamer for the target structure and the anti-interference encapsulation technology of the nanoprobes jointly ensured a detection recovery rate of nearly 101% and a fluorescence recovery rate >95%, demonstrating reliability. The procedure requires only a 1:1 mixture of sample and reagent kit, incubation at 37°C for 40 minutes, and detection at 434nm / 516nm wavelengths. No complex pretreatment is needed, achieving truly rapid, stable, and highly sensitive on-site detection capabilities. Furthermore, this detection solution is cost-effective, offering significant economic advantages and providing a feasible solution for large-scale, rapid screening in food safety supervision and primary healthcare settings. Its entire preparation process is clearly designed with well-defined quantitative indicators, providing a reliable technical basis for the stable and efficient production of high-performance reagent kits.

[0048] To address the differences in surface properties between fluorescent nanozymes and gold nanoparticles, and the varying reactivity of the terminal amino and thiol groups of the aptamers, this invention designs and implements a differentiated directional coupling strategy: 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride / N-hydroxysuccinimide activation system is used to drive the formation of stable amide bonds between the carboxyl groups on the fluorescent nanozyme surface and the amino-modified aptamers; simultaneously, a thiol activation mechanism is utilized to achieve high-affinity Au-S bond binding between the thiol-modified aptamers and gold nanoparticles. This strategy ensures efficient, directional, and stable immobilization of the two aptamers on the corresponding nanomaterial surfaces. Furthermore, by tracking the redshift of the fluorescence emission peak from 514 nm to 516 nm during the modification of the fluorescent nanozymes, and the shift of the ultraviolet absorption peak from 521 nm to 523 nm during the modification of the gold nanoparticles, the successful coupling of the aptamers on the nanomaterial surfaces can be verified in real-time, non-destructively, and directly. Attached Figure Description

[0049] Figure 1 This is a secondary structure diagram of the amino-modified Salmonella typhimurium nucleic acid aptamer prepared in this invention;

[0050] Figure 2 This is a three-dimensional structural diagram of the membrane protein to be molecularly docked and matched by the Salmonella typhimurium nucleic acid aptamer of the present invention;

[0051] Figure 3 This is a transmission electron microscope image of the fluorescent liquid containing fluorescent nanoparticles prepared according to the present invention;

[0052] Figure 4 This is a transmission electron microscope image of the quenching solution containing gold nanoparticles prepared in this invention.

[0053] Figure 5 This is a diagram showing the effect of the biosensor prepared in this invention after excitation at an excitation wavelength of 434 nm.

[0054] Figure 6 This is a standard curve of the biosensor detection reagent of the present invention against Salmonella typhimurium in PBS buffer.

[0055] Figure 7 This is a standard curve of the biosensor detection reagent of the present invention against Salmonella typhimurium in an orange juice matrix.

[0056] Figure 8 This is a standard curve of the biosensor detection reagent of the present invention against Salmonella typhimurium in a milk matrix. Detailed Implementation

[0057] The present invention will now be described in detail through specific embodiments. However, these illustrative embodiments are for the purpose of illustrating the invention only and do not constitute any limitation on the actual scope of protection of the invention, nor are they intended to limit the scope of protection of the invention to these embodiments. Furthermore, any mass percentage or weight percentage not explicitly stated or mentioned generally refers to the final concentration after addition.

[0058] Unless otherwise specified, the raw materials used in the following examples are all conventional biochemical reagents; unless otherwise specified, the experimental methods are all conventional methods; unless otherwise specified, the quantitative tests in the following examples are all repeated three times and the results are averaged; unless otherwise specified, the percentages in the following examples are all mass percentages.

[0059] In the following examples, both the first and second aptamers were synthesized by Shanghai Sangon Biotech (Shanghai) Co., Ltd.; unless otherwise specified, all other raw materials used were purchased from Sinopharm Chemical Reagent Co., Ltd.

[0060] The phosphate buffer used in this application was 0.1M sterile PBS buffer with a pH of 7.4. All strains used in this test were commercially available standard test strains, including Listeria monocytogenes ATCC 43251, Staphylococcus aureus ATCC 29213, Salmonella typhimurium ATCC 14028, Escherichia coli ATCC 25922, Cronobacter sakazakii ATCC 29544, and Pseudomonas aeruginosa ATCC 15442. All of the above strains were purchased from the American Type Culture Collection (ATCC).

[0061] It should be noted that all instruments, equipment, raw materials, reagents, and methods used in this application are handled under aseptic conditions.

[0062] It should be noted that instruments, equipment, raw materials, reagents, or methods not mentioned in this application are conventional or well-known technical methods to those skilled in the art, and will not be described in detail in this application.

[0063] This invention used flow cytometry to determine the binding characteristics of the amino-modified nucleic acid aptamer of this invention with various test strains. The results showed that its binding rate to the target bacterium *Salmonella typhimurium* was 79.52%, with an affinity constant of 12.50 nM; while the non-specific binding rates to *Staphylococcus aureus*, *Listeria monocytogenes*, *Escherichia coli*, *Cronobacter sakazakii*, and *Pseudomonas aeruginosa* were 4.59%, 7.09%, 19.73%, 13.56%, and 10.70%, respectively. These data indicate that the binding rate and affinity constant of the amino-modified *Salmonella typhimurium* nucleic acid aptamer of this invention are close to the highest known levels, demonstrating feasibility and meeting the requirements for use.

[0064] The following details the method for screening the DNA sequences of amino-modified Salmonella typhimurium aptamers in this invention:

[0065] (1) Construction of the three-dimensional structure of the outer membrane channel protein of Salmonella Typhimurium: First, the gene sequence of the target protein was obtained from the NCBI Gene database, and its three-dimensional structural model was constructed through homology modeling and energy optimization. Analysis showed that the protein model has a typical outer membrane β-barrel and a periplasmic α-helical channel with a length of about 140 Å, and the channel entrance region is negatively charged. This model provides a key structural basis for subsequent molecular docking.

[0066] (2) Molecular docking test of Salmonella typhimurium outer membrane channel protein: First, construct a 10 12 A random oligonucleotide library with fragment lengths ranging from 50 to 70 bp was obtained. Subsequently, the structural information of the outer membrane channel protein of *Salmonella typhimurium* was imported into molecular simulation software to simulate molecular docking between the library and the protein surface domains, and the binding free energy between each oligonucleotide fragment and the protein was calculated. Under simulated physiological binding conditions, the DNA fragments in the library were flexibly docked with the protein active pocket. After docking, the free energy changes of each complex were calculated, and strong binding sequences with a binding free energy ΔG < -8 kcal / mol were screened for subsequent experimental verification.

[0067] In summary, this scheme aims to optimize nucleic acid aptamer design by using molecular docking computational simulations to screen short oligoDNA fragments that bind with high affinity to the surface domains of Salmonella typhimurium outer membrane channel proteins. The entire process encompasses three key steps: randomized library construction, high-throughput virtual screening, and binding energy assessment, enabling the systematic and efficient identification of potential high-affinity nucleic acid aptamer candidate sequences.

[0068] (3) Application of biomimetic optimization algorithm model: Based on the candidate sequences obtained by molecular docking screening, the binding free energy is further optimized globally using a biomimetic optimization algorithm model to obtain a high-affinity nucleic acid aptamer that matches the outer membrane channel protein of Salmonella typhimurium.

[0069] Specifically, a particle swarm optimization algorithm was chosen as the biomimetic model. In this model, each oligoDNA sequence to be optimized is encoded as a particle, whose position vector represents the nucleotide composition or structural features of the sequence, and whose velocity vector determines the direction and magnitude of sequence updates. During algorithm initialization, a population containing several particles is generated, and a fixed sequence length is set. The objective function for optimization is to minimize the binding free energy ΔG between the sequence and the outer membrane channel protein; the initial value of ΔG is derived from the calculation results of the aforementioned molecular docking step.

[0070] During the iterative optimization process, the algorithm dynamically updates the state of all particles by tracking and comparing the historical optimal solution of each particle with the global optimal solution of the entire population. To balance the algorithm's global exploration and local exploitation capabilities, a dynamically decaying inertial weight is introduced. In each iteration, the sequence generated after particle decoding is re-docked to calculate its ΔG value, and the optimal solution record is updated accordingly. After multiple rounds of iterative convergence, the algorithm outputs the sequence with the lowest binding free energy in the population, which is the aptamer obtained in the final optimization.

[0071] Through the above process, several sequences with high predicted binding affinity to outer membrane channel proteins were screened, and Table 1 lists the top three nucleic acid aptamers. The top-ranked aptamer is the amino-modified Salmonella typhimurium nucleic acid aptamer used in this invention.

[0072] Table 1 Binding Free Energy of Different Nucleic Acid Aptamers

[0073] Ranking Sequence (5'–3') ΔG (kcal / mol) 1 GGCACGACGTCAGGCTTAATCCTGACGTACGCTGATTCCAAAATCAGCTCAG -14.2 2 TCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGAT -13.8 3 GCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTA -13.5

[0074] Example 1

[0075] The preparation steps for the biosensor detection reagent used to detect Salmonella typhimurium are as follows:

[0076] (1) Preparation of the first activation mixture

[0077] Dissolve 19.2 mg of 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride and 5.75 mg of N-hydroxysuccinimide in pure water and bring the volume to 10 mL to obtain the first activation mixture.

[0078] (2) Preparation of the second activation mixture

[0079] 0.2867 g of tris(2-carboxyethyl)phosphonic acid hydrochloride was added to 100 mL of pure water to obtain the second activation mixture.

[0080] (3) Preparation of fluorescent probes

[0081] (3.1) Dissolve 0.242 g copper nitrate, 0.404 g ferric nitrate, 0.251 g manganese nitrate, 0.291 g nickel nitrate, 0.297 g zinc nitrate and 0.434 g cerium nitrate in 20 mL of deionized water and stir at 4 °C for 10 min; then sonicate at the same temperature to obtain a nitrate mixed solution.

[0082] (3.2) Add 1 mL of N-(β-aminoethyl-γ-aminopropyl)methyldimethoxysilane and 2 mL of 10% tannic acid solution to the nitrate mixed solution, then add 10 mL of deionized water, and adjust the pH value to 5 with 0.1 mol / L dilute nitric acid to obtain the mixed solution.

[0083] (3.3) Stir the mixed solution at 85℃ for 2h, add 4mL of tetraethyl orthosilicate and 15mL of deionized water, stir in an oil bath at 80℃ for 2h, and centrifuge at 8000rpm for 5min to obtain the precipitate.

[0084] (3.4) The precipitate was washed three times with 10 mL of ethanol solution. The washed product was then freeze-dried under vacuum to obtain a dry powder.

[0085] (3.5) The dry powder was calcined at 800℃ for 6 hours to obtain calcined powder; 1 mg of calcined powder was mixed with 100 mL of deionized water and cooled to room temperature to obtain fluorescent nanozyme solution.

[0086] (3.6) Mix 400 μL of fluorescent nanozyme solution and 250 μL of first activation mixture by vortexing and incubate in a shaker at 180 rpm and room temperature for 30 min to obtain fluorescent nanozyme incubation solution.

[0087] (3.7) Prepare a 10 μmol / L aptamer solution by mixing the first aptamer powder with distilled water. Add 200 μL of the first aptamer solution to the fluorescent nanozyme incubation solution and vortex mix for 2 min. Incubate on a shaker at 180 rpm and room temperature for 2.5 h to obtain the fluorescent probe. See [link to relevant documentation]. Figure 3 Store at 4℃ wrapped in aluminum foil to protect from light.

[0088] See Figure 1 The secondary structure of amino-modified Salmonella typhimurium nucleic acid aptamers.

[0089] When the fluorescence emission wavelength of the fluorescent nanozyme solution shifts from 514 nm to 516 nm, it indicates that the first aptamer in the fluorescent probe has been successfully modified into the fluorescent nanozyme in the fluorescent solution.

[0090] The first aptamer is an amino-modified Salmonella typhimurium nucleic acid aptamer, the DNA sequence of which is shown in SEQ ID No: 1. The 5' end of the amino-modified Salmonella typhimurium nucleic acid aptamer is modified with an amino group. The first aptamer is in powder form.

[0091] (4) Preparation of quenching probe

[0092] (4.1) Add 1 mL of 1% chloroauric acid solution to 100 mL of distilled water and boil; quickly add 3.5 mL of 1% trisodium citrate solution and continue boiling for 15 min. Allow to cool naturally to room temperature to obtain the quenching solution containing gold nanoparticles, as follows: Figure 4 As shown.

[0093] (4.2) Take 80 μL of the second aptamer solution with a concentration of 10 μM, bathe it in water at 95 °C for 5 min, and then cool it at 4 °C for 5 min to obtain the annealing solution.

[0094] The second aptamer is the Salmonella typhimurium aptamer, whose DNA sequence is as follows: TAGCTACTACTCCTAGATGACGCCCTTTGAGGGGGTACAGACGCAATTGA AACGGTCGTTAATTT, as described in Chinese patent CN202410267120.1.

[0095] (4.3) Add 15 μL of the second activation mixture to the annealing solution and let it stand at room temperature for 30 min to obtain the reaction solution.

[0096] (4.4) Add 1 mL of quenching solution containing gold nanoparticles to the reaction solution, incubate at 37°C for 12 h, centrifuge at 10000 rpm for 20 min, remove the supernatant, and obtain the precipitate.

[0097] (4.5) Add 500 μL of 0.1 M phosphate buffer (PBS) at pH 7.4 to the precipitate, wrap in aluminum foil at 4°C to protect from light, and store to obtain the quenching probe. See [link to relevant documentation]. Figure 4 .

[0098] When the ultraviolet absorption wavelength shifts from 521 nm to 523 nm, it indicates that the second aptamer in the quenching probe has been successfully modified onto the gold nanoparticles.

[0099] (5) Preparation of biosensor detection reagents

[0100] The fluorescent probe and the quenching probe were mixed at a volume ratio of 1:1 to prepare a biosensor detection reagent for detecting Salmonella typhimurium. (See [link to relevant documentation]). Figure 5 .

[0101] Example 2

[0102] The biosensor detection reagent for detecting Salmonella typhimurium prepared in Example 1 was used for detection. The operation steps are as follows: prepare a series of standard solutions and perform measurements, establish a standard curve and regression equation, and detect the sample to be tested.

[0103] A standard curve and regression equation were established. The standard curve was plotted with the fluorescence intensity ratio F / F0 as the ordinate and the logarithm of the concentration of Salmonella typhimurium as the abscissa. The linear regression equation was obtained by fitting the curve, and its correlation coefficient and detection limit were calculated.

[0104] When testing the sample, the test solution is first prepared and mixed with the biosensor detection reagent prepared in this invention at the same volume ratio. After incubation, the fluorescence intensity F1 is measured. Substituting the fluorescence intensity ratio F1 / F0 into the above linear regression equation, the concentration of Salmonella typhimurium in the test sample can be calculated.

[0105] The biosensor detection reagent prepared in this invention exhibits a distinct emission peak at 516 nm, and the fluorescence intensity ratio F / F0 shows a good linear relationship with the logarithm of the *Salmonella typhimurium* concentration. The obtained linear regression equation is y = -0.1170x + 1.0197, with a correlation coefficient R0. 2 The value was 0.9981, and the limit of detection was 1.527 CFU / mL. See [link to relevant documentation]. Figure 6 .

[0106] Next, a specificity test was performed (using PBS solution as an example): 10% concentration of each solution was added to the system. 6 The fluorescence intensity ratios (F / F0) of test solutions containing CFU / mL of Listeria monocytogenes, Staphylococcus aureus, Escherichia coli, Cronobacter sakazakii, and Pseudomonas aeruginosa were 0.9860, 0.9632, 0.9321, 0.9431, and 0.9530, respectively. Under the same conditions, the fluorescence intensity ratio (F / F0) of the test solution containing Salmonella typhimurium was 0.2214; the fluorescence intensity ratio (F / F0) of the blank control was 1. These results indicate that the biosensor detection reagent prepared in this invention has good specificity for Salmonella typhimurium.

[0107] Example 3

[0108] Based on Example 2, the detection of real liquid food samples was added. Orange juice and milk were selected to test the amino-modified Salmonella typhimurium nucleic acid aptamer designed in this invention:

[0109] After centrifugation, the Salmonella typhimurium bacterial suspension was resuspended in orange juice and milk, respectively. Subsequently, serial dilutions were performed to prepare concentrations of 10⁻⁶ each time. 0 10¹, 10², 10³, 10 4 10 5 10 6 10 7 10 8 A series of bacterial test solutions containing CFU / mL were prepared. 100 μL of the fluorescence-quenched biosensor was mixed with an equal volume of blank control solution and test solutions of various concentrations of Salmonella typhimurium. The mixtures were incubated at 37°C for 40 minutes to obtain the corresponding incubation solutions. The fluorescence intensity of each incubation solution was measured at 516 nm at an excitation wavelength of 434 nm. The fluorescence intensity of the blank control solution was denoted as F0, and the fluorescence intensity of each bacterial test solution was denoted as F.

[0110] Subsequently, a standard curve and regression equation were established. A standard curve was plotted with the fluorescence intensity ratio F / F0 as the ordinate and the logarithm of the Salmonella typhimurium concentration as the abscissa. A linear regression equation was obtained by fitting the curve, and its correlation coefficient and detection limit were calculated. The linear regression equation obtained in orange juice was y = -0.1083x + 0.9715, with a correlation coefficient R0. 2 The value was 0.9961, and the limit of detection was 1.892 CFU / mL. See [link to relevant documentation]. Figure 7 The linear regression equation obtained in milk is y = -0.1101x + 0.9773, with a correlation coefficient R0. 2 The value was 0.9922, and the limit of detection was 3.507 CFU / mL. See [link to relevant documentation]. Figure 8 .

[0111] Example 4

[0112] Based on Example 3, the detection of real solid food samples was added, and pre-cooked marinated beef was selected to test the Salmonella typhimurium nucleic acid aptamer designed in this invention:

[0113] It should be noted that Example 4 was designed to verify the applicability of the standard curve y=-0.1170x+1.0197 in an interference environment, using pre-cured marinated beef as an example. Therefore, the experiment compared the actual bacterial count detected by the probe in artificially quantitative bacterial contamination with that in the pre-cured marinated beef sample to determine whether the biosensor detection reagent established in this invention can effectively detect bacteria in real samples under the influence of nutrients such as high protein, high fat, and high salt.

[0114] It should be noted that the pre-marinated beef involved in this embodiment 4 was purchased from a supermarket in China, and its ingredients are shown in Table 2 below.

[0115] Table 2 Component Table

[0116] Element Content (per 100g) energy 250 kilojoules (kJ) protein 25g Fat 15g Saturated fatty acids 6g carbohydrate 2g sugar 1g Salt 2.5g sodium 1000mg cholesterol 70mg iron 2.5mg Potassium 300mg

[0117] First, inoculate the pre-marinated beef with a final concentration of 10. 8 CFU / g of Salmonella Typhimurium was collected and allowed to stand at room temperature for 2 hours. Then, beef samples were diced. Subsequently, 25g of the diced samples were mixed with 25mL of sterile PBS buffer in a sterile bag and homogenized for 2 minutes to prepare a mixture. After standing for 5 minutes, the supernatant was collected, and the final concentration of Salmonella Typhimurium in the supernatant was adjusted to 10 by adding sterile PBS buffer. 6The concentration of CFU / mL was used as the test solution. Next, 500 μL of the test solution was mixed with 500 μL of the biosensor detection reagent of this invention, and incubated for 40 minutes to obtain the incubation solution. The fluorescence intensity of this incubation solution at 516 nm was measured at an excitation wavelength of 434 nm and recorded as F; the fluorescence intensity of the uninoculated blank control sample was measured under the same conditions and recorded as F0. Finally, the fluorescence intensity ratio F / F0 was substituted into the established linear regression equation to calculate the concentration of Salmonella typhimurium in the test sample.

[0118] The experimental results showed that, based on calculations, the concentration of Salmonella Typhimurium detected by the probe in pre-cooked marinated beef under conditions of artificial inoculation with Salmonella Typhimurium was 1.011 × 10⁻⁶. 6 CFU / mL, almost identical to its actual concentration of 1.0 × 10⁻⁶. 6 The CFU / mL values ​​are close, indicating that even without establishing a corresponding standard curve and linear regression equation under the pre-prepared marinated beef environment, the standard curve and linear regression equation established under the pure PBS sample environment still have good versatility. This shows that the biosensor detection reagent prepared in this invention has good versatility and can be quickly applied to the detection of different samples.

Claims

1. An amino-modified Salmonella typhimurium nucleic acid aptamer, characterized in that: The DNA sequence of the amino-modified Salmonella typhimurium nucleic acid aptamer is shown in SEQ ID No:

1. The 5' end of the amino-modified Salmonella typhimurium nucleic acid aptamer is modified with an amino group.

2. A biosensor detection reagent for detecting Salmonella Typhimurium based on an amino-modified Salmonella Typhimurium nucleic acid aptamer as described in claim 1, characterized in that: It is prepared by uniformly mixing a fluorescent probe as an energy donor and a quenching probe as an energy acceptor at a volume ratio of 1:

1. The fluorescent probe is a fluorescent nanozyme detection reagent modified with a first aptamer at a concentration of 10 μmol / L; The first aptamer is the amino-modified Salmonella typhimurium nucleic acid aptamer; The quenching probe is a gold nanoparticle detection reagent modified with a second aptamer at a concentration of 10 μmol / L; The second aptamer is a Salmonella typhimurium nucleic acid aptamer, wherein the 5' end of the Salmonella typhimurium nucleic acid aptamer is modified with a thiol group; The biosensor detection reagent has a linear detection range of 10 for Salmonella typhimurium. 1 ~10 7 CFU / mL, linear fitting correlation coefficient R 2 =0.9981, with a detection limit as low as 1.527 CFU / mL.

3. The method for preparing a biosensor detection reagent for detecting Salmonella typhimurium according to claim 2, characterized in that, The operation steps are as follows: (1) Preparation of the first activation mixture 19.2 mg of 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride and 5.75 mg of N-hydroxysuccinimide were dissolved in pure water and the volume was adjusted to 10 mL to obtain the first activation mixture. (2) Preparation of the second activation mixture 0.2867 g of tris(2-carboxyethyl)phosphonic acid hydrochloride was added to 100 mL of pure water to obtain the second activation mixture; (3) Preparation of fluorescent probes (3.1) Dissolve 0.242 g copper nitrate, 0.404 g ferric nitrate, 0.251 g manganese nitrate, 0.291 g nickel nitrate, 0.297 g zinc nitrate and 0.434 g cerium nitrate in 20 mL of deionized water and stir at 4 °C for 10 min; then sonicate at the same temperature to obtain a nitrate mixed solution. (3.2) Add 1 mL of N-(β-aminoethyl-γ-aminopropyl)methyldimethoxysilane and 2 mL of 10% tannic acid solution to the nitrate mixed solution, then add 10 mL of deionized water, and adjust the pH value to 5 with 0.1 mol / L dilute nitric acid to obtain the mixed solution. (3.3) Stir the mixed solution at 85℃ for 2h, add 4mL of tetraethyl orthosilicate and 15mL of deionized water, stir in an oil bath at 80℃ for 2h, and centrifuge at 8000rpm for 5min to obtain the precipitate; (3.4) The precipitate was washed three times with 10 mL of ethanol solution. The washed product was then freeze-dried under vacuum to obtain a dry powder. (3.5) The dry powder is calcined to obtain calcined powder; 1 mg of calcined powder is mixed with 100 mL of deionized water and cooled to room temperature to prepare a fluorescent nanozyme solution; (3.6) Mix 400 μL of fluorescent nanozyme solution and 250 μL of the first activation mixture by vortexing and incubate on a shaker at room temperature to obtain the fluorescent nanozyme incubation solution; (3.7) Mix the first aptamer with distilled water to prepare a first aptamer solution with a concentration of 10 μmol / L. Take 200 μL of the first aptamer solution and add it to the fluorescent nanozyme incubation solution. Vortex mix for 2 min and incubate on a shaker at room temperature to obtain the fluorescent probe. Wrap it in tin foil at 4℃ and store it in the dark. When the fluorescence emission wavelength of the fluorescent nanozyme solution shifts from 514 nm to 516 nm, it indicates that the first aptamer in the fluorescent probe has been successfully modified into the fluorescent nanozyme in the fluorescent solution. (4) Preparation of quenching probe (4.1) Add 1 mL of 1% chloroauric acid solution to 100 mL of distilled water and boil; quickly add 3.5 mL of 1% trisodium citrate solution and continue boiling for 15 min, then cool naturally to room temperature to obtain the quenching solution containing gold nanoparticles. (4.2) Take 80 μL of the second aptamer solution with a concentration of 10 μM, bathe it in a water bath at 95 °C for 5 min, and then cool it at 4 °C for 5 min to obtain the annealing solution; (4.3) Add 15 μL of the second activation mixture to the annealing solution and let it stand at room temperature for 30 min to obtain the reaction solution; (4.4) Add 1 mL of quenching solution containing gold nanoparticles to the reaction solution, incubate at 37°C for 12 h, centrifuge at 10000 rpm for 20 min, remove the supernatant, and obtain the precipitate; (4.5) Add 500 μL of 0.1 M phosphate buffer solution (PBS) with pH 7.4 to the precipitate, wrap it in tin foil at 4°C to protect it from light, and prepare the quenching probe; When the ultraviolet absorption wavelength shifts from 521 nm to 523 nm, it indicates that the second aptamer in the quenching probe has been successfully modified onto the gold nanoparticles. (5) Preparation of biosensor detection reagents At room temperature, the fluorescent probe and the quenching probe are mixed at a volume ratio of 1:1 to prepare a biosensor detection reagent for detecting Salmonella typhimurium.

4. The preparation method according to claim 3, characterized in that: In step (3.1), the ultrasound conditions are: frequency 40kHz, power 150W, and time 60min.

5. The preparation method according to claim 3, characterized in that: In step (3.4), the vacuum freeze-drying conditions are: vacuum degree 1 Pa, temperature -50℃, and time 24 h.

6. The preparation method according to claim 3, characterized in that: In step (3.5), the calcination conditions are: temperature 800℃ and time 6h.

7. The preparation method according to claim 3, characterized in that: In step (3.6), the room temperature shaker incubation conditions are: 180 rpm and 30 min.

8. The preparation method according to claim 3, characterized in that: In step (3.7), the room temperature shaker incubation conditions are: 180 rpm and 2.5 h.

Images