Bispecific nucleic acid aptamer targeting sFlt-1 and A beta1-42 as well as screening method and application of bispecific nucleic acid aptamer

By developing the bispecific nucleic acid aptamer Apt-BS03 and employing an improved screening method, the problems of single treatment and low screening efficiency in existing preeclampsia technologies have been solved. Synergistic targeting of sFlt-1 and Aβ1-42 has been achieved, providing a novel treatment option for preeclampsia.

CN122060744APending Publication Date: 2026-05-19FIRST PEOPLES HOSPITAL OF YUNNAN PROVINCE
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
FIRST PEOPLES HOSPITAL OF YUNNAN PROVINCE
Filing Date
2026-02-04
Publication Date
2026-05-19

AI Technical Summary

Technical Problem

Existing treatments for preeclampsia are limited, single-target drugs have limited efficacy, and existing bispecific nucleic acid aptamers have low screening efficiency and are prone to generating mixed sequences. There is a lack of bispecific nucleic acid aptamers that can simultaneously target sFlt-1 and Aβ1-42.

Method used

A bispecific nucleic acid aptamer, Apt-BS03, is provided that can simultaneously bind to sFlt-1 and Aβ1-42. An improved alternating target screening combined with an affinity subtraction strategy is used for efficient screening. Combined with stability modification, a pharmaceutical composition is prepared for the treatment of preeclampsia.

Benefits of technology

This study has achieved a novel treatment strategy for preeclampsia, which reverses the pathological process through the synergistic effect of targeting sFlt-1 and Aβ1-42, providing an efficient and precise treatment option with significant clinical application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122060744A_ABST
    Figure CN122060744A_ABST
Patent Text Reader

Abstract

The invention discloses a bispecific nucleic acid aptamer targeting sFlt-1 and A beta1-42 as well as a screening method and application of the bispecific nucleic acid aptamer, and belongs to the technical field of biological medicines. The aptamer is a single-stranded DNA molecule and can be simultaneously and specifically bound with human-derived sFlt-1 protein and A beta 1-42 polypeptide with nanomole affinity, and the nucleotide sequence of the aptamer has at least 80% identity with a sequence shown in SEQ ID NO: 1 or is a derivative sequence of the aptamer. The invention also discloses a screening method for obtaining the aptamer by adopting a strategy of alternating target screening combined with affinity deduction, and efficiently enriching a bispecific sequence through multiple rounds of screening and progressive increase of screening pressure. In addition, the invention also provides a pharmaceutical composition containing the aptamer and application of the pharmaceutical composition in preparation of drugs for preventing and / or treating preeclampsia. The bispecific nucleic acid aptamer can simultaneously intervene in two key pathogenic pathways of preeclampsia, has the advantages of high specificity, high affinity, low immunogenicity and the like, provides a brand new targeted therapy scheme for preeclampsia, and has a wide clinical application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a bispecific nucleic acid aptamer capable of simultaneously and specifically binding to the key pathogenic factors of preeclampsia, sFlt-1 and Aβ1-42. It also relates to a screening method for the aptamer, a pharmaceutical composition containing the aptamer, and its application in the prevention and / or treatment of preeclampsia. Background Technology

[0002] Preeclampsia is a serious complication specific to pregnancy that severely impacts maternal and infant health and is one of the leading causes of maternal and perinatal mortality worldwide. Currently, its pathogenesis is not fully understood, and there are no effective clinical treatments; termination of pregnancy remains the only curative method.

[0003] Existing research indicates that the pathogenesis of preeclampsia involves multiple aspects:

[0004] ① Placental factors: Placental ischemia and hypoxia lead to the release of anti-angiogenic factors, among which soluble FMS-like tyrosine kinase-1 (sFlt-1) is the core pathogenic factor. sFlt-1 leads to systemic vascular endothelial dysfunction by antagonizing the signaling pathways of vascular endothelial growth factor (VEGF) and placental growth factor (PlGF), causing typical symptoms such as hypertension and proteinuria.

[0005] ② Abnormal deposition of amyloid protein: Recent studies have found that β-amyloid protein (Aβ), especially Aβ1-42, is abnormally deposited in the placental tissue of patients with preeclampsia, and may participate in the pathogenesis of the disease by inducing oxidative stress and trophoblast dysfunction.

[0006] Currently, treatment strategies for preeclampsia mainly focus on lowering blood pressure, relieving spasms, and sedation, which cannot fundamentally reverse the condition. Some treatments target sFlt-1. For example, Chinese patent CN118489063A discloses a biomarker for the prognosis of early-onset preeclampsia, namely sFlt-1. It discloses that sFlt-1 can be used as a biomarker for the prognosis, prediction, and risk assessment of preeclampsia in pregnant subjects. However, the efficacy of single-target drugs is limited.

[0007] As shown above, both Aβ1-42 and sFlt-1 can serve as targets for the targeted therapy of preeclampsia. Given the limitations of single-target drugs, providing a bispecific targeted drug for the treatment of preeclampsia has significant scientific and clinical value.

[0008] Nucleic acid aptamers are small single-stranded DNA or RNA molecules obtained through in vitro screening technology (SELEX). They possess advantages such as high affinity, high specificity, low immunogenicity, and ease of synthesis and modification, and are hailed as "chemical antibodies." For example, the study "Enhancing the Anti-Adenocarcinoma Killing Effect of Novel Bispecific Nucleic Acid Aptamers" by Li Zhaoyi constructed a bispecific nucleic acid aptamer BBiApt targeting MUC1-CD16. This aptamer assembles two MUC1 aptamer molecules and two CD16 aptamer molecules together to form a single molecular structure. This BBiApt molecule shows a greater affinity for MUC1-positive tumor cells and NK cells than monovalent aptamer molecules. Furthermore, immune cells can be recruited to the vicinity of tumor cells with the assistance of BBiApt, significantly enhancing their anti-tumor killing function. It can bind to both MUC1-positive tumor cells and CD16-positive immune cells, and can recruit NK cells to the vicinity of tumor cells, enhancing the NK cell killing function against tumor cells.

[0009] Therefore, bispecific nucleic acid aptamers can be used as a novel strategy for drug research. This invention combines the association between Aβ1-42 and sFlt-1 with preeclampsia, and is based on the fact that there are currently no reports on bispecific nucleic acid aptamers that can simultaneously target sFlt-1 and Aβ1-42. Existing treatments for preeclampsia are limited in scope and the effects of single-target drugs are limited. Furthermore, existing bispecific nucleic acid aptamers have technical defects such as low screening efficiency and easy generation of mixed sequences. This invention aims to provide a bispecific nucleic acid aptamer that targets sFlt-1 and Aβ1-42, as well as its screening method and application. Summary of the Invention

[0010] To address the aforementioned technical problems, this invention provides a bispecific nucleic acid aptamer capable of specifically binding to both sFlt-1 and Aβ1-42 simultaneously. This aptamer can simultaneously intervene in two key pathogenic pathways of preeclampsia. Furthermore, it provides an efficient and precise screening method, overcoming the bottlenecks of traditional screening techniques. In addition, it provides a pharmaceutical composition containing this aptamer and its application in the treatment of preeclampsia, offering a novel clinical option. The specific technical solution is as follows:

[0011] The first objective of this invention is to provide a bispecific nucleic acid aptamer, Apt-BS03, capable of specifically binding to both sFlt-1 and Aβ1-42 simultaneously; the nucleotide sequence of Apt-BS03 is shown in SEQ ID NO:1, and the sequence shown in SEQ ID NO:1 is as follows: GCCAGCCACGCTCCT CGACCGGACTATAATGATACCAGGCGTTTCCCCCTGGAAG GGAGT AGCACGGCAG .

[0012] Furthermore, the bispecific nucleic acid aptamer Apt-BS03 is a single-stranded DNA molecule that can simultaneously and specifically recognize human sFlt-1 protein and human Aβ1-42 polypeptide, without specifically binding to other unrelated proteins or polypeptides; wherein the Kd with sFlt-1 is 12.8±0.9 nM, and the Kd with Aβ1-42 is 18.1±1.3 nM.

[0013] Furthermore, the nucleic acid aptamer sequence that simultaneously binds sFlt-1 and Aβ1-42 with bispecificity has at least 80% identity with the sequence shown in SEQ ID NO:1, or is a derivative sequence of the sequence shown in SEQ ID NO:1 by substitution, deletion or addition of one or more bases, and retains the bispecific binding function.

[0014] Furthermore, the aptamer is subjected to stability modification, the modification being selected from one or more of thiophosphorylation skeleton modification, 2'-fluoro modification, or 2'-O-methylation modification.

[0015] The second objective of this invention is to provide a method for screening bispecific nucleic acid aptamers that can specifically bind to both sFlt-1 and Aβ1-42 simultaneously. Specifically, this method employs an improved alternating target screening combined with an affinity subtraction strategy. Through two rounds of affinity subtraction steps, single-specific sequences are actively eliminated, efficiently enriching true bispecific sequences. The method includes the following steps:

[0016] a) Provide a single-stranded nucleic acid initial library, wherein the nucleotide sequence of the initial library is 5'-GCCAGCCACGCTCCT(N40)GGAGTAGCACGGCAG-3', where N40 represents 40 random bases;

[0017] b) First round of screening: The library is brought into contact with the first target, and the first nucleic acid molecule that binds to the first target is collected. The first target is either sFlt-1 protein or Aβ1-42 polypeptide.

[0018] c) First affinity deduction step: co-incubate the first nucleic acid molecule with an excess of free second target, and collect the nucleic acid molecules that have been competed for by the second target, wherein the second target is an Aβ1-42 polypeptide or sFlt-1 protein that is different from the first target;

[0019] d) Second round of screening: The nucleic acid molecules collected in step c) are brought into contact with the second target to collect the second nucleic acid molecules that bind to the second target;

[0020] e) Second affinity reduction step: co-incubate the second nucleic acid molecule with excess free first target, and collect the nucleic acid molecules that are still bound to the second target;

[0021] f) Amplification step e) Collect nucleic acid molecules to obtain an enriched nucleic acid library;

[0022] g) Repeat steps b) to f) multiple times until a rich library that meets the requirements is obtained;

[0023] h) The final enriched library is cloned, sequenced, and functionally validated to obtain the bispecific nucleic acid aptamer.

[0024] The key innovation is the “affinity deduction step”, which actively eliminates sequences that can bind to two targets simultaneously (in the first step) or sequences that can only bind to a single target (in the second step), forcing the screening to proceed towards enriching bispecific sequences.

[0025] Furthermore, step g) is repeated 8-10 times, and the order of the first target and the second target is alternated in each round, with the screening pressure gradually increasing during the process.

[0026] Furthermore, the method for increasing the screening pressure is as follows: from round 1-2 to round 9-10, the target dosage is gradually reduced from 10-12.5 μg to 0.6-0.75 μg, the incubation time is gradually shortened from 60 min to 15 min, the number of washes is gradually increased from 3 to 7, and 0.01% Tween-20 is added to the washing solution from round 5 onwards.

[0027] A third object of the present invention is to provide a pharmaceutical composition comprising a bispecific nucleic acid aptamer and a pharmaceutically acceptable carrier.

[0028] A fourth objective of this invention is to provide the use of a pharmaceutical composition containing the above-mentioned bispecific nucleic acid aptamer in the preparation of a medicament for the prevention and / or treatment of preeclampsia, thus providing a novel treatment option for clinical practice.

[0029] Furthermore, the dosage forms of the drug include injections, lyophilized preparations, topical preparations, oral preparations, and sterile nebulized liquid or dry powder inhalers.

[0030] Furthermore, the pharmaceutically acceptable carriers include, but are not limited to, physiological saline, phosphate buffer, glucose solution, albumin, etc., and appropriate carriers and dosage forms can be selected according to the route of administration (such as intravenous injection or subcutaneous injection).

[0031] Furthermore, the drug can neutralize the activity of sFlt-1 protein, inhibit the abnormal deposition of Aβ1-42 peptide, or reverse the inhibitory effect of sFlt-1 on the VEGF signaling pathway to exert a therapeutic effect.

[0032] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0033] (1) Target innovation: For the first time, a dual-target strategy that simultaneously targets sFlt-1 and Aβ1-42 was proposed, which can more effectively reverse the pathological process of preeclampsia through synergistic effect.

[0034] (2) Molecular innovation: The first bispecific nucleic acid aptamer targeting this combination of targets was obtained, filling a technological gap.

[0035] (3) Method innovation: The “alternating target and affinity subtraction” screening method effectively solves the technical bottleneck in bispecific aptamer screening and has a higher success rate.

[0036] (4) Therapeutic potential: This aptamer can directly neutralize the toxic effects of sFlt-1 and Aβ1-42, providing a new potential treatment option for preeclampsia and has important clinical application prospects. Attached Figure Description

[0037] Figure 1 This is a competition inhibition curve;

[0038] Figure 2 The diagram shows the continuous combination of experimental results;

[0039] Figure 3 This is a predicted diagram of the secondary structure of the aptamer in this invention. Detailed Implementation

[0040] The present invention will now be described in further detail with reference to specific embodiments and accompanying drawings.

[0041] Example 1: Screening of bispecific aptamers

[0042] 1. Materials and Reagents

[0043] Initial ssDNA library: 5'- GCC AGC CAC GCT CCT( N40) GGA GTA GCA CGG CAG-3' (N40 represents 40 random bases).

[0044] Primers:

[0045] Upstream primer: 5'-GCC AGC CAC GCT CCT-3'

[0046] Downstream primer (biotin-labeled): 5'-Biotin-CTG CCG TGC TAC TCC-3'

[0047] Targets: Biotinylated recombinant human sFlt-1 protein and biotinylated Aβ1-42 peptide.

[0048] Solid-phase carrier: magnetic beads coated with streptavidin.

[0049] Buffers: Binding buffer (20 mM Tris-HCl, pH 7.4, 5 mM MgCl2, 1 mg / mL BSA, 0.1 mg / mL tRNA), washing buffer (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 5 mM MgCl2), elution buffer (10 mM Tris-HCl, pH 7.4, 1 mM EDTA, 3.5 M urea).

[0050] 2. Screening Steps

[0051] 1) Preparation of target beads: Biotinylated sFlt-1 and biotinylated Aβ1-42 were incubated with streptavidin magnetic beads to prepare approximately 100 ng / μL of sFlt-1 beads and Aβ1-42 beads.

[0052] 2) First two rounds of pre-enrichment: The library was first incubated with blank magnetic beads for counter screening. Then it was incubated with sFlt-1 beads and Aβ1-42 beads respectively to elute the binding sequence, amplify independently, and establish two initial enrichment pools.

[0053] a) Take 5 nmol of the initial ssDNA library (lyophilized powder dissolved in 500 μL BB).

[0054] b. Add 200 μL of blank streptavidin magnetic beads (pre-equilibrated with binding buffer).

[0055] c. Incubate at room temperature by rotating for 60 minutes.

[0056] d. Magnetic separation, collect the supernatant (containing ssDNA that has not bound to the magnetic beads).

[0057] e. Divide the supernatant into two equal portions (225 μL each). In tube A, add 100 μL of sFlt-1 magnetic bead suspension. In tube B, add 100 μL of Aβ1-42 magnetic bead suspension.

[0058] f. Incubate at room temperature by rotating for 60 minutes.

[0059] g. Magnetic separation, discard the supernatant.

[0060] h. Add 1 mL of washing buffer to each, gently invert and mix 10 times, then magnetically separate and discard the supernatant.

[0061] i. Repeat washing twice.

[0062] j. Add 200 μL of preheated elution buffer (65°C) to each.

[0063] Incubate at 65°C for 10 minutes with intermittent vortexing.

[0064] 1. Magnetic separation, collect the supernatant (containing bound ssDNA).

[0065] m. Obtain "Enrichment Pool A-R1" and "Enrichment Pool B-R1".

[0066] n. The product was amplified by PCR (95℃ 5 min → (95℃ 30 s, 60℃ 30 s, 72℃ 30 s) × 20 cycles → 72℃ 5 min → 4℃ hold) and purified by the kit. Single strands were then prepared using the alkaline denaturation method to obtain the ssDNA secondary library for the next round of screening.

[0067] Table 1 PCR reaction system

[0068]

[0069] 3) Third round and beyond: Alternate deduction filtering (taking sFlt-1 as an example)

[0070] a. Incubate the ssDNA library with sFlt-1 beads and wash.

[0071] b. Affinity subtraction: Incubate sFlt-1 beads with excess free Aβ1-42 (100 molar concentration) for 10 minutes. Collect the supernatant (containing bispecific candidate sequences competed for from sFlt-1 by Aβ1-42).

[0072] c. Recover and amplify the ssDNA from the supernatant.

[0073] d. Incubate the amplification product with Aβ1-42 beads and wash.

[0074] e. Second round of affinity subtraction: Aβ1-42 beads are co-incubated with excess free sFlt-1. This time, the sequences bound to the beads are collected (eluted by denaturation) because these sequences are truly bispecific and can still be competitively bound by sFlt-1 after binding to Aβ1-42. The supernatant is discarded.

[0075] f. Amplify the eluted ssDNA and use it as input for the next round of screening.

[0076] 4) In the next cycle, first combine with Aβ1-42 beads, then subtract with sFlt-1, and so on alternately.

[0077] 5) Increasing screening pressure: Starting from the 5th round, gradually reduce the amount of target beads used and increase the number and intensity of washing.

[0078] Table 2 Screening Pressure Increasing Scheme

[0079]

[0080] 6) Monitoring and cloning:

[0081] From the 6th round onwards, the enrichment effect was monitored by flow cytometry after each round of screening. After the 10th round, the finally enriched PCR products were cloned into a T vector, transformed, and at least 200 single clones were selected for sequencing. Multiple sequence alignment was performed using sequence analysis software. Based on sequence family and frequency, the 20 most abundant sequence families, Apt-BS01 to Apt-BS20, were selected for full-sequence synthesis and functional verification. Finally, Apt-BS03, which possesses both binding activity and biological activity, was selected.

[0082] Table 3 Aptamer Sequences

[0083]

[0084] Example 2: Verification of Bispecificity and Determination of Affinity

[0085] The cross-binding competition ELISA assay was used to verify whether the candidate aptamer Apt-BS03 could simultaneously bind to sFlt-1 and Aβ1-42, and to evaluate its bispecific binding ability. Specific experimental steps included:

[0086] Coating: Take two 96-well ELISA plates. Add 100 μL of 2 μg / mL sFlt-1 protein solution to each well of plate A and 100 μL of 5 μM Aβ1-42 peptide solution to each well of plate B. Incubate overnight at 4°C. Discard the coating solution and add 200 μL of 5% BSA in PBS solution to each well. Block at 37°C for 2 h.

[0087] Biotinylated aptamer preparation: Apt-BS03, single-target control aptamer Apt-S01 (binding only sFlt-1), and random sequence nucleic acid were 3' biotinylated and diluted to 50 nM with binding buffer (same as in Example 1).

[0088] Competitive binding reaction: Four groups were set up: ① Apt-BS03 only; ② Apt-BS03 + serial concentrations of Aβ1-42 (0, 1, 10, 100, 1000 nM); ③ Apt-S01 + serial concentrations of Aβ1-42; ④ random sequence control. 50 μL of the competitor or buffer was added to each well first, followed by 50 μL of aptamer working solution, and incubated at 37°C for 1 h.

[0089] Detection: After washing, add 100 μL of streptavidin-HRP diluted 1:5000 to each well and incubate at 37°C for 30 min; after washing again, add 100 μL of TMB substrate and develop color in the dark for 15 min; add 50 μL of 2M H2SO4 to terminate the reaction and measure the absorbance at 450 nm.

[0090] The results are as follows Figure 1 As shown, (1) Apt-BS03 exhibits bispecificity: its binding to sFlt-1 and Aβ1-42 can be dose-dependently inhibited by another target (Aβ1-42 and sFlt-1), respectively. (2) Through nonlinear fitting (four-parameter logistic equation), the IC50 of Apt-BS03 competed for by Aβ1-42 can be calculated. 50 =68.2 nM, IC competed for by sFlt-1 50 =75.1 nM. Apt-S01 exhibits single-specificity; its binding to sFlt-1 is unaffected by any concentration of Aβ1-42 (no significant signal change), and it does not bind to the Aβ1-42-coated plate itself. Random sequences do not bind specifically, and their signals remain indistinguishable from the background.

[0091] Table 4. Results of four-parameter fitting of inhibitor-effect curves (dose-response relationship)

[0092] [lnhibitor] vs. response -- Variable slope (four parameters) Apt-BS03@ Aβ1-42 Apt-BS03@ sFlt-1 Apt-BS03 Best-fit values 0.1928 0.2668 80.64 Bottom 97.78 96.84 99.39 Top 50.69 44.58 2237 IC50 -0.9820 -1.015 -0.4220 HillSlope 1.705 1.649 3.350 loglC50 1.705 1.649 3.350 span 97.59 96.57 18.75

[0093] Note: Four-parameter fitting (variable slope) is a classic analytical method for drug / inhibitor dose-response relationships. Parameter meanings:

[0094] Bottom: The baseline response (minimum effect size) when the inhibitor concentration is extremely low.

[0095] Top: The maximum response value (maximum effect value) at which the inhibitor concentration is extremely high.

[0096] IC 50 The inhibitor concentration that inhibits the reaction by 50% (a key indicator; the smaller the value, the stronger the inhibitory activity).

[0097] HillSlope: The slope of the dose-response curve (the absolute value reflects the "synergistic" effect of the inhibitory effect, and a negative value represents the inhibitory effect).

[0098] logIC50: IC 50 The logarithm of (for easy plotting and calculation);

[0099] Span: The difference between Top and Bottom (reflecting the maximum inhibitory amplitude of the inhibitor).

[0100] Table 5. Cross-competitive ELISA binding data (absorbance values, mean ± SD, n=3)

[0101]

[0102] Note: Blank background value: The absorbance of the well with only buffer solution is 0.18 ± 0.01. This background value has been subtracted from all data.

[0103] Then, through surface plasmon resonance (SPR) kinetic analysis, the kinetic parameters and dissociation constant (Kd) of the binding of Apt-BSO3 with sFlt-1 and Aβ1-42 were accurately determined. The specific experiments are as follows:

[0104] (1) Chip preparation: Using a CM5 chip, sFlt-1 protein (approximately 5000 RU) and Aβ1-42 peptide (approximately 3500 RU) were immobilized in different channels by amine coupling, with one channel reserved as a blank reference;

[0105] (2) Kinetic determination: Apt-BS03 was serially diluted with running buffer (HBS-EP+) (0.78, 1.56, 3.125, 6.25, 12.5, 25 nM), injected at a flow rate of 30 μL / min, with a binding time of 180 s and a dissociation time of 300 s. The chip surface was regenerated with 1 M NaCl. The results are shown in Table 6 below: The binding rate constant ka of Apt-BS03 and sFlt-1 is... The dissociation rate constant kd is Kd is 12.8 ± 0.9 nM; ka is the same as that of Aβ1-42. kd is Kd is 18.1 ± 1.3 nM (Table 6).

[0106] Table 6 SPR kinetic parameters (mean ± SD, n=2)

[0107]

[0108] (3) Continuous binding experiment: First, inject 25 nM Apt-BS03 into the fixed flow channel of sFlt-1. After binding is completed, immediately switch to injecting 50 nM Aβ1-42 solution and observe the change in response signal, such as Figure 2 The continuous combination experiment shown indicates that:

[0109] Upon injection of Apt-BS03, a rapid and smooth increase in the response value was observed, reaching a plateau (~124 RU), indicating that Apt-BS03 specifically and with high affinity binds to the sFlt-1 protein immobilized on the chip. After switching to buffer, the response signal showed only a slight decrease and remained stable, indicating that the formed Apt-BS03–sFlt-1 complex is structurally stable and dissociates slowly. Based on the established stable complex, injection of Aβ1-42 solution resulted in a second significant and smooth increase in the response value (approximately 44 RU), reaching a new, higher plateau (~162 RU). This signal increase can only be attributed to the specific binding of Aβ1-42 molecules to the existing Apt-BS03–sFlt-1 complex on the chip surface, forming a ternary complex of sFlt-1–Apt-BS03–Aβ1-42. This SPR continuity experiment directly demonstrates that after Apt-BS03 binds to sFlt-1 at one binding site, its other independent binding site can still freely and effectively capture the second target Aβ1-42 in solution. This result rules out the possibility of non-specific adsorption and unequivocally verifies that Apt-BS03 is a single- and dual-specific nucleic acid aptamer capable of simultaneously recognizing and binding to sFlt-1 and Aβ1-42. This lays a solid molecular foundation for its application in simultaneously intervening in two pathogenic factors in preeclampsia. Therefore, Apt-BS03, with the nucleotide sequence shown in SEQ ID NO:1, can be used as an active ingredient in the preparation of products for the treatment of preeclampsia. Through the dual specificity of Apt-BS03 in the product in simultaneously recognizing and binding to sFlt-1 and Aβ1-42, it can neutralize the activity of sFlt-1 protein, inhibit the abnormal deposition of Aβ1-42 peptide, or reverse the inhibitory effect of sFlt-1 on the VEGF signaling pathway to exert a therapeutic effect.

[0110] Example 3: sFlt-1 / VEGF pathway inhibition experiment

[0111] The sFlt-1 / VEGF pathway inhibition assay was performed using the human VEGF165 ELISA kit purchased from Jianglai Biotechnology. The specific groups were as follows: ① VEGF alone (5 ng / mL); ② VEGF + sFlt-1 (VEGF 5 ng / mL + sFlt-1 20 ng / mL); ③ VEGF + sFlt-1 + Apt-BS03 (Apt-BS03 concentrations were 12.5, 25, 50, and 100 nM); ④ VEGF + sFlt-1 + Apt-S01 (100 nM); ⑤ VEGF + sFlt-1 + random sequence (100 nM). Each group had 4 replicates.

[0112] The specific experimental procedure was as follows: First, sFlt-1 was pre-incubated with different concentrations of aptamers at 37°C for 30 min; then VEGF solution was added, and incubation continued at 37°C for 1 h; finally, the mixture was added to an ELISA plate pre-coated with anti-VEGF antibody, and the procedure was followed according to the kit instructions. The absorbance at 450 nm was measured, and the concentration of free VEGF and the recovery rate were calculated. The results are shown in Table 7 below: Apt-BS03 can dose-dependently restore VEGF activity inhibited by sFlt-1: the recovery rate was 39.3% at 12.5 nM, 55.0% at 25 nM, 73.1% at 50 nM, and reached 87.4% at 100 nM; while the recovery rate of the single-target aptamer Apt-S01 (100 nM) was only 27.8%, and that of the random sequence group was 24.8% (Table 7).

[0113] Table 7 VEGF signal recovery measurement (mean ± SD, n=4)

[0114]

[0115] In summary, Apt-BS03 can effectively neutralize the biological function of sFlt-1 and reverse its inhibition of the VEGF signaling pathway.

Claims

1. A bispecific nucleic acid aptamer targeting sFlt-1 and Aβ1-42, characterized in that, The aptamer is Apt-BS03, which has both binding and biological activity; the nucleotide sequence of Apt-BS03 is shown in SEQ ID NO:

1.

2. The bispecific nucleic acid aptamer targeting sFlt-1 and Aβ1-42 according to claim 1, characterized in that, The aptamer is a single-stranded DNA molecule; the dissociation constant Kd between the aptamer and the sFlt-1 protein is 12.8±0.9 nM, and the dissociation constant Kd between the aptamer and the Aβ1-42 polypeptide is 18.1±1.3 nM.

3. The bispecific nucleic acid aptamer targeting sFlt-1 and Aβ1-42 according to claim 1, characterized in that, The aptamer is subjected to stability modification, wherein the modification is selected from one or more of the following: thiophosphorylation skeleton modification, 2'-fluorination modification, or 2'-O-methylation modification.

4. A method for screening bispecific nucleic acid aptamers targeting sFlt-1 and Aβ1-42 according to any one of claims 1-3, characterized in that, The aptamer screening employs an improved alternating target screening combined with an affinity reduction strategy, specifically including the following steps: a) Provide a single-stranded nucleic acid initial library, wherein the nucleotide sequence of the initial library is 5'-GCCAGCCACGCTCCT(N40)GGAGTAGCACGGCAG-3', where N40 represents 40 random bases; b) First round of screening: The library is brought into contact with the first target, and the first nucleic acid molecule that binds to the first target is collected. The first target is either sFlt-1 protein or Aβ1-42 polypeptide. c) First affinity deduction step: co-incubate the first nucleic acid molecule with an excess of free second target, and collect the nucleic acid molecules that have been competed for by the second target, wherein the second target is an Aβ1-42 polypeptide or sFlt-1 protein that is different from the first target; d) Second round of screening: The nucleic acid molecules collected in step c) are brought into contact with the second target to collect the second nucleic acid molecules that bind to the second target; e) Second affinity reduction step: co-incubate the second nucleic acid molecule with excess free first target, and collect the nucleic acid molecules that are still bound to the second target; f) Amplification step e) Collect nucleic acid molecules to obtain an enriched nucleic acid library; g) Repeat steps b) to f) multiple times until a rich library that meets the requirements is obtained; h) The final enriched library was cloned, sequenced, and functionally validated to obtain the bispecific nucleic acid aptamer Apt-BS03.

5. The method according to claim 4, characterized in that, Step g) is repeated 8-10 times, with the order of the first and second targets alternating in each round, and the screening pressure gradually increasing during the process.

6. The method according to claim 5, characterized in that, The method for increasing screening pressure is as follows: from round 1-2 to round 9-10, the target dosage is gradually reduced from 10-12.5 μg to 0.6-0.75 μg, the incubation time is gradually shortened from 60 min to 15 min, the number of washes is gradually increased from 3 to 7, and 0.01% Tween-20 is added to the washing solution from round 5 onwards.

7. A pharmaceutical composition, characterized in that, It comprises the bispecific nucleic acid aptamer of any one of claims 1-3, and a pharmaceutically acceptable vector.

8. Use of the pharmaceutical composition according to claim 7 in the preparation of a medicament for the prevention and / or treatment of preeclampsia.

9. The application according to claim 8, characterized in that, The drug can neutralize the activity of sFlt-1 protein, inhibit the abnormal deposition of Aβ1-42 peptide, or reverse the inhibitory effect of sFlt-1 on the VEGF signaling pathway.