Application of arachidonic acid ethanolamine as respiratory syncytial virus infection biomarker
By detecting the content of arachidonic acid ethanolamine (AEA) and the expression level of FAAH, the timeliness and specificity problems of RSV infection diagnosis have been solved, achieving early diagnosis with high sensitivity and specificity, and providing a new therapeutic target for RSV infection.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- CITY UNIVERSITY OF HONG KONG
- Filing Date
- 2026-01-09
- Publication Date
- 2026-05-15
AI Technical Summary
Existing diagnostic methods for respiratory syncytial virus (RSV) infection are not timely, have a high false negative rate, and lack specific antiviral drugs and effective vaccines. Clinical treatment mainly relies on supportive measures, and the small molecular markers in host cells are still unclear.
Arachidonic acid ethanolamine (AEA) was used as a biomarker. By detecting its content and the expression level of the degradation enzyme gene FAAH, ultra-high performance liquid chromatography-mass spectrometry was used to diagnose respiratory syncytial virus infection at an early stage.
It provides a highly sensitive and specific diagnostic method for RSV infection, enabling early detection and assessment of the degree of infection, providing a basis for clinical treatment, and promoting the transformation of RSV prevention and control towards precision early warning and targeted intervention.
Smart Images

Figure CN122042837A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, and in particular to the application of arachidonic acid ethanolamine as a biomarker for respiratory syncytial virus infection. Background Technology
[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.
[0003] RSV (Respiratory Syncytial Virus) infection is one of the leading pathogens causing severe lower respiratory tract infections in infants, the elderly, and immunocompromised individuals. It has become the second leading cause of viral infection-related deaths in infants in developing countries. With advancements in medical technology, diagnostic testing for RSV infection has become an indispensable part of public health systems, and accurate and rapid detection is crucial for RSV prevention and control.
[0004] Currently, diagnostic methods for RSV infection mainly include nucleic acid testing, antigen testing, and immunological testing. However, nucleic acid testing has poor timeliness, antigen testing has a high false negative rate, and immunological testing cannot distinguish between acute and past infections. Furthermore, although the molecular biological characteristics of RSV have been extensively studied, its pathogenic molecular mechanisms remain incompletely understood. Therefore, the prevention and treatment of RSV infection still lacks specific antiviral drugs and effective vaccines, with clinical treatment primarily relying on supportive measures such as oxygen therapy and mechanical ventilation. In recent years, metabolomics technology has provided a new perspective for elucidating viral infection mechanisms, and research on metabolites as disease biomarkers has moved from technological exploration to clinical translation. Therefore, screening a specific metabolite as a highly sensitive diagnostic biomarker for RSV infection will drive the transformation of RSV prevention and treatment towards "precision early warning and targeted intervention."
[0005] Based on this, the applicant has submitted this application through in-depth research on the molecular mechanism of RSV infection. Summary of the Invention
[0006] This invention provides the application of arachidonic acid ethanolamine (AEA) as a biomarker for respiratory syncytial virus (RSV) infection, aiming to address the current research's lack of clear small molecule biomarkers in host cells after RSV infection and the absence of specific metabolic detection targets. This study, after clarifying the metabolomic changes in RSV-infected host cells, suggests that AEA content can serve as a small molecule biomarker for evaluating the degree of RSV infection in cells, thus solving the problems existing in the prior art.
[0007] One of the technical solutions adopted in this invention is: The application of arachidonic acid ethanolamine as a biomarker for respiratory syncytial virus (RSV) infection is provided; specifically, the application of arachidonic acid ethanolamine as a biomarker in the preparation of products for non-diagnostic purposes to detect RSV infection is provided.
[0008] Furthermore, the above applications can be used for the early diagnosis of respiratory syncytial virus infection by detecting the content of arachidonic acid ethanolamine, or by simultaneously detecting the content of arachidonic acid ethanolamine and the expression level of its degradation enzyme gene FAAH.
[0009] Furthermore, the samples used for testing were respiratory epithelial cells. When the content of arachidonic acid ethanolamine in these cells was higher than that in the uninfected group, it indicated that the patient had respiratory syncytial virus infection.
[0010] Furthermore, when the content of arachidonic acid ethanolamine is increased and the expression level of FAAH is decreased, it indicates that the patient has respiratory syncytial virus infection.
[0011] Furthermore, the content of arachidonic acid ethanolamine (AEA) was detected by ultra-high performance liquid chromatography-mass spectrometry.
[0012] Furthermore, the AEA content in samples infected with respiratory syncytial virus was significantly upregulated compared to the uninfected group; the upregulation was 3-4 times.
[0013] Furthermore, the chromatographic conditions for the above ultra-high performance liquid chromatography-mass spectrometry are as follows: Chromatographic column: (UHPLC) HILIC, column temperature 25℃; flow rate 0.5 mL / min; injection volume 2 μL; mobile phase composition A: water + 25 mM ammonium acetate + 25 mM ammonia; mobile phase B: acetonitrile; gradient elution program as follows: 0-0.5 min, 95%; 0.5-7 min, B linearly changes from 95% to 65%; 7-8 min, B linearly changes from 65% to 40%; 8-9 min, B remains at 40%; 9-9.1 min, B linearly changes from 40% to 95%; 9.1-12 min, B remains at 95%.
[0014] The mass spectrometry conditions for the above ultra-high performance liquid chromatography-mass spectrometry are as follows: The Triple TOF 6600 mass spectrometer has the following ESI source settings: Nebulizer gas auxiliary heating gas 1 (Gas1): 60, auxiliary heating gas 2 (Gas2): 60, curtain gas (CUR): 30 psi, ion source temperature: 600℃, spray voltage (ISVF) ±5500V (positive and negative modes); primary mass-to-charge ratio detection range: 60-1000 Da, secondary fragment ion mass-to-charge ratio detection range: 25-1000 Da, primary mass spectrum scan cumulative time: 0.20 s / spectra, secondary mass spectrum scan cumulative time: 0.05 s / spectra; secondary mass spectra are acquired using data-dependent acquisition mode (IDA) with peak intensity filtering mode, declustering voltage (DP): ±60 V (positive and negative modes), collision energy: 35±15 eV, IDA settings are as follows: dynamic exclusion range of isotopic ions: 4 Da, 10 fragment spectra are acquired per scan.
[0015] Furthermore, the product includes reagents or kits.
[0016] Furthermore, the reagents include primers, probes, antibodies, or nucleic acid chips for detecting RSV.
[0017] Furthermore, the reagent includes primers or probes for detecting the FAAH gene.
[0018] Furthermore, the primers are primer pairs used to detect the expression level of the FAAH gene; the primer sequences are shown in SEQ ID NO.1 and SEQ ID NO.2.
[0019] Specifically, SEQ ID NO.1: 5'-CTGCTCTGGACTTGAATGCC-3'; SEQ ID NO. 2: 5' - CCCCAAAGTAGCCCCTGTAA-3'.
[0020] Furthermore, the kit includes the primers described above, as well as cDNA, SYBR Green premix, and RNase-free water.
[0021] The beneficial effects of the present invention include, but are not limited to: 1. This invention's applied research revealed that arachidonic acid ethanolamine (AEA) levels were significantly upregulated in RSV-infected respiratory epithelial cells, while no significant differences were observed in AEA levels in other viral infections. This provides an application method for RSV infection detection and treatment based on changes in AEA levels. Further molecular mechanism studies of RSV infection showed that RSV inhibits the expression of the AEA-degrading enzyme FAAH, reducing AEA enzymatic degradation and consequently increasing AEA levels in RSV-infected cells. Therefore, RSV infection can be detected and assessed by detecting FAAH expression and AEA levels. AEA can serve as a novel target for RSV infection detection and treatment, which is of great significance for the early detection and prevention of RSV infection in clinical practice.
[0022] 2. This invention explores the regulatory role of RSV on the metabolome of host cells by establishing an in vitro RSV infection model, and discovers the possible metabolic molecular mechanism by which RSV escapes the host immune response. This provides a new target and theoretical basis for the prevention and treatment of RSV infection, and suggests that AEA can be used as a molecular marker to detect early RSV infection in host cells. Attached Figure Description
[0023] Figure 1 For the detection of changes in AEA content (A) and fold increase (B) in respiratory epithelial cells before and after RSV infection using mass spectrometry in this invention, * p<0.05, ** p<0.01, *** p<0.001, NS showed no significant difference; Figure 2 The changes in AEA content before and after respiratory epithelial cell infection by other viruses (EVA-71, HCoV-OC43) used for comparison in this invention are shown in the figures. * p < 0.05, ** p < 0.01, *** p < 0.001, NS showed no significant difference. Figure 3 This is a schematic diagram of the synthesis and catabolic pathway of AEA in this invention; Figure 4 For the detection of RSV metabolic enzyme expression in RSV-infected respiratory epithelial cells by real-time quantitative PCR in this invention, * p<0.05, ** p<0.01, *** p<0.001, NS showed no significant difference; Figure 5 To verify the downregulation of AEA-degrading enzyme FAAH expression using Western blot, * p < 0.05, ** p < 0.01, *** p < 0.001, NS showed no significant difference.
[0024] in, Figure 4The values of AC correspond to the relative expression levels of RSV metabolic enzymes NAT, NAPEPLD, and FAAH in RSV-negative and infected cells, respectively. Detailed Implementation
[0025] To clearly illustrate the technical features of this solution, the invention will be described in detail below through specific embodiments and in conjunction with the accompanying drawings. It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0026] As a typical specific embodiment of the present invention, the application of arachidonic acid ethanolamine as a biomarker in the preparation of products for detecting respiratory syncytial virus infection is provided.
[0027] The application detects the content of arachidonic acid ethanolamine in a sample, or simultaneously detects the content of arachidonic acid ethanolamine and the expression level of its degradation enzyme gene FAAH, for the early diagnosis of respiratory syncytial virus infection.
[0028] The samples used for the above tests can be respiratory epithelial cells. Elevated levels of arachidonic acid ethanolamine (FAAH) indicate respiratory syncytial virus (RSV) infection. Generally, RSV-infected samples show elevated FAAH levels and decreased FAAH expression.
[0029] In the above applications, the content of arachidonic acid ethanolamine was detected by ultra-high performance liquid chromatography-mass spectrometry (UHPLC-Q-TOFMS).
[0030] The products mentioned in the above applications can be reagents or test kits for detecting RSV infection, and the test reagents can be primers or probes.
[0031] Furthermore, the above detection reagents can be primers used to detect the expression level of the degradation enzyme gene FAAH that degrades AEA using the real-time PCR detection method.
[0032] Through in-depth research, this invention has shown through molecular mechanism studies of RSV infection that RSV reduces the enzymatic degradation of AEA by inhibiting the expression of the AEA-degrading enzyme FAAH, thereby increasing the amount of AEA in RSV-infected cells. Therefore, by detecting the expression level of AEA in samples, it is possible to assist in the early diagnosis, assessment and guidance of RSV infection treatment.
[0033] The technical solution of the present invention will be described in detail below with reference to specific embodiments. The equipment, raw materials, and reagents used are all commercially available or commonly used in the art. Unless otherwise specified, the methods in the following embodiments are conventional methods in the art.
[0034] The respiratory syncytial virus (RSV) used in the following embodiments of the present invention was a standard strain purchased from the American Standard Microbial Library (ATCC); enterovirus A71 EVA-71 was obtained from the Shenzhen Center for Disease Control and Prevention; and human coronavirus HCoV-OC43 was a standard strain purchased from the American Standard Microbial Library (ATCC).
[0035] Example 1: Preparation and Analysis of RSV-Infected Cell Samples I. Cell Culture Human laryngeal epidermoid carcinoma cells (HEP-2) were cultured in complete DMEM medium containing 10% FBS and 1% penicillin-streptomycin in a 37°C cell culture incubator containing 5% CO2; human bronchial epithelioid cells (16HBE) were cultured in 1640 medium containing 10% FBS and 1% penicillin-streptomycin in a 37°C cell culture incubator containing 5% CO2.
[0036] II. RSV Culture RSV was inoculated into HEP-2 cells that were being cultured in DMEM medium containing 2% FBS and 1% penicillin-streptomycin. The viral titer was then measured after culturing the cells in a 37°C cell culture incubator containing 5% CO2 for 5-7 days.
[0037] III. Establishment of RSV Infection Model The cultured 16HBE cells were seeded in 1640 medium containing 2% FBS and infected with RSV at MOI=1. The mixture was stirred every 15-20 min. After 2 h of infection, the virus solution was discarded and the cells were cultured in 1640 medium containing 2% FBS at 37°C in a cell culture incubator containing 5% CO2 for 24 h.
[0038] IV. Sample Preparation for AEA Detection After washing the cultured cells three times with pre-cooled DPBS, the cells were collected using a cell scraper into 1.5 mL centrifuge tubes free of endotoxin. The samples were then rapidly frozen in liquid nitrogen for 15 min, then thawed on dry ice for 5 min, and then thawed on ice for another 15 min. The samples were then mixed by shaking on a shaker for 2 min. This process was repeated three times.
[0039] Subsequently, an appropriate amount of sample was added to a pre-cooled methanol / acetonitrile / water solution (2:2:1, v / v), vortexed, sonicated at low temperature for 30 min, allowed to stand at -20℃ for 10 min, centrifuged at 14000 g and 4℃ for 20 min, the supernatant was collected and vacuum dried, and 100 μL of acetonitrile aqueous solution (acetonitrile:water = 1:1, v / v) was added to redissolve the sample before mass spectrometry analysis, vortexed, centrifuged at 14000 g and 4℃ for 15 min, and the supernatant was injected for analysis.
[0040] V. Ultra-high performance liquid chromatography-mass spectrometry (UHPLC-Q-TOF MS) analysis 5.1 Chromatographic conditions: Samples were separated using an Agilent 1290 Infinity LC ultra-high performance liquid chromatography (UHPLC) system with a HILIC column; column temperature 25℃; flow rate 0.5 mL / min; injection volume 2 μL; mobile phase composition A: water + 25 mM ammonium acetate + 25 mM ammonia, B: acetonitrile; gradient elution program as follows: 0-0.5 min, 95%; 0.5-7 min, B linearly changes from 95% to 65%; 7-8 min, B linearly changes from 65% to 40%; 8-9 min, B maintains at 40%; 9-9.1 min, B linearly changes from 40% to 95%; 9.1-12 min, B maintains at 95%; throughout the analysis, samples were placed in an autosampler at 4℃. To avoid the influence of instrument signal fluctuations, samples were analyzed continuously in a randomized order. QC samples were inserted into the sample queue to monitor and evaluate the stability of the system and the reliability of the experimental data.
[0041] 5.2 Q-TOF Mass Spectrometry Conditions: First-order and second-order spectra of the samples were acquired using an AB Triple TOF 6600 mass spectrometer. After separation using an Agilent 1290 Infinity LC ultra-high performance liquid chromatography (UHPLC) system, mass spectrometry analysis was performed using a Triple TOF 6600 mass spectrometer (AB SCIEX), with detection performed in both positive and negative electrospray ionization (ESI) modes. The ESI source settings are as follows: Auxiliary heating gas 1 (Gas1): 60, Auxiliary heating gas 2 (Gas2): 60, Curtain gas (CUR): 30psi, Ion source temperature: 600℃, Spray voltage (ISVF): ±5500 V (positive and negative modes); Primary mass-to-charge ratio detection range: 60-1000 Da, Secondary fragment ion mass-to-charge ratio detection range: 25-1000 Da, Primary mass spectrometry scan cumulative time: 0.20 s / spectra, Secondary mass spectrometry scan cumulative time: 0.05 s / spectra; Secondary mass spectrometry is obtained using data-dependent acquisition mode (IDA) and peak intensity value screening mode, Declustering voltage (DP): ±60V (positive and negative modes), Collision energy: 35±15 eV, IDA settings are as follows: Dynamic exclusion range of isotopic ions: 4 Da, 10 fragment spectra are acquired per scan.
[0042] Mass spectrometry results of AEA content in respiratory epithelial cells after RSV infection, such as... Figure 1 As shown in the figure. It can be seen from the figure that the infected group ( Figure 1 The AEA content of RSV+ was lower than that of the uninfected group ( Figure 1 The value of RSV- was increased by approximately 4 times.
[0043] VI. Quantitative Real-Time PCR Analysis Total RNA was extracted from RSV-infected cell samples. Then, RNase-free DNase I was used to remove DNA contamination from the extracted RNA. The reaction mixture consisted of: 5 × gDNA Eraser Buffer: 2 μL; gDNA Eraser: 1 μL; Total RNA: 1 μg; RNase-free H2O: brought to a final volume of 10 μL. The reaction conditions were: 42℃, 2 min. The reverse transcription reaction mixture consisted of: DNA-free RNA reaction solution: 10 μL; 5 × PrimeScript Buffer: 4 μL; PrimeScript RTEnzyme Mix I: 1 μL; RT Primer Mix: 1 μL; RNase-free H2O: 4 μL. The reaction conditions were: 37℃, 15 min; 85℃, 5 s.
[0044] The obtained cDNA was frozen at -80℃ for later use. Using the obtained cDNA as a template, the mRNA expression levels of NAT, NAPE-PLD, FAAH, and the internal control gene GAPDH were detected by qRT-PCR. The total volume of the qRT-PCR reaction was 20 μL, containing 200 ng cDNA, 10 μL 2× SYBR Green Master Mix, 0.6 μL each of 10 μM forward and reverse primers, and 6.8 μL RNase-free H2O. A comparative threshold cycling (2...) was used. -ΔΔCT (Method) Calculate the relative concentration.
[0045] The primer sequence information used to detect NAT, NAPE-PLD, FAAH, and the internal control gene GAPDH is shown in the table below: Primer name Primer sequence (5' - 3') NAT-F GGGGATGCCATGGACTTAGG (SEQ ID NO.3) NAT-R CCTCCCAACATCGTGGTCTC (SEQ ID NO.4) NAPE-PLD-F GAGCTTATGAACCGAGGTGGT (SEQ ID NO.5) NAPE-PLD-R TCAGCTTCACTGGAGGCTCT (SEQ ID NO.6) FAAH-F CTGCTCTGGACTTGAATGCC (SEQ ID NO.1) FAAH-R CCCCAAAGTAGCCCCTGTAA (SEQ ID NO.2) GAPDH-F GAAAGCCTGCCGGTGACTAA (SEQ ID NO.7) GAPDH-R GCCCAATACGACCAAATCAGAG (SEQ ID NO.8) like Figure 3 As shown, intracellular AEA is mainly generated by NAT catalyzing membrane phospholipids and arachidonic acid to produce NAPE. NAPE is then catalyzed by NAPE-PLD, while AEA is decomposed into arachidonic acid and ethanolamine by FAAH. FAAH can rapidly decompose AEA to maintain the stability of intracellular AEA.
[0046] The above results of quantitative real-time PCR detection of transcriptional levels of AEA metabolism-related enzymes are as follows: Figure 4As shown, RSV had no significant effect on the transcriptional levels of AEA-related enzymes NAT and NAPE-PLD. Figure 4 (A, B), and can significantly inhibit the transcriptional level of its degradation-related enzyme FAAH ( Figure 4 (C) The above results suggest that RSV may mediate the enrichment of AEA by inhibiting the transcriptional level of FAAH-related genes.
[0047] VII. Western blot Cell lysis buffer was added to lyse the sample cells. The lysis buffer was collected in endotoxin-free finger tubes and centrifuged at 2000 rpm for 5 min to remove cell debris. 200 μL of the supernatant was transferred to a new endotoxin-free finger tube, and 50 μL of 5× Laemmli buffer was added. The tube was incubated at 100°C for 10 min, followed by electrophoresis on a 12% polyacrylamide gel. The proteins from the polyacrylamide gel were transferred to an NC membrane and blocked with TBST containing 1% BSA at room temperature for 2 h. The NC membrane was then washed with TBST for 5 min, repeated 3 times. The corresponding diluted antibody (human FAAH monoclonal antibody, 1:1000) was added to the NC membrane and incubated overnight at 4°C on a shaker. The NC membrane was washed with TBST for 5 min, repeated 5 times. The HRP-labeled anti-IgG secondary antibody (1:5000) was added to the NC membrane and incubated on a shaker at room temperature for 1 h. The NC membrane was washed with TBST for 5 min, repeated 5 times, and then ECL chemiluminescent substrate was added to the NC membrane for color development. The protein bands were then analyzed using Image-J software.
[0048] like Figure 5 As shown, RSV infection significantly inhibited the expression of FAAH in host cells, while AEA was highly sensitive to FAAH, with a Km of only 2 μM. These results indicate that RSV infection of respiratory epithelial cells in the early stage mediates the accumulation of AEA in host cells by inhibiting the expression of FAAH protein.
[0049] Example 2: Preparation and Analysis of Cell Samples Infected with EVA-71 I. Cell Culture: Rhabdomyosarcoma cells (RD) were cultured in complete DMEM medium containing 10% FBS and 1% penicillin-streptomycin in a 37°C cell culture incubator containing 5% CO2; human bronchial epithelioid cells (16HBE) were cultured in 1640 medium containing 10% FBS and 1% penicillin-streptomycin in a 37°C cell culture incubator containing 5% CO2.
[0050] II. EV-A71 virus culture: EV-A71 was inoculated into RD cells cultured in DMEM medium containing 2% FBS and cultured in a cell culture incubator at 37°C containing 5% CO2 for 5-7 days before the virus titer was detected.
[0051] III. For the establishment of the EV-A71 infection model, preparation of AEA detection samples and mass spectrometry analysis, please refer to the relevant operations in Example 1.
[0052] See results Figure 2 ,Depend on Figure 2 It can be seen that after EV-A71 infection, the AEA content was not significantly different from that in the uninfected group.
[0053] Example 3: Preparation and Analysis of Cell Samples Infected with HCoV-OC43 I. Cell culture is the same as the cell culture content in Example 2.
[0054] II. Culture of HCoV-OC43 virus: HCoV-OC43 was inoculated into RD cells cultured in DMEM medium containing 2% FBS and cultured in a cell culture incubator at 37°C containing 5% CO2 for 5-7 days before the viral titer was detected.
[0055] III. For details on virus infection model establishment, AEA detection sample preparation, and mass spectrometry analysis, please refer to the relevant procedures in Example 1.
[0056] See results Figure 2 It was found that after HCoV-OC43 infection, the AEA content was not significantly different from that in the uninfected group.
[0057] The results of the above examples suggest that AEA content has high specificity in RSV-infected respiratory epithelial cells, and it can serve as a new target for RSV infection detection and treatment, which is of great significance for the early detection and prevention of RSV infection in clinical practice.
[0058] The above specific embodiments should not be construed as limiting the scope of protection of the present invention. For those skilled in the art, any alternative improvements or modifications made to the embodiments of the present invention shall fall within the scope of protection of the present invention.
[0059] Any aspects of this invention not described in detail are well-known to those skilled in the art.
Claims
1. Application of arachidonic acid ethanolamine as a biomarker in the preparation of products for non-therapeutic detection of respiratory syncytial virus infection.
2. The application according to claim 1, characterized in that, The content of arachidonic acid ethanolamine, or the content of arachidonic acid ethanolamine and the expression level of its degradation enzyme gene FAAH, can be used for the early diagnosis of respiratory syncytial virus infection.
3. The application according to claim 2, characterized in that, The samples used for testing were respiratory epithelial cells. When the content of arachidonic acid ethanolamine in these cells was higher than that in the uninfected group, it indicated that the patient had respiratory syncytial virus infection.
4. The application according to claim 3, characterized in that, When the content of arachidonic acid ethanolamine is increased and the expression level of FAAH is decreased, it indicates that the patient has respiratory syncytial virus infection.
5. The application according to claim 2 or 3, characterized in that, The content of arachidonic acid ethanolamine (AEA) was determined by ultra-high performance liquid chromatography-mass spectrometry.
6. The application according to claim 1, 2, or 4, characterized in that, The product includes a reagent or a kit containing the reagent.
7. The application according to claim 6, characterized in that, The reagents include primers or probes for detecting the FAAH gene.
8. The application according to claim 7, characterized in that, The primers are primer pairs used to detect the expression level of the FAAH gene, and the primer sequences are shown in SEQ ID NO.1 and SEQ ID NO.2.