ELISA protein quantitative detection method based on magnetic beads and immune qPCR, kit and application thereof

The BIQ-ELISA method, based on magnetic beads and immunoqPCR, utilizes the combination of magnetic particles and nucleic acid barcodes to solve the problem of insufficient sensitivity in the detection of low concentration analytes in traditional ELISA methods. It achieves high sensitivity and specificity in detection and is suitable for multiplex detection and automated operation.

CN122109524APending Publication Date: 2026-05-29RAYBIOTECH INC GUANGZHOU +1
View PDF 12 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
RAYBIOTECH INC GUANGZHOU
Filing Date
2026-02-25
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing technologies struggle to detect low concentrations of biomarkers with high sensitivity and specificity, especially in the early detection of diseases such as cancer or neurological disorders. Traditional ELISA methods have high detection limits, which can lead to missed detection of femtomolar concentrations of proteins.

Method used

The BIQ-ELISA method, based on magnetic beads and immunoqPCR, simplifies the procedure and improves sensitivity by using magnetic particles modified with multiple first binders targeting the analytes and a second binder linked with nucleic acid barcodes to form an immune complex, followed by PCR amplification to identify the analytes.

Benefits of technology

It achieves femtogram-level detection sensitivity per milliliter, improves the sensitivity for detecting low-concentration analytes, simplifies the workflow, reduces background noise, and is suitable for multiplex detection and automated operation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application discloses an ELISA protein quantitative detection method based on magnetic beads and immune qPCR, a kit and application thereof, and relates to a kit for detecting target analytes in samples and a detection method thereof.The kit comprises a first reagent and a second reagent.The first reagent comprises magnetic particles modified with a first binding agent specific to the analyte; the second reagent comprises a second binding agent specific to the analyte, and the second binding agent is coupled with a nucleic acid barcode; and the first binding agent and the second binding agent are combined to different epitopes of the target analyte.The kit and the detection method have the advantages of high sensitivity and multiprotein detection, and are especially suitable for detecting low-abundance protein biomarkers.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to biological detection technology, specifically to an ELISA protein quantification detection method, kit, and application based on magnetic beads and immunoqPCR. Background Technology

[0002] Traditional enzyme-linked immunosorbent assays (ELISA) have been the gold standard for protein detection for decades due to their high affinity and specificity for antibody-antigen recognition. ELISA can detect protein concentrations at the picomolar level, making it suitable for detecting small amounts of protein in complex samples such as blood or urine. However, many biomarkers of interest exist at ultra-low concentrations (low picomolar or femtomolar range), which are often below the limit of detection (LOD) of current diagnostic methods. Therefore, femtomolar concentrations of protein may be missed, creating a significant gap in diagnostic capability. This limitation is particularly pronounced in the early detection of diseases such as cancer or neurological disorders, as biomarkers are often present in very low concentrations at early stages.

[0003] One method to improve detection sensitivity is immunoPCR. Unlike ELISA, where the detection antibody is directly labeled with an enzyme, in immunoPCR, the antibody is ligated to a DNA tag that serves as a template for PCR amplification. Leveraging the high specificity of antibody-based protein detection and the amplification power of PCR, immunoPCR can detect biomarkers at extremely low levels. Two of the most widely used methods in this category are proximity linkage analysis (PLA) and proximity extension analysis (PEA). In both systems, two antibodies are designed to target different epitopes of the same antigen, each linked to a different DNA oligonucleotide. When these antibodies bind to the same target protein, the DNA strands approach each other, triggering a reaction that amplifies the signal via PCR. PLA uses external linkers and DNA ligase to link two oligonucleotide strands into a single DNA sequence for PCR amplification. PEA, on the other hand, relies on direct hybridization and DNA polymerase to extend overlapping sequences.

[0004] Both PLA and PEA employ homogeneous detection methods. Homogeneous detection requires no washing or separation steps; all reactions occur in the same solution, making the process faster, easier to execute, and readily automatable. However, because unbound molecules are present in the same solution, homogeneous detection often exhibits higher background noise and lower sensitivity compared to solid-phase detection.

[0005] In contrast, traditional protein detection employs solid-phase detection methods, where one of the detection components (such as antibodies or antigens) is immobilized on a solid phase, such as microplates or magnetic beads. The solid phase surface allows for thorough washing to remove unbound or non-specifically bound molecules, thereby reducing background noise and improving sensitivity. Solid-phase PEAs immobilized with third-proto-binding antibodies have been shown to elevate detection sensitivity to the level of SIMOA (Single-Molecular Array). SIMOA achieves extremely high sensitivity by isolating individual enzyme-labeled immune complexes into thousands of microwells, each well acting as a tiny, independent detection unit. This isolation allows SIMOA to detect extremely low concentrations of protein, with sensitivity down to the femtogram per milliliter (fg / mL) level. Its sensitivity is 1000 times higher than that of conventional ELISA, making it one of the most advanced technologies for detecting low-abundance proteins in research and clinical diagnostics.

[0006] Due to their numerous advantages, microscopic magnetic beads are widely used as solid-phase carriers for immunoassays, including increased sensitivity through increased surface area, accelerated reaction kinetics due to uniform suspension in the liquid phase, reduced sample volume, multiplexing capabilities, and compatibility with automated operations. Magnetic beads also offer the added advantage of simplifying the separation of bound antibodies or antigens from complex mixtures by applying a magnetic field. This simplified separation method reduces the need for multiple washing steps, lowers background noise, and further improves the sensitivity and specificity of the assay.

[0007] The two most widely used magnetic bead-based immunoassay methods are Luminex magnetic bead multiplexing and flow cytometry-based magnetic bead detection. Luminex xMAP uses uniquely colored magnetic beads for multiplexing and a universal fluorescent dye for signal detection, enabling simultaneous measurement of multiple target analytes in the same sample. Similar to Luminex, BD Biosciences' flow cytometry magnetic bead array (CBA) uses fluorescently labeled magnetic beads for multiplexing, but leverages the precision of flow cytometry for readout. Both xMAP and CBA offer detection sensitivity comparable to ELISA but with the added capability of multiplexing.

[0008] Nevertheless, there remains a need for compositions and detection methods capable of detecting low concentrations of analytes with high sensitivity and specificity. Therefore, the objective of this invention is to provide a kit and method of using it capable of detecting low concentrations of analytes with high sensitivity and specificity. Summary of the Invention

[0009] This invention provides a kit for detecting one or more target analytes in a sample and a method for using the kit.

[0010] A first aspect of the present invention provides a kit for detecting at least one target analyte in a sample, comprising a pair of specific binders for the target analyte, the binders being capable of binding to different epitopes or different portions of the target analyte. The kit includes a first reagent containing magnetic particles modified with a plurality of first binders targeting the target analyte, and a second reagent containing a plurality of second binders modified with a plurality of second binders targeting the target analyte, each binder being linked to a nucleic acid barcode.

[0011] In some embodiments, the size of the magnetic particles is preferably at the micrometer level.

[0012] In some implementations, the kit is used to detect multiple target analytes in a sample, comprising a first binding agent and a second binding agent for each target analyte. In this configuration, each second binding agent is labeled with a different barcode.

[0013] In some embodiments, particles other than magnetic particles may be used in the first reagent. These particles include, but are not limited to, polystyrene magnetic beads, silica magnetic beads, latex magnetic beads, hydrogel magnetic beads, gold nanoparticles (AuNPs), quantum dots, or glass beads. These particles are modified with a variety of first binders targeting the analyte.

[0014] The first and second binders include any pair of binders capable of specifically binding to the target analyte, and preferably have no or very low cross-reactivity with other analytes.

[0015] The second binding agent is attached to a DNA barcode, which can be used for subsequent identification of the bound target analyte.

[0016] The present invention includes the following technical solutions.

[0017] A kit for detecting a target analyte in a sample, the kit comprising:

[0018] (a) First reagent; and

[0019] (b) Second reagent,

[0020] in:

[0021] (i) The first reagent contains magnetic particles modified with a first binder specific to the analyte;

[0022] (ii) The second reagent contains a second binding agent that is specific to the target analyte and is coupled to the nucleic acid barcode.

[0023] In some embodiments, the first binder and the second binder bind to different epitopes of the target analyte.

[0024] A kit for detecting two or more target analytes in a sample, the kit comprising:

[0025] (a) Modified magnetic particles containing two or more first binders; and

[0026] (b) Two or more second binders,

[0027] The two or more first binders and two or more second binders form two or more binding groups.

[0028] Each binding group contains a first binding agent and a second binding agent.

[0029] The first and second binders in each binding group target the same analyte.

[0030] Each second binding agent is coupled to a nucleic acid barcode; different second binding agents correspond to different nucleic acid barcodes.

[0031] The two or more analytes are different from each other.

[0032] In some embodiments, the first and second binders in each binding group bind to different or the same epitopes of the target analyte.

[0033] In some embodiments, the first and second binders in each binding group are independently antibodies, nucleic acid aptamers, or peptides, or combinations thereof.

[0034] In some embodiments, the diameter of the modified magnetic particles is about 0.5 µm to 5 µm, 0.3 µm – 5.5 µm, 0.2 µm – 6 µm, 1 µm – 4.5 µm, 1.5 µm – 4 µm, 2 µm – 3.5 µm, or 2.5 µm – 3 µm.

[0035] In some embodiments, the density of the modified magnetic particles is approximately 1.4 g DS / cm³. 3 - 1.8 g DS / cm 3 1.3 g DS / cm 3 - 1.9 g DS / cm 3 1.5 g DS / cm 3 - 1.7 g DS / cm 3 1.2 g DS / cm 3 - 2.0g DS / cm 3 1.6 g DS / cm 3 - 1.9 g DS / cm3 1.1 g DS / cm 3 - 2.1 g DS / cm 3 Or 1.0 g DS / cm 3 - 2.5 g DS / cm 3 .

[0036] In some embodiments, the first binder is coupled to the modified magnetic particles via an affinity pair selected from the group consisting of: streptavidin family protein / biotin, nucleic acid aptamer / target molecule pairs, receptor / ligand pairs, natural or synthetic receptor / ligand pairs, or amines and carbonyl compounds. Further, the streptavidin family protein is streptavidin, avidin, or neutral avidin.

[0037] In some embodiments, the antibody is a monoclonal antibody, polyclonal antibody, recombinant antibody, humanized antibody, human antibody, chimeric antibody, functional fragment thereof, or a combination thereof. Further, in some embodiments, the functional fragment is a single-chain variable fragment (scFv), Fab fragment, nanobody, bispecific antibody, biantibody, triantibody, or a combination thereof.

[0038] In some embodiments, the analyte is one or more proteins / peptides selected from at least one of the following groups of analytes: IL-8 (interleukin-8), ALPP (alkaline phosphatase, e.g., placental type (EC 3.1.3.1)), CD38 (differentiation group 38), SOD1 (superoxide dismutase-1), and VCAN (chondroitin).

[0039] In some embodiments, the kit comprises DAB / CAB pairs selected from Table 2, and the nucleic acid barcodes are selected from SEQ ID NO:1-5 and SEQ ID NO:20-24.

[0040] In some embodiments, the analyte is present in the sample, optionally wherein the sample is a food sample, environmental sample, industrial sample, human clinical sample, veterinary sample, or sample of other biological origin, optionally wherein the sample is blood, serum, plasma, feces, mucosal swabs, tissue aspirate, tissue homogenate, cell culture, cell culture supernatant (including cultures of eukaryotic and prokaryotic cells), urine, saliva, sputum, and / or cerebrospinal fluid.

[0041] The kit described herein includes a second binding agent coupled to a nucleic acid barcode via a linker.

[0042] In some embodiments, the connector is , where n1 is an integer from 1 to 10, 1 to 8, 1 to 6, 2 to 10, 2 to 8, 4 to 10 or 4 to 8, for example 6; where -NH- comes from the second binding agent and the nucleic acid barcode, respectively.

[0043] In some implementations, the nucleic acid barcode includes:

[0044] (a) The region used for hybridization with the TaqMan probe;

[0045] (b) The region used for primer binding during PCR amplification; and

[0046] (c) Regions for target specificity, or regions that match Illumina sequencing, or regions that match the Illumina sequencing system Rd2SP.

[0047] In some embodiments, the kit comprises one or more buffer solutions and one or more reagents.

[0048] In some preferred embodiments, one or more buffer solutions include at least one of the following:

[0049] (a) Dilution buffer used for preparing standards and diluting samples;

[0050] (b) Washing buffer for removing unbound material from magnetic particles;

[0051] (c) Elution buffer containing sodium hydroxide for releasing ONA from immune complexes;

[0052] (d) Blocking buffer used to reduce nonspecific binding.

[0053] In some embodiments, the blocking buffer is a PBS solution containing casein and Biolipidure 1002 (B1002).

[0054] In some preferred embodiments, a PBS solution containing 10 ± 1% casein and 1 ± 0.1% (w / v) B1002 is used.

[0055] In some embodiments, the kit further includes one or more reagents, said one or more reagents including at least one of the following:

[0056] (a) A PCR master mixture containing DNA polymerase and nucleotides for qPCR amplification;

[0057] (b) One or more oligonucleotide primers for amplifying the ONA barcode;

[0058] (c) TaqMan probes labeled with fluorescent reporter groups and quenchers for detecting ONA during qPCR amplification.

[0059] A second aspect of the invention also provides a method for detecting one or more analytes in a sample using the kit. The method includes contacting the sample with first and second reagents to form an immune complex of the target analyte in the sample, the complex consisting of its first and second binding partners. The method further includes releasing the immune complex from magnetic particles using a suitable elution buffer, performing PCR (e.g., qPCR) using a DNA barcode as a template, and optionally performing next-generation sequencing (NGS) to identify the analyte based on the DNA barcode.

[0060] A method for detecting one or more analytes in a sample using any of the above-mentioned reagent kits, the method comprising:

[0061] (i) co-incubating the sample with modified magnetic particles and a second binding agent to form an immune complex; and

[0062] (ii) Perform signal amplification and / or sequencing on nucleic acid barcodes.

[0063] In some embodiments, the method further includes, after step (i), (a) purifying the immune complex.

[0064] In some embodiments, the method includes step (a) of washing the immune complex with a washing buffer to remove unbound material and separating the immune complex from the buffer by a magnetic field or centrifugation.

[0065] In some embodiments, the method further includes, after step (i), eluting the nucleic acid barcode from the immune complex using an elution buffer.

[0066] In some embodiments, the method, wherein step (ii) includes adding a PCR mixture to a nucleic acid barcode and amplifying the eluted nucleic acid using qPCR.

[0067] In some embodiments, the method further includes, after step (ii), (b) determining the concentration of each target analyte.

[0068] In some embodiments, the method includes step (b) of generating a standard curve for each analyte and calculating the concentration of the analyte in the sample based on the Ct value obtained in step (ii).

[0069] In some embodiments, the method is described in which step (ii) is performed using qPCR or sequencing, or a combination thereof.

[0070] In some embodiments, the method uses next-generation sequencing (NGS), such as Illumina sequencing, Ion Torrent semiconductor sequencing, PacBio SMRT sequencing, Oxford Nanopore sequencing, NanoString nCounter and / or Miser sequencing.

[0071] In some embodiments, the method, wherein NGS includes the simultaneous analysis and detection of five or more analytes in a single and / or multiple samples, optionally hundreds to thousands of analytes, such as 100 to 10,000 analytes in a single and / or multiple samples.

[0072] The kit described in this invention is a highly sensitive protein quantification platform for ELISA (BIQ-ELISA) based on magnetic beads and immunoqPCR. BIQ-ELISA technology utilizes the specificity of sandwich ELISA, the sensitivity of real-time PCR, and the ease of handling magnetic microspheres to reduce background values, integrating them into a simple and easy-to-use platform. The BIQ-ELISA method can achieve a detection sensitivity of femtograms per milliliter, which is 1000 times more sensitive than traditional ELISA methods.

[0073] Unlike PLA and PEA antibodies, which are labeled with DNA sequences requiring proximity for PCR amplification, the BIQ-ELISA method of this invention uses only one DNA barcode antibody. This is achieved by detecting the binding of the antibody (DAB) to an oligonucleotide (ONA) barcode that allows for direct PCR amplification. This method increases detection sensitivity without requiring two DNA tags for proximity-based amplification, simplifying the system and potentially making it more robust. The capture antibody (CAB) is biotin-labeled and pre-adsorbed onto streptavidin-coated magnetic beads. These magnetic beads not only increase the surface area for antibody-antigen interactions, reducing reaction volume and simplifying handling and washing by enabling uniform analysis, but also improve sensitivity through a solid-surface analysis system. In summary, the BIQ-ELISA kit and detection method of this invention simplify the workflow compared to proximity-based methods such as PLA and PEA while maintaining ultra-high sensitivity. This is achieved by utilizing a single DNA barcode for PCR amplification and easily manipulated magnetic microspheres to improve the efficiency and sensitivity of the assay. Attached Figure Description

[0074] Figure 1A-1CA schematic diagram of the enzyme-linked immunosorbent assay (BIQ-ELISA) detection process based on magnetic beads and immunoqPCR is shown, where “CAB” represents capture antibody; “ONA” represents oligonucleotide; and “DAB” represents detection antibody.

[0075] Figure 2 This is a comparison chart of SIMOA (Single Molecule Array) technology and BIQ-ELISA for detecting TNF-α. The X-axis represents the patient sample number, and the Y-axis represents the detected TNF-α content (pg / ml).

[0076] Figure 3 This is a schematic diagram of primer design for the BIQ system. P5, P7, Rd1SP, Rd2SP, and i7 are Illumina sequencing components; SP_F: a unique BIQ-ELISA sequencing primer with four random bases at the 5' end for NGS and four universal bases at the 3' end for TaqMan; ONA: a unique 20bp DNA barcode; a matching TaqMan probe is designed based on this. Primer 2 is used alone for individual BIQ-ELISA. Primers 1 and 3 are used for NGS library construction.

[0077] Figures 4A-4D The results of the crosslinking reaction using crosslinking agent BS3 are shown. Figure 4A It is the chemical structure of BS3. Figure 4B These are gel images showing protein and DNA staining. Lane 1: DSS ligation via DNA activation; Lane 2: BS3 ligation via DNA activation; Lane 3: BS3-activated streptavidin; Lane 4: BS3 ligation via streptavidin activation. Figure 4C These are gel images showing BS3 ligation of the P7 end fragment in 200 mM HEPES. Lane 1: Ligand activated by a 50-fold molar excess of BS3 for the P7 end fragment; Lane 2: Ligand activated by a 100-fold molar excess of BS3 for the P7 end fragment; Lane 3: Ligand activated by a 250-fold molar excess of BS3 for the P7 end fragment; Lane 4: Ligand activated by a 100-fold molar excess of BS3 for the P7 end fragment, with a DNA to streptavidin molar ratio of 3:1; Lane 5: Ligand activated by a 100-fold molar excess of BS3 for the P7 end fragment, with a DNA to streptavidin molar ratio of 6:1; Lane 6: Ligand activated by a 100-fold molar excess of BS3 for the P7 end fragment, with a DNA to streptavidin molar ratio of 9:1. Figure 4D These are gel images showing the ligation of mouse IgG with different proportions of DNA. Further optimization of the pH value significantly improved efficiency.

[0078] Figures 5A-5D The test results for streptavidin magnetic beads are presented. Among them, Figures 5A-5B The following magnetic beads are labeled as such: 1) HV0150 Hi-SurMag streptavidin, 150nm, 2ml, 1mg / ml (custom-made); 2) MV1000-002 MonoMag streptavidin, 1μm, 2ml (custom-made); 3) HV1000-02 HiSur streptavidin, 1μm, 2ml (custom-made); 4) 2574067 1mL Dynabeads™ M-280 streptavidin, 2.8μm; 5) 01342559 1mL Dynabeads™ M-270 streptavidin, 2.8μm; 6) 01342859 1mL Dynabeads™ MyOne™ streptavidin C1, 1μm; 7) 01340664 1mL Dynabeads™ MyOne™ streptavidin T1, 1μm. Figures 5C-5D The following are nine different streptavidin magnetic beads tested in the PCR reaction: 1) HV0150 Hi-SurMag streptavidin, 150nm, 2ml, 1mg / ml (custom-made); 2) MV1000-002 MonoMag streptavidin, 1μm, 2ml (custom-made); 3) HV1000-02 HiSur streptavidin, 1μm, 2ml (custom-made); 4) 2574067 1mL Dynabeads™ M-280 streptavidin, 2.8μm; 5) 01342559 1mL Dynabeads™ M-270 streptavidin, 2.8μm; 6) 01342859 1mL Dynabeads™ MyOne™ streptavidin C1, 1μm; 7) 01340664 1mL Dynabeads™ MyOne™ Streptavidin T1, 1 μm; 8) Bioeast M2800S3-XC, 2.8 μm; 9) Beaver 22307-1, 1 μm. Dynabeads M-280 were identified as the most suitable magnetic beads for downstream PCR.

[0079] Figure 6A-6J It's a bar chart comparing the filter plate method ( Figure 6A , 6C 6E, 6G, 6I) and magnetic bead washing method ( Figure 6B , 6D (6F, 6H, 6J) in the detection of IL-1β ( Figures 6A-6B ), TNF-α ( Figures 6C-6D ), IL-12p70 ( Figure 6E-6F ), IFN-γ ( Figure 6G-6H ) and IL-6 ( Figure 6I-6JThe detection sensitivity at that time.

[0080] Figure 7 It is a pair of bar charts showing that the reaction in a 10 μL volume (5 μL sample + 5 μL magnetic bead mixture) has better consistency and the lowest coefficient of variation (CV).

[0081] Figure 8A This is a schematic diagram of barcode and primer design for next-generation sequencing.

[0082] Figure 8B The results of the bioanalyzer analysis for the mixed sample are shown. The concentration of the mixed sample was 1.1 ng / μL, and it was ready for sequencing.

[0083] Figure 9 This is a schematic diagram of BIQ testing.

[0084] Figure 10A The bar chart shows the difference in cyclic threshold (CT) between BIQ and BIQL detection methods in the detection of interferon-gamma (IFNg).

[0085] Figure 10B The bar chart shows the difference in circulating threshold between the BIQ and BIQL assays in the detection of tumor necrosis factor α (TNFa).

[0086] Figure 10C The bar chart shows the difference in circulating threshold between the BIQ and BIQL assays in the detection of interleukin-1β (IL-1b).

[0087] Figure 11 The graph shows the CT values ​​of different concentrations of IL-6 detected by the BIQL method using the TaqMan probe or SYBR Green.

[0088] Figure 12 This is a schematic diagram of NGS amplicon library construction methods 1-4.

[0089] Figure 13 The results of NGS testing using the BIQL detection method are shown. Detailed Implementation

[0090] To facilitate understanding of the present invention, a more complete description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0091] A. Definition

[0092] In this document, "subject" includes, but is not limited to, animals, plants, bacteria, viruses, parasites, and any other living organisms or entities. Subjects can be vertebrates, more specifically mammals (e.g., humans, horses, pigs, rabbits, dogs, sheep, goats, non-human primates, cattle, cats, guinea pigs, or rodents), fish, birds, reptiles, or amphibians. Subjects can also be invertebrates, more specifically arthropods (e.g., insects and crustaceans). The term does not refer to a specific age or sex. Therefore, it includes adults, newborns, and fetuses, regardless of sex. A patient is a subject suffering from a disease or disorder. The term "patient" includes both human and veterinary subjects.

[0093] The term “antibody” should be interpreted in the broadest sense unless explicitly stated otherwise. Therefore, an “antibody” can be naturally occurring or artificial, such as a monoclonal antibody produced using conventional hybridoma technology. Antibodies include monoclonal and polyclonal antibodies, as well as fragments and polymers containing the antigen-binding domain and / or one or more complementarity-determining regions of these antibodies. In this document, the term “antibody” refers to any form of antibody or antigen-binding fragment or recombinant protein, specifically encompassing monoclonal antibodies (including full-length monoclonal antibodies), polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments, provided they can specifically bind to a target antigen. Any specific antibody may be used in the methods and compositions provided herein. Therefore, in some embodiments, “antibody” encompasses a molecule containing a variable region of at least one light chain immunoglobulin molecule and a variable region of at least one heavy chain molecule, these variable regions collectively forming a specific binding site against a target antigen. The term “variable region” is intended to distinguish it from a domain in an immunoglobulin that is widely shared with the antibody (e.g., the Fc domain of an antibody). Variable regions include “hypervariable regions” whose residues are responsible for antigen binding. Hypervariable regions include residues from the complementarity-determining region (CDR) or CDR (i.e., typically around positions 24–34 (L1), 50–56 (L2), and 89–97 (L3) in the light chain variable region, and around positions 27–35 (H1), 50–65 (H2), and 95–102 (H3) in the heavy chain variable region; Kabat et al., Immunology-Associated Protein Sequences, 5th Edition, Public Health Service, National Institutes of Health, Bethesda, MD (1991)) and / or residues from the hypervariable ring (i.e., positions 26–32 (L1), 50–52 (L2), and 91–96 (L3) in the light chain variable region, and positions 26–32 (H1), 53–55 (H2), and 96–101 (H3) in the heavy chain variable region; Chothia, C. et al. (1987) “Typical structure of immunoglobulin hypervariable region”, Journal of Molecular Biology 196:901-917.

[0094] “Frame region” or “FR” residues refer to variable domain residues other than the hypervariable region residues defined in this paper.

[0095] The term "antibody" encompasses monoclonal antibodies, multispecific antibodies, humanized antibodies, humanized antibodies, synthetic antibodies, chimeric antibodies, and camel-derived antibodies (see, for example, Muyldermans et al., 2001, Trends in Biochemistry 26:230; Nuttall et al., 2000, Current Pharmaceutical Biotechnology 1:253; Reichmann and Muyldermans, 1999, Journal of Immunological Methods 231:25; International Publication Nos. WO 94 / 04678 and WO 94 / 25591; U.S. Patent No. 6,005,079), single-chain variable fragments (scFv) (see, for example, Pluckthun, Pharmacology of Monoclonal Antibodies, Vol. 113, edited by Rosenburg and Moore, Springer-Verlag, New York, pp. 269-315 (1994)), single-chain antibodies, disulfide-linked Fvs (sdFv), intracellular antibodies, and anti-idiotype (anti-Id) antibodies (including, for example, anti-Id and anti-anti-Id antibodies against the antibodies of the present invention). In particular, these antibodies include any type of immunoglobulin molecule (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), or subclass. An “antibody fragment” or “antigen-binding fragment” is defined as a region of at least a portion of the variable region of an immunoglobulin molecule that is capable of binding its target, i.e., an antigen-binding region (also called an antigen-binding domain). In some embodiments, it specifically covers single antibodies and their clones, as well as anti-antibody compositions with multi-epitope specificity. The antibodies in the methods and compositions described herein can be monoclonal or polyclonal antibodies. Antibodies can be in the form of antigen-binding antibody fragments, including Fab fragments, F(ab')2 fragments, single-chain variable regions, etc. Fragments of complete molecules can be generated using methods known in the art, including enzymatic digestion and recombinant techniques. Therefore, a "fragment" can be a recombinant protein, such as a fusion protein.

[0096] In this document, any form of "antigen" can be used to generate specific antibodies against a target antigen. Therefore, the inducible antigen can be an epitope, multiple epitopes, or the entire protein, used alone or in combination with one or more immunogenic enhancers known in the art. The inducible antigen can be a purified full-length protein, a cell surface protein (e.g., immunized with cells transfected with at least a portion of the antigen), or a soluble protein (e.g., immunized with only the extracellular domain portion of the protein). The antigen can be generated in genetically modified cells. The DNA encoding the antigen can be genomic DNA or non-genomic DNA (e.g., cDNA) and encodes at least a portion of the extracellular domain. In this document, the term "portion" refers to the minimum number of amino acids or nucleic acids constituting the immunogenic epitope of the target antigen, as specific. Any gene vector suitable for transforming target cells can be used, including but not limited to adenoviral vectors, plasmids, and non-viral vectors such as cationic lipids. In some embodiments, the antibody in the methods and compositions described herein specifically binds to at least a portion of the extracellular domain of the target antigen. In some embodiments, the binding fragment used in this invention is a biologically active fragment. In this article, the term “biological activity” refers to antibodies or antibody fragments that are able to bind to desired antigenic epitopes and exert biological effects directly or indirectly.

[0097] Bispecific antibodies are also used in the methods and compositions of the present invention. Hereinafter, the term "bispecific antibody" refers to an antibody having binding specificity to at least two different antigenic epitopes, typically a monoclonal antibody. In some embodiments, these epitopes are derived from the same antigen. In another form, these epitopes are derived from two different antigens. Methods for manufacturing bispecific antibodies are known in the art.

[0098] The term "specific binding" or "immune-specific binding" refers to the binding of an antibody to its corresponding antigen, without significant binding to other antigens. Preferably, the antibody binds at a concentration greater than about 10. 5 mol -1 The affinity constant (Ka) (e.g., 10) 8 mol -1 10 7 mol -1 10 8 mol -1 10 9 mol -1 10 10 mol -1 10 11 mol -1 and 10 12 mol -1 (or higher) "specifically binds" to the second molecule.

[0099] The term "monoclonal antibody" or "mAb" refers to an antibody obtained from a essentially homogeneous population of antibodies, meaning that the individual antibodies in the population are identical except for the possibility of natural mutations (which may exist in a small subgroup of antibody molecules).

[0100] In this article, the term "peptide" refers to a class of compounds composed of amino acids linked together by chemical bonds. Generally, amino acids are linked together by amide bonds (CONH); however, amino acids can also be linked together by other chemical bonds known in the art. For example, amino acids can be linked by amino bonds. The peptides mentioned herein include oligomers of amino acids, as well as small and large peptides, including polypeptides.

[0101] In this article, the term "peptide" includes proteins and their functional fragments. Peptides disclosed in this article are presented as amino acid residue sequences. These sequences are written from left to right, from the amino terminus to the carboxyl terminus. Following standard nomenclature, the amino acid residue sequences can be represented by three-letter or single-letter codes, as follows: alanine (Ala, A), arginine (Arg, R), asparagine (Asn, N), aspartic acid (Asp, D), cysteine ​​(Cys, C), glutamine (Gln, Q), glutamic acid (Glu, E), glycine (Gly, G), histidine (His, H), isoleucine (Ile, I), leucine (Leu, L), lysine (Lys, K), methionine (Met, M), phenylalanine (Phe, F), proline (Pro, P), serine (Ser, S), threonine (Thr, T), tryptophan (Trp, W), tyrosine (Tyr, Y), and valine (Val, V).

[0102] In this article, the term "functional fragment" refers to a full-length protein fragment that retains one or more functional properties of the full-length protein.

[0103] In this document, the term "nucleotide" refers to a molecule containing a base moiety, a sugar moiety, and a phosphate moiety. Nucleotides can be linked together by their phosphate and sugar moieties to form nucleoside linkages. The base moiety of a nucleotide can be adenine (A), cytosine (C), guanine (G), uracil (U), and thymine (T). The sugar moiety of a nucleotide is ribose or deoxyribose. The phosphate moiety of a nucleotide is pentavalent phosphate. A non-limiting example of a nucleotide is 3'-AMP (3'-adenosine monophosphate) or 5'-GMP (5'-guanosine monophosphate). Many variations of such molecules are available in the art.

[0104] In this article, “oligonucleotide” or “polynucleotide” refers to a synthetic or isolated nucleic acid polymer containing multiple nucleotide subunits.

[0105] "Contact," "make contact," or "cause to contact" describes placing substances in a physical relationship, such as being present in solid and / or liquid form. For example, contact or binding can occur in vitro, involving one or more primers and / or probes and a biological sample (such as a sample containing nucleic acids) in solution.

[0106] Nucleic acid aptamers are nucleic acid molecules that can bind to specific target molecules with high affinity and specificity (Tuerk and Gold, *Science* 249:505 (1990); Ellington and Szostak, *Nature* 346:818 (1990)). The binding of a ligand to a nucleic acid aptamer (usually RNA) alters the conformation of the aptamer and the nucleic acid it contains. This conformational change can inhibit the translation of mRNA containing the aptamer or otherwise interfere with the normal activity of the nucleic acid. Nucleic acid aptamers can also be composed of DNA or contain non-natural nucleotides and nucleotide analogs. Nucleic acid aptamers are typically obtained through in vitro screening for binding to target molecules. However, in vivo screening of aptamers is also possible.

[0107] "Amplification" or "amplification" refers to increasing the copy number of nucleic acid molecules (such as genes, gene fragments, or other genomic regions). The products of an amplification reaction are called amplicones or amplification products.

[0108] The terms “isolation,” “separation,” “purification,” “purification,” “enrichment,” and “enrichment,” when used to refer to nucleic acids of interest (e.g., DNA, such as complete or fragmented genomic DNA, amplicon, etc.), indicate that at a certain point in time, the nucleic acid of interest has been isolated, enriched, sequenced, etc., thereby increasing its proportion relative to other cellular material, or has been separated relative to other cellular material, impurities, or active agents (such as enzymes, proteins, detergents, cations, or anions). When used to refer to nucleic acids of interest, “highly purified,” “highly enriched,” and “highly separated” indicate that the nucleic acid of interest has been purified or isolated by at least approximately 70%, approximately 75%, approximately 80%, approximately 85%, approximately 90% or more, approximately 95%, approximately 99%, or 99.9% or more, thereby separating it from other cellular material, impurities, or active agents (such as enzymes, proteins, detergents, cations, or anions). When used to refer to nucleic acids of interest, “basic separation,” “basic purification,” and “basic enrichment” indicate that the nucleic acid of interest has been purified or separated by at least 70%, 75%, or 80%, typically at least 85% or 90%, and sometimes at least 95% or more, such as 95%, 96%, or even up to 100%, thereby separating it from other cellular material, impurities, or active agents (such as enzymes, proteins, detergents, cations, or anions).

[0109] In this paper, "complementarity," "complementarity," and "complementary effect" are related to polynucleotides (i.e., nucleotide sequences, such as oligonucleotides or target nucleic acids) and refer to the Watson-Crick base pairing rule. In this paper, a complementary sequence of a nucleic acid sequence refers to an oligonucleotide in which the 5' end of one sequence pairs with the 3' end of another sequence when aligned with the nucleic acid sequence, exhibiting an "antiparallel association." For example, the sequence "5'-AGT-3'" is complementary to the sequence "3'-TCA-5'." The second sequence can be referred to as the anticomplementary sequence of the first sequence, and vice versa.

[0110] In this article, "hybridization" refers to the process by which two essentially complementary or completely complementary nucleic acid strands anneal under appropriate stringent conditions through hydrogen bonding between complementary base pairs, forming a double helix or heteroduplex.

[0111] In this paper, "primer" refers to an oligonucleotide that can serve as the starting point for the synthesis of nucleic acid sequences when placed under conditions that induce the synthesis of primer extension products (complementary to the target nucleic acid strand), i.e., in an appropriate buffer ("buffer" includes pH, ionic strength, cofactors, etc.) and at a suitable temperature in the presence of different nucleotide triphosphates and polymerases. One or more nucleotides of the primer can be modified, for example by adding a methyl group, biotin or digoxigenin, fluorescent tagging, or using a radioactive nucleotide. The primer sequence does not need to perfectly reflect the template sequence. For example, a non-complementary nucleotide fragment can be attached to the 5' end of the primer, while the rest of the primer sequence is substantially or completely complementary to that strand. In this paper, primers include all possible forms of primers that can be synthesized, including peptide nucleic acid primers, locked nucleic acid primers, phosphate-thiolated primers, labeled primers, etc. "Forward primer" refers to a primer that can anneal to the antisense strand of double-stranded DNA (dsDNA). "Reverse primer" anneal to the sense strand of dsDNA. Primers typically have a length of at least 10, 15, 18, or 30 nucleotides, or up to about 100, 110, 125, or 200 nucleotides. In some embodiments, primers are between about 15 and about 60 nucleotides long, or between about 25 and about 40 nucleotides long. In some embodiments, primers are between 15 and 35 nucleotides long. There is no standard length suitable for optimal hybridization or polymerase chain reaction amplification. The optimal length for a particular primer application can be easily determined as described by H. Erlich in "PCR Techniques: Principles and Applications of DNA Amplification" (1989).

[0112] In this article, "primer pair" or "primer set" refers to forward and reverse primer pairs (i.e., left and right primer pairs) that can be used together to amplify specific regions of nucleic acids of interest.

[0113] In this document, "probe" refers to a nucleic acid that interacts with a target nucleic acid through hybridization. A probe can be fully or partially complementary to the target nucleic acid sequence. The degree of complementarity typically depends on the probe's function, which is influenced by many factors. Probes can be labeled or unlabeled, or modified in a variety of ways known in the art. Probes can specifically hybridize with the target nucleic acid. Probes can be DNA, RNA, or an RNA / DNA hybrid. Probes can be oligonucleotides, artificial chromosomes, fragmented artificial chromosomes, genomic nucleic acids, fragmented genomic nucleic acids, RNA, recombinant nucleic acids, fragmented recombinant nucleic acids, peptide nucleic acids (PNAs), locked nucleic acids, cyclic heterocyclic oligomers, or conjugates of nucleic acids. Probes can contain modified bases, modified sugar groups, and modified internucleotide linkages. Probes typically have a length of at least 10, 15, 20, 25, 30, 35, 40, 50, 60, 75, 100 nucleotides or longer.

[0114] In this article, "target nucleic acid," "target sequence," or "target fragment" refers to the nucleic acid sequence that needs to be detected and / or quantified in the sample to be analyzed. Target nucleic acid can consist of a fragment of the genome, a complete gene (with or without intergenic sequences), a fragment or portion of a gene (with or without intergenic sequences), or a nucleic acid sequence to which probes or primers are designed to hybridize. Target nucleic acid can include wild-type sequences, mutations, deletions, insertions, or repetitive sequences, tandem repeat elements, genes of interest, regions of genes, or any upstream or downstream regions thereof. Target nucleic acid can represent a substitute sequence or allele of a specific gene. Target nucleic acid can be derived from genomic DNA, cDNA, or RNA.

[0115] In this paper, "multiplexing" refers to a process that enables the simultaneous analysis of multiple analytes and / or multiple samples in a single detection or sequencing run. This is achieved by using unique molecular identifiers, such as nucleic acid barcodes, which can distinguish and identify different analytes and / or samples after data collection.

[0116] The use of the word "approximately" is intended to describe a range, namely a value fluctuating by approximately ±10% above or below the stated value; in other cases, the value may vary within a range of approximately ±5% above or below; in other cases, the value may vary within a range of approximately ±2% above or below; in other cases, the value may vary within a range of approximately ±1% above or below. The above ranges should be understood according to the context and do not imply any further limitations.

[0117] B. Reagent kit

[0118] This article describes a kit for detecting one or more target analytes in a sample.

[0119] In some implementations, the kit is a bead-based immunoquantitative enzyme-linked immunosorbent assay (BIQ-ELISA). This is a protein detection method that combines the specificity of sandwich-based ELISA, the sensitivity of real-time polymerase chain reaction (PCR), and the ease of handling magnetic microspheres. In this system, a first binding agent is biotin-labeled and pre-adsorbed onto streptavidin-coated magnetic beads, while a second binding agent is coupled to a uniquely corresponding oligonucleotide (ONA) barcode for signal amplification.

[0120] This technology represents an advancement in protein detection methods, providing an ultrasensitive and highly specific approach for quantifying proteins in biological samples. It integrates the advantages of existing methods onto an easy-to-use platform, making it an essential tool in the research field. The BIQ-ELISA kit can be used for the quantitative detection of proteins in various sample types, including serum, plasma, and cell culture supernatant, with a detection sensitivity down to femtograms per milliliter.

[0121] The BIQ-ELISA kit features, but are not limited to: sensitivity (up to 1000 times higher than conventional ELISA); low sample volume (less than 10 μL); specificity (sandwich-based detection); simplicity (two-step processing); high efficiency (data generated within 4 hours); and multiplexing (designed to detect combinations of up to five or more targets).

[0122] In some implementations, this kit eliminates the need for sandwich-based protein detection technology because it uses only a second binding agent and eliminates the need for a first binding agent. In some forms, this kit, which does not contain a first binding agent, is referred to as a "magnetic bead-based immunoquantitative PCR with biotin-labeled sample kit." In this BIQL kit, biotin is labeled onto the target analyte, enabling it to bind directly to streptavidin-modified magnetic particles.

[0123] In these implementations, the analyte is labeled by reacting with a protein-labeling reagent containing an affinity pair molecule, thereby attaching the affinity pair member to the analyte to facilitate its interaction with magnetic particles surface-modified with complementary affinity pair members. Simultaneously, the aforementioned second binder carrying a unique DNA barcode binds directly to the target analyte for detection. For example, in such systems, all proteins in the sample are first biotinylated. These biotinylated proteins are immobilized on streptavidin-coated magnetic beads and subsequently incubated with a series of DNA-barcode-labeled detection antibodies, thereby forming a highly specific immune complex between the analyte and the second binder.

[0124] This type of kit can also be used for the quantitative detection of proteins in various sample types, such as serum, plasma, and cell culture supernatant, with detection sensitivity down to the femtogram / mL level. Furthermore, the kit enables the detection of single or multiple analytes (more than 100 or even 1000) under low sample volume conditions (less than 10 μL).

[0125] Unlike traditional sandwich assays that require paired antibodies, this platform utilizes DNA tags as unique molecular identifiers to achieve direct quantitative analysis via quantitative PCR or next-generation sequencing. For example, BIQL technology combines the femtogram sensitivity of bead-based quantitative immunoPCR with the scalable multiplex detection capabilities of biotinylated sample arrays. By combining direct biotinylation of proteins, magnetic bead capture, and DNA barcode antibody detection, BIQL can achieve digital, highly specific quantitative analysis of up to 1000 proteins in a single run—making it an ideal tool for clinical biomarker discovery, systems biology research, and next-generation diagnostic technologies.

[0126] The kit contains the following components:

[0127] 1. The first reagent, including modified magnetic particles.

[0128] i. Structure

[0129] Structurally, in some embodiments, the first reagent comprises magnetic particles that bind to a ligand via an affinity pair. In other embodiments, the first reagent comprises magnetic particles modified with an affinity pair member and does not contain a first ligand.

[0130] a. Magnetic particles

[0131] This document discloses modified magnetic particles for use as solid supports. In some embodiments, the magnetic particles are modified by binding an affinity pair to a first binder. For example, the magnetic particles are first surface-modified to carry a first member of the affinity pair (e.g., streptavidin) on their surface, and then this member binds to a complementary member (e.g., biotin) on the first binder, thereby obtaining magnetic particles surface-modified with the first binder. In other embodiments, the magnetic particles are modified to carry a member of the affinity pair (e.g., streptavidin) that is specifically designed to bind proteins labeled with a complementary affinity member (e.g., biotin). Such affinity-modified magnetic particles (e.g., streptavidin-modified magnetic particles) are commercially available (e.g., from brands such as Dynabeads, Sera-Mag, MagniSort, BioMag, MagMAX, Pure Proteome, Adembeads, Pierce™, etc.) or prepared using chemical methods known in the art (for relevant methods, see the literature by Zhang, Z. et al. published in SCI CHINA SER B, 2007, Vol. 50, pp. 127–134; and the literature by Gong, P. et al. published in J Nanopart Res, 2013, Vol. 15, p. 1558).

[0132] This document discloses modified magnetic particles for use in solid supports. In some embodiments, the modified magnetic particles are selected from the group consisting of Dynabeads, Sera-Mag, MagniSort, BioMag, MagMAX, PureProteome, and Adembeads.

[0133] In some embodiments, the solid support may include any solid material that can be used to immobilize or couple the detection component. Examples, but not limited to, include acrylamide, cellulose, nitrocellulose, glass, polystyrene, vinyl acetate, polypropylene, polymethacrylate, polyethylene, polyethylene glycol, silicates, carbonates, Teflon, fluorocarbons, nylon, silicone rubber, polyanhydride, polyglycolic acid, polylactic acid, polyorthoesters, polyfumarate, collagen, glycosaminoglycans, and polyamino acids. The substrate can take any useful form, including films or membranes, magnetic beads, bottles, petri dishes, fibers, woven fibers, molded polymers, granules, and microparticles. Certain forms of substrates include plates and magnetic beads. Magnetic beads are a useful form of magnetic bead.

[0134] In some embodiments, particles other than magnetic particles may be used in the first reagent. These particles include, but are not limited to, polystyrene magnetic beads, silica magnetic beads, latex magnetic beads, hydrogel magnetic beads, gold nanoparticles (AuNPs), quantum dots, or glass magnetic beads. These particles are modified to contain binding agents for binding with the analyte.

[0135] b. Affinity pair

[0136] In some embodiments, the affinity binding pair members are selected from biotin, 2-iminobiotin, avidin, streptavidin, neutral avidin, glutathione, glutathione S-transferase, maltose, maltose-binding protein, inteptide, chitin, and chitin-binding protein.

[0137] Other suitable binding pairs include receptor / ligand pairs, antibody / antigen pairs, natural or synthetic receptor / ligand pairs, hapten / antibody pairs, antigen / antibody pairs, epitope / antibody pairs, mimic epitope / antibody pairs, nucleic acid aptamer / target molecule pairs, hybridization partners, intercalating agent / target molecule pairs, and the use of surface and anchoring reagents fixed by electrostatic charge.

[0138] For biotin-avidin affinity pairs (such as biotin-streptavidin or biotin-neutralavidin pairs), biotin can be attached to the first binder, while streptavidin, avidin, or neutral avidin can be attached to the carrier or surface, and vice versa. Biotin binds to the biotin-binding compound via affinity, thereby non-covalently coupling the first binder to the carrier or surface. In some embodiments, other affinity pairs for immobilizing the first binder to a solid surface include, but are not limited to, histidine tag / nickel ion (Ni... 2+ ) or cobalt ions (Co 2+ ), Strep tag / Strep-Tactin®, Protein A / IgG, Protein G / IgG, SBP tag / Streptavidin, FLAG tag / Anti-FLAG antibody resin, HA tag / Anti-HA antibody resin, Myc tag / Anti-Myc antibody resin, Halo tag / HaloTag ligand, SpyTag / SpyCatcher.

[0139] In other embodiments, when a protein in a sample is labeled by one member of an affinity pair, thereby directly binding to a complementary member of the affinity pair on the carrier surface, the affinity pair member and its complementary member can be any of the combinations described above, such as biotin and avidin. Specifically, after being labeled with biotin, the protein in the sample can bind to streptavidin on the carrier surface (e.g., magnetic particles modified with streptavidin).

[0140] Non-covalent connections can be achieved through electrostatic interactions, hydrogen bonding, metal coordination, physical adsorption, host-guest interactions, hydrophobic interactions, π-stacking interactions, van der Waals forces, magnetic interactions, and dipole-dipole interactions.

[0141] A preferred non-covalent linkage mechanism is the affinity interaction formed through receptor-ligand complexes. The binding of a ligand to its binding partner can be achieved through intermolecular forces such as ionic bonds, hydrogen bonds, hydrophobic interactions, and van der Waals forces. Therefore, the affinity interaction mentioned in this paper refers to the non-covalent interaction between the ligand and its binding partner, forming a complex.

[0142] c. Binder

[0143] Typically, the first binding agent binds to the particle via an affinity pair and is present on the particle surface, facing outwards to facilitate binding to the target analyte. In some embodiments, the kit contains only a second binding agent (e.g., binding via an affinity pair) that specifically recognizes the target analyte bound to the particle. This second binding agent is typically coupled to a nucleic acid barcode.

[0144] This article discloses first and second binding agents, which may be independently antibodies, nucleic acid aptamers or peptides, or combinations thereof.

[0145] In some implementations, suitable antibody pairs (e.g., antibody binding pairs) can be identified through the following steps: 1) Identifying suitable antibody pairs: Each antibody is tested separately as a capture antibody and a detection antibody via dot hybridization screening. Antibody combinations are ranked according to signal intensity, as higher intensity indicates stronger binding affinity to the target protein. The combination with the highest affinity is selected for further sensitivity testing; 2) Checking cross-reactivity: All capture antibodies are printed on the same array. Each target protein is tested separately with the corresponding detection antibody. The array data is analyzed to determine specificity: Non-cross-reactive combinations show a strong signal only for their intended antigen. Cross-reactive combinations bind significantly to unintended targets. The antibody pair that ultimately exhibits minimal or no cross-reactivity is selected.

[0146] Binders are typically oriented upwards and exposed to the surrounding environment to bind to target analytes. The design and orientation of these binders enhance their ability to interact with and bind to target analytes present in the environment, typically in liquid media such as buffers, biological fluids, or other aqueous solutions. This spatial arrangement enhances the accessibility and interaction between the binder and the target analyte. In some embodiments, by maintaining an upward and exposed configuration, the binder is prevented from being obstructed by other components, surface structures, or steric hindrances that could reduce binding efficiency.

[0147] (A) Antibody

[0148] In some embodiments, both the first and second binding agents are antibodies. In some embodiments, the analytes are selected from the group consisting of antibodies specifically targeting IL-8 (interleukin-8), ALPP (alkaline phosphatase, e.g., placental type (EC 3.1.3.1)), CD38 (differentiation cluster 38), SOD1 (superoxide dismutase-1), and VCAN (hyaluronic acid), as well as DAB (DNA barcode modified detection antibody) and CAB (capture antibody) antibodies, as shown in Table 2.

[0149] Therefore, in some implementations, the DAB (DNA barcode modified detection antibody) specifically targeting IL-8 is an anti-IL-8 antibody supplied by RayBiotech (Peachtree Corners, Georgia), catalog number 130-10975, and its binding pair antibody is also purchased from RayBiotech.

[0150] Therefore, in some implementations, the DAB (DNA barcode-modified detection antibody) specifically targeting ALPP is an anti-ALPP antibody provided by RayBiotech (Peachtree Corners, Georgia), catalog number 130-10518, and its binding pair antibody catalog number 130-10519B.

[0151] Therefore, in some implementations, the DAB (DNA barcode modified detection antibody) specifically targeting CD38 is an anti-CD38 antibody provided by RayBiotech (Peachtree Corners, Georgia), catalog number 130-10323, and its binding pair antibody catalog number 130-10324B.

[0152] Therefore, in some implementations, the DAB (DNA barcode modified detection antibody) specifically targeting SOD1 is an anti-SOD1 antibody provided by RayBiotech (Peachtree Corners, Georgia), catalog number 130-10369, and its binding pair antibody catalog number 130-10366B.

[0153] Therefore, in some implementations, the DAB (detection antibody against DNA barcode modification) specifically targeting VCAN is an anti-VCAN antibody provided by RayBiotech (Peachtree Corners, Georgia), catalog numbers 130-10778 and 130-10773.

[0154] Natural antibodies are typically heterotetrameric glycoproteins, composed of two identical light chains (LC) and two identical heavy chains (HC). Each light chain is usually linked to a heavy chain by a single covalent disulfide bond, although the number of disulfide bonds between heavy chains varies among different immunoglobulin isotypes. Each heavy and light chain also has regularly spaced intrachain disulfide bridges. Each heavy chain has a variable region (V(H) or VH) at one end, followed by several constant regions. Each light chain has a variable region (V(L) or VL) at one end and a constant region at the other; the constant region of the light chain aligns with the first constant region of the heavy chain, and the variable region of the light chain aligns with the variable region of the heavy chain. Specific amino acid residues are thought to form the interface between the variable regions of the light and heavy chains. Based on the amino acid sequence of their constant regions, antibody light chains of any vertebrate species can be classified into two distinct types: κ (kappa) and λ (lambda). Immunoglobulins can be classified into different categories based on the amino acid sequence of their heavy chain constant regions. Human immunoglobulins are classified into five major classes: IgA, IgD, IgE, IgG, and IgM. Some of these can be further subdivided into subclasses (isotypes), such as IgG-1, IgG-2, IgG-3, and IgG-4; and IgA-1 and IgA-2. Those skilled in the art can identify the corresponding mouse classes. The heavy chain constant regions corresponding to different immunoglobulin classes are respectively designated as α, δ, ε, γ, and μ.

[0155] In the context of antibodies and their fragments, terms such as "variable region" and "variable sequence" are used to describe certain parts of the variable domain that differ in sequence between different antibodies. These parts are used for the binding and specificity of the antibody to its specific antigen. However, the variability in the variable domain of an antibody is not uniformly distributed, but is usually concentrated in three segments called complementarity-determining regions (CDRs) or hypervariable regions (HVs), which are present in both the light chain and heavy chain variable domains. The more conserved parts in the variable domain are called frame regions (FRs). The variable domains of the natural heavy chain and light chain each contain four frame regions (FR1, FR2, FR3, and FR4), which are mainly β-sheet conformations and are linked by three CDRs (HV1, HV2, and HV3). These CDRs form loops connecting the β-sheet structure and, in some cases, constitute part of the β-sheet structure. The CDRs in each chain are tightly linked by the frame regions and together with the CDRs of other chains, form the antigen-binding site of the antibody. Constant regions do not directly participate in antibody-antigen binding but have various effector functions, such as participating in antibody-dependent cytotoxicity.

[0156] It is well known that the variable regions of an antibody—especially the complementarity-determining regions (CDRs) within them—are the primary determinants of antibody binding and binding specificity. It is also well known that antibody portions other than the variable regions (or CDRs) can be replaced, altered, or eliminated without eliminating the antibody's (or, in the case of elimination of antibody portions, antibody fragments) binding and binding specificity. The modular nature of antibody structures allows for extensive substitution, alteration, and elimination of antibody portions other than the variable regions (or CDRs) while preserving the binding and binding specificity of both the variable regions and CDRs. For example, antibodies and antibody fragments can be any form of antibody-binding fragment containing any or all of the CDR sequences of the B5 antibody, or any form of antibody-binding fragment containing the CDR sequences of the B5 antibody.

[0157] The terms “polyclonal antibody” and “monoclonal antibody” include complete antibodies and functional (e.g., antigen-binding) antibody fragments, including Fab fragments, F(ab')2 fragments, Fab' fragments, Fv fragments, recombinant IgG (rlgG) fragments, single-chain antibody fragments (including single-chain variable fragment scFv), and single-domain antibody fragments (e.g., sdAb, sdFv, nanobodies). The term also covers genetically engineered and / or otherwise modified forms of immunoglobulins, such as intracellular antibodies, peptide bodies, chimeric antibodies, fully human antibodies, humanized antibodies, and heterologous conjugates, multispecific antibodies (e.g., bispecific antibodies, biantibodies, triantibodies, and tetraantibodies), tandem biscFv, and tandem triscFv. The term also includes complete or full-length antibodies, including antibodies of any class or subclass, including IgG and its subclasses, IgM, IgE, IgA, and IgD. Therefore, although usually discussed in the context of IgG, the target antibody for the variable domain of Ig-Fc specific immunoglobulin can be IgM, IgE, IgA or IgD.

[0158] In some embodiments, the antibody is a heterodimer of bispecific and trispecific (or more) Ig antibodies and Fc fusion proteins. Exemplary structures include, but are not limited to, IgG, IgM, monomers, dimers, trimers, or polymorphs of scFv-Fc. For example, bispecific, trispecific, and multispecific formats include, but are not limited to, bispecific and trispecific IgG, IgG-scFv, IgG-dAb, scFv-Fc-scFv, convex-concave coordination (KIH)-IgG, κλ-antibody, KIH0Fc-Fab / scFv, tandem scFv, KIH trispecific, and bispecific Fc fusion proteins (N- or C-terminus, with or without KIH).

[0159] In some embodiments, a multispecific antibody molecule may contain multiple antigen-binding sites, with different sites targeting different antigens. In some embodiments, a multispecific antibody molecule may bind to multiple (e.g., two or more) epitopes on the same antigen. In some embodiments, a multispecific antibody molecule contains one antigen-binding site targeting a target cell (e.g., cancer cells) and another specific antigen-binding site targeting HERV-K Env. In some embodiments, a multispecific antibody molecule is a bispecific antibody molecule. Bispecific antibody molecules can be classified into five different structural groups: (i) bispecific immunoglobulin G (BsIgG); (ii) IgG with an additional antigen-binding moiety; (iii) bispecific antibody fragments; (iv) bispecific fusion proteins; and (v) bispecific antibody conjugates.

[0160] This invention also covers chimeric antibodies and hybrid antibodies having dual or multiple antigen or epitope specificity, as well as fragments, such as F(ab')2, including hybrid fragments. These antibodies and fragments can be prepared by techniques known in the art and can be screened according to general methods for preparing antibodies and screening for antibody specificity and activity (see, for example, Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor, New York, 1988, which is cited herein by reference).

[0161] This invention also covers human antibodies and / or humanized antibodies. Many non-human antibodies (e.g., antibodies derived from mice, rats, or rabbits) are naturally antigenic in humans and may therefore trigger undesirable immune responses when administered to humans. Therefore, using human or humanized antibodies in the methods described in this invention can reduce the likelihood of triggering undesirable immune responses when administered to humans.

[0162] Human, chimeric, or humanized B5 antibody derivatives are particularly suitable for use in humans; however, mouse antibodies or antibodies from other species can also be used for many purposes (e.g., in vitro or in situ detection assays, acute in vivo application, etc.). Humanized antibodies may contain substitutions, deletions, or additions of amino acid residues in one or more non-human CDRs. Compared to non-derived humanized antibodies, humanized antibody derivatives may have substantially the same, stronger, or weaker binding affinity. In certain forms, one, two, three, four, or five amino acid residues in the CDR have been substituted, deleted, or added (i.e., mutated). Fully humanized antibodies are particularly suitable for the treatment of human patients.

[0163] Humanized or chimeric versions of B5 antibodies may contain nearly a portion of at least one (usually two) variable regions, wherein all or nearly all complementarity-determining regions (CDRs) are consistent with the corresponding regions of the non-human immunoglobulin (i.e., the donor antibody), while all or nearly all frame regions (FRs) are derived from the consensus sequence of human immunoglobulins. Preferably, the antibody also contains part or all of the immunoglobulin constant region (Fc), typically the constant region of human immunoglobulins.

[0164] The constant region of an antibody can be selected based on the antibody's intended function, particularly the desired effector function. In some embodiments, the constant region of an antibody may be (or contain) the constant region of human IgA, IgD, IgE, IgG, or IgM. In a particular form, when the humanized antibody is used for therapeutic purposes and antibody effector functions (such as antibody-dependent cell-mediated cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDC) activity) are required, the constant region of human IgG, particularly the constant regions of IgG1 and IgG3 isotypes, is used. In other forms, when the antibody is used for therapeutic purposes but antibody effector functions are not required, IgG2 and IgG4 isotypes are used.

[0165] In addition, antibodies containing amino acid modifications in the Fc constant region have been disclosed, which can alter the effector function of the antibody, as disclosed in U.S. Patent Application Publication Nos. 2005 / 0037000 and 2005 / 0064514.

[0166] In some embodiments, the antibody comprises at least one variable region of both the light and heavy chains. In other forms, the antibody may further comprise one or more CH1, hinge, CH2, CH3, and CH4 regions of the heavy chain. The antibody can be selected from any class of immunoglobulins, including IgM, IgG, IgD, IgA, and IgE, and any subtype, including IgG1, IgG2, IgG3, and IgG4. In some embodiments, when it is desired that the antibody exhibit cytotoxic activity, the constant region is a constant region capable of activating complement, and its class is typically IgG1. In other forms, when such cytotoxic activity is not required, the constant region may be of the IgG2 class. Antibodies may comprise sequences from multiple classes or subtypes, and selecting a specific constant region to optimize the desired effector function is a common skill of those skilled in the art.

[0167] The frame region and consensus frame (CDR) of a humanized antibody do not need to be completely identical to the parental sequence. For example, the donor CDR or consensus frame can be mutated by substituting, inserting, or deleting at least one residue, so that the CDR or frame residue at that site corresponds neither to the consensus sequence nor to the donor antibody. However, these mutations are usually not too widespread. Typically, at least 75% of the humanized antibody residues correspond to the parental frame region (FR) and CDR sequence, more commonly 90%, and ideally more than 95%.

[0168] In the kits and methods disclosed herein, antibodies are typically used as the first and / or second binding agents to facilitate the detection of the target analyte by forming an immune complex. In some embodiments, the immune complex is a "sandwich" structure comprising a first antibody and a second antibody, each binding to the target analyte, such that the analyte is sandwiched between the first and second antibodies. In other embodiments, when the analyte is biotinylated and directly binds to the modified particles, only the analyte and the second antibody participate in the formation of the immune complex.

[0169] In some embodiments, the antibodies / antigens used in this invention are described in Table 1 below.

[0170] Table 1. Antibody / antigen pairings (including supplier and catalog number)

[0171]

[0172] (B) Other binders

[0173] In some embodiments, the first and second binding agents comprise nucleic acid aptamers, such as DNA, RNA, or peptide nucleic acid aptamers. Nucleic acid aptamers are short, single-stranded DNA or RNA oligonucleotides that, due to their secondary structure, can bind ligands (proteins, small molecules, and even living cells) with high affinity. Most DNA or RNA can form secondary structures, but only very rare sequences can bind to specific targets with significant affinity. Aptamers bind not only with high affinity but also with high specificity, such as aptamers screened for binding theophylline. Aptamers are sometimes referred to as artificial antibodies, but compared to antibodies, aptamers have several advantages, including ease of production, low cost, and no animal involvement. Aptamers are less likely to elicit an immune response than antibodies and have been used as therapeutic agents in humans.

[0174] Aptamers are obtained through rigorous selection, where they "evolve" from a random library of DNA, RNA, or amino acids, filtering out a small number (or even none) of the sequences capable of binding to the target from a large pool of starting sequences. The random library is typically surrounded by a fixed primer region, such that each oligonucleotide in the pool contains the sequence 5'-primer1-N20-60-primer2 (reverse complementary)-3', where N is a random base. Primers are used to amplify the selected library via PCR. The process of generating aptamers through in vitro selection was independently developed by Szostak and Gold's team in 1990 and is known as Systematic Evolution of Ligands with Exponential Enrichment (SELEX). The SELEX procedure involves incubating the DNA / RNA sequences of the random library with the target, followed by a partitioning step to remove unbound sequences, then a elution step to recover the bound sequences, and finally an amplification step to generate a library of enriched bound sequences. Several variants of SELEX have emerged over the years. One SELEX variant using capillary electrophoresis (CE) allows for faster completion of SELEX due to its more efficient partitioning and prevention of aptamers from binding to the ligand support (where the ligands flow freely in the buffer). Compared to conventional SELEX (which typically requires 10 or more rounds of screening), CE-SELEX usually identifies highly binding and specific aptamers in a single round (almost always less than five). Aptamers generated by CE-SELEX can have dissociation constants in the nanomolar or even picomolar range.

[0175] d. First reagent without the first binder

[0176] In some embodiments, the first reagent does not contain a first binding agent. When the first binding agent is not present, the modified magnetic particles bind directly to the target analyte via interactions between members of the affinity pair. In these embodiments, the magnetic particles are typically modified by one member of the affinity pair, while the analyte is labeled by the complementary member of that pair; the member and the complementary member can bind to each other through any suitable interaction (as described above).

[0177] The affinity binding pair used to bind the analyte to the magnetic particle can be any of those described above. For example, the affinity binding pair can be biotin or its derivatives (such as 2-iminobiotin) with a biotin-binding compound (such as avidin, streptavidin, neutral avidin). Other examples of binding pairs include glutathione with glutathione S-transferase, maltose with maltose-binding protein, and peptide- or chitin-binding protein.

[0178] Other suitable binding pairs include: receptor / ligand pairs, antibody / antigen pairs, natural or synthetic receptor / ligand pairs, hapten / antibody pairs, antigen / antibody pairs, epitope / antibody pairs, mimic epitope / antibody pairs, aptamer / target molecule pairs, hybridization partners, intercalator / target molecule pairs, and surface and anchoring agents that bind via electrostatic interactions.

[0179] For biotin-avidin binding pairs (such as biotin-streptavidin or biotin-neutral avidin pairs), biotin can be linked to the analyte, while streptavidin, avidin, or neutral avidin can be linked to a carrier, surface, or particle, and vice versa. Biotin binds to biotin-binding compounds through affinity interactions, thereby non-covalently linking the analyte to a carrier, surface, or particle. In some embodiments, other affinity binding pairs for immobilizing the analyte to a solid surface or particle include, but are not limited to, His-tag / Ni-tag. 2+ or Co 3 Strep tag / Strep-Tactin®, Protein A / IgG, Protein G / IgG, SBP tag / Streptavidin, FLAG tag / Anti-FLAG antibody resin, HA tag / Anti-HA antibody resin, Myc tag / Anti-Myc antibody resin, Halo tag / HaloTag ligand, SpyTag / SpyCatcher.

[0180] ii. Characteristics

[0181] In some embodiments, the diameter of the modified magnetic particles disclosed herein is about 0.5 micrometers to 5 micrometers, 0.3 micrometers to 5.5 micrometers, 0.2 micrometers to 6 micrometers, 1 micrometer to 4.5 micrometers, 1.5 micrometers to 4 micrometers, 2 micrometers to 3.5 micrometers, or 2.5 micrometers to 3 micrometers.

[0182] In some embodiments, the density of the modified magnetic particles disclosed herein is about 1.4 g DS / cm³. 3 Up to 1.8 gDS / cm 3 1.3g DS / cm 3 Up to 1.9g DS / cm 3 1.5g DS / cm 3 Up to 1.7g DS / cm 3 1.2g DS / cm 3 Up to 2.0g DS / cm 3 1.6g DS / cm 3 Up to 1.9g DS / cm 3 1.1g DS / cm 3 Up to 2.1g DS / cm 3 , or 1.0g DS / cm 3Up to 2.5g DS / cm 3 .

[0183] In some embodiments, the modified magnetic particles disclosed herein are homogeneous, non-porous, superparamagnetic, monodisperse, and highly cross-linked polystyrene microspheres, wherein the magnetic material is uniformly dispersed throughout the magnetic beads. The magnetic material in the magnetic particles consists of a mixture of magnetite (γ-Fe₂O₃) and magnetite (Fe₃O₄). In some embodiments, the magnetic particles are encapsulated by a thin polystyrene shell, which encapsulates the magnetic material and prevents leakage of the magnetic material from the magnetic beads or trapping of ligands inside the beads. The shell also protects the target from iron exposure while providing a well-defined surface area for the adsorption or coupling of various molecules. In some embodiments, the surface of the magnetic particles is activated with toluenesulfonyl, epoxy, carboxylic acid, and amino groups.

[0184] 2. The second reagent, including the second binder.

[0185] The second reagent includes a specific second binding agent for one or more target analytes, optionally coupled to a nucleic acid barcode via a linker.

[0186] i. Connector

[0187] In some embodiments, one member of the affinity pair is linked to a magnetic particle via a linker. In some embodiments, a second binding agent is coupled to a nucleic acid barcode via a linker. In some embodiments, the linker is selected from, but is not limited to, the group consisting of: sulfosuccinimide-4-(N-maleimidemethyl)cyclohexane-1-carboxylic acid ester (Sulfo-SMCC), bis(sulfosuccinimide)succinate (BS3), bissuccinimide succinate (DSS), bissuccinimide sulfoxide (DSSO), and bissuccinimide dibutylurea (DSBU). In a preferred embodiment, the linker is bis(sulfosuccinimide)succinate (BS3).

[0188] In some implementations, the connector has the following structure: , where n1 is an integer from 1 to 10, 1 to 8, 1 to 6, 2 to 10, 2 to 8, 4 to 10 or 4 to 8, for example 6; where the secondary amino group (-NH-) comes from the second binding agent and the nucleic acid barcode, respectively.

[0189] BS3

[0190] BS3 is a bifunctional, water-soluble, non-cleavable, and membrane-impermeable amino-to-amino crosslinking agent. BS3 contains an N-hydroxysulfosuccinimide (NHS) ester at each end of its 8-carbon spacer arm, which reacts with an amino group. The NHS ester reacts with a primary amine at pH 7–9 to form a stable amide bond, releasing the N-hydroxysulfosuccinimide leaving group. Proteins (including antibodies) typically have multiple primary amines on their lysine (K) residue side chains and at the N-terminus of each polypeptide; these primary amines are the target of the NHS ester crosslinking agent.

[0191] Sulfo-SMCC

[0192] Sulfo-SMCC is an indestructible and membrane-impermeable crosslinking agent. It contains an N-hydroxysuccinimide (NHS ester) that reacts with an amino group and a maleimide group that reacts with a thiol group. The NHS ester reacts with a primary amine at pH 7–9 to form a stable amide bond. The maleimide reacts with a thiol group at pH 6.5–7.5 to form a stable thioether bond. Due to the cyclohexane bridge in the spacer arm of Sulfo-SMCC and SMCC, its maleimide group is exceptionally stable below pH 7.5. Because of the hydrophilic sulfonyl group, Sulfo-SMCC is soluble in water and many common buffers to approximately 10 mM, thus avoiding the use of organic solvents that may disrupt protein structure.

[0193] DBCO-Azide

[0194] Dibenzocyclooctyne (DBCO) reagents are a class of click chemistry labeling reagents. The DBCO group can specifically react with azide-labeled molecules or biomolecules to form a stable triazole ring. This click chemistry is also known as strain-promoted alkyne-azidocycloaddition (SPAAC). DBCO reagents have been widely used in bioconjugation, labeling, and chemical biology. DBCO click chemistry reactions can be carried out in aqueous buffers or organic solvents, depending on the properties of the substrate molecule. Reagents with polyethylene glycol (PEG) arms can increase the hydrophilicity of the compound.

[0195] DSS

[0196] DSS is a non-cleavable, membrane-permeable crosslinking agent containing an N-hydroxysuccinimide (NHS) ester at each end of its 8-carbon spacer arm, which reacts with an amino group. The NHS ester reacts with a primary amine at pH 7–9 to form a stable amide bond, releasing the N-hydroxysuccinimide leaving group. Proteins (including antibodies) typically have multiple primary amines on the side chains of their lysine (K) residues and at the N-terminus of each polypeptide; these primary amines are the targets of the NHS ester crosslinking agent. DSS is first dissolved in an organic solvent (such as DMF or DMSO) and then added to the aqueous crosslinking reaction. BS3 is a water-soluble analog of DSS and is also suitable for applications requiring a hydrophilic crosslinking agent (e.g., for cell surface crosslinking).

[0197] ii. Nucleic acid barcode

[0198] In some embodiments, the second binder is coupled to one or more components as barcodes or tags. In some embodiments, these barcodes are typically nucleic acid barcodes. Barcodes and / or tags can be used to identify, isolate, sequence, organize, degrade, maintain, store, purify, or otherwise characterize or manipulate associated biomacromolecules or pools of biomacromolecules. Barcodes and tags can be selected from a variety of detectable, sequenceable, or scoreable molecules. Exemplary barcodes and tags include sequence identifiers (such as nucleotide or amino acid sequences), capture tags, and dyes or other detectable molecules. In some embodiments, a biomacromolecule contains one or more barcodes or tags. Barcodes or tags are provided that can be used to capture barcode biomacromolecules from similar pools of biomacromolecules. Barcodes or tags are also provided that can be used to detect, quantify, or otherwise detect the presence or absence of biomacromolecules. Barcodes or tags are also provided that can be used to sequence or manipulate associated biomacromolecules. In some embodiments, barcodes allow for the sequencing, selection, sorting, degradation, synthesis, and manipulation of associated biomacromolecules via microfluidic systems.

[0199] In some implementations, this kit can be used for the detection of multiple analytes in a single sample, such as the simultaneous detection of more than 10, more than 100, or even more than 1,000 analytes in a single sample. For example, this kit can be used to detect thousands of different proteins in a biological sample (such as blood) in a single test.

[0200] In this type of multiplex detection, the second binding agent for each specific type of analyte is labeled with a unique nucleic acid barcode. Each unique nucleic acid barcode corresponds to a single type of analyte, and the nucleic acid barcodes for different analytes are distinguishable from each other. By performing PCR and / or next-generation sequencing analysis on each unique nucleic acid barcode, the presence and quantification information of the corresponding specific analyte can be determined.

[0201] Nucleic acid barcoding can be achieved by designing unique nucleotide sequences. Table 2 (below) and Figure 13 An exemplary nucleic acid barcode sequence is shown.

[0202] A typical barcoded biomolecule is a nucleic acid, which contains a nucleotide sequence that acts as a barcode to identify encoded data. A DNA barcode is a short DNA sequence that uniquely identifies a specific associated characteristic, such as a nucleic acid sequence encoding one or more genes, or fragments of metadata. By associating a characteristic with a DNA barcode of uniform length and melting temperature (Tm), these characteristics can be manipulated experimentally in mixed forms and deconstructed via subsequent PCR amplification, followed by microarray hybridization or high-throughput sequencing. DNA barcoding technology has significantly increased the throughput of genetic screening, making previously time-consuming or cumbersome experiments possible.

[0203] In some implementations, the sequence identifier (i.e., a barcode) is included in the promoter sequence. In other forms, the identifier is attached to the promoter sequence or the growing biomolecule during synthesis. In one exemplary embodiment, the sequence identifier is attached as a single prefabricated unit to the promoter sequence or the growing biomolecule.

[0204] Molecular or sequence barcoding is a method for identifying molecules from other molecular pools. Barcoding is used for sequencing identification of complex DNA strand pools in next-generation sequencing. Barcoding can also be used for cell identification and RNA identification in solution, where sequence resolution and sample separation are important for downstream sample isolation. The synthesis of barcoded DNA typically involves pre-synthesizing the sequence using methods known in the art, and then ligating it to the sample of interest using DNA ligases.

[0205] An exemplary DNA barcode for a specific analyte of the present invention is shown below.

[0206]

[0207]

[0208] 3. Other components

[0209] i. Buffer solutions and reagents

[0210] In some implementations, the kit for detecting the target analyte in a sample includes buffers. Several buffer solutions are used in the BIQ-ELISA process to optimize different steps. The buffer used for conjugation includes 200 mM MEPES (pH 8.5) to prepare oligonucleotide solutions and facilitate the conjugation of oligonucleotides to antibodies during DAB-ONA preparation. For purification by rapid protein liquid chromatography (FPLC), two buffers are used: Buffer A, containing 150 mM NaCl and 50 mM Tris-HCl (pH 8.0); and Buffer B, containing 1 M NaCl and 50 mM Tris-HCl (pH 8.0). These buffers enable efficient elution and purification of antibody-oligonucleotide conjugates. Dilution buffers include PBS (PBST) or a variant thereof containing 0.05% Tween-20. Wash buffers for removing unbound components include PBST (PBS containing 0.05% Tween-20) and PBS containing 0.1% Tween-20. Elution buffer, such as 10 mM NaOH, is used to release DNA from the magnetic beads; this concentration is optimized to maintain elution efficiency and compatibility with subsequent qPCR reactions. Additionally, qPCR reaction buffers are prepared using a 2× PCR premix containing primers, probes, and SYBR Green dye for fluorescence detection. These buffers are carefully formulated to ensure compatibility with the eluted DNA and to minimize background signal from primer dimers. Each buffer is specifically designed to enhance the sensitivity, specificity, and reliability of the BIQ-ELISA system.

[0211] A buffer solution is an aqueous solution that provides optimal pH, ionic strength, cofactors, etc., to achieve optimal enzyme activity. In some embodiments, buffer solutions are suitable for enzyme storage. In some embodiments, buffer solutions are suitable for PCR. Suitable buffer components include, but are not limited to, one or more salts, reducing agents (such as dithiothreitol), buffering agents, deoxyribonucleoside triphosphates (dNTPs), or combinations thereof. One or more salts provide monovalent or divalent cations, such as Mg²⁺. 2+ Mn 2+ K + NH4 + and Na + Exemplary salts that may be included in the buffer solution include KCl, MgCl2, NaCl, MnCl2, NH4Cl, MgSO4, (NH4)2SO4, and magnesium acetate. The concentration range of one or more salts may be from about 1 mM to about 500 mM, from about 5 mM to about 250 mM, from about 10 mM to about 200 mM, from about 25 mM to about 150 mM, or from about 50 mM to about 100 mM.

[0212] Suitable buffers are known in the art, including but not limited to tris(hydroxymethyl)aminomethane (such as Tris-HCl), trioctanol, dioctanol, and HEPES. The pH range of the buffer can be from about 6 to 10 (e.g., pH 6.8 to 9, such as about pH 8.5). The concentration range of one or more buffers can be from about 10 mM to about 100 mM.

[0213] In some implementations, the reagents used in the BIQ-ELISA kit include a PCR master mix containing DNA polymerase and nucleotides for qPCR amplification, providing enzymatic activity and building blocks for DNA synthesis. Furthermore, one or more oligonucleotide primers are used to specifically amplify the ONA barcode, ensuring accurate and efficient targeted amplification. The amplified ONA barcode is detected using TaqMan probes with fluorescent reporter and quencher groups, enabling precise quantification via fluorescence signals during the qPCR process. These reagents are crucial for achieving the required sensitivity and specificity of the BIQ-ELISA system.

[0214] Any buffers and reagents used in the BIQ-ELISA system (such as those described above) can also be used in the BIQL assay. The BIQL assay may also include additional buffers and reagents for protein labeling to introduce affinity-pairing components onto the protein.

[0215] When the method includes a protein labeling step, the sample containing the analyte needs to be co-incubated with the protein labeling reagent in a buffer solution. This step can be performed using any buffer solution that promotes the reaction between the protein in the sample and the protein labeling reagent. For example, a phosphate-buffered saline (PBS) solution with a pH range of 7 to 8 can be used to react with a suitable protein labeling reagent (such as any of the reagents described in the "Protein Labeling Reagents" section).

[0216] ii. Sealant

[0217] In some implementations, a blocking agent is used to reduce background noise. When using a blocking agent, it can be formulated in a buffer solution, such as a blocking buffer containing 10% casein, 5% bovine serum albumin (BSA), and B1002. Several blocking agents have been used in the BIQ-ELISA process to reduce background noise and enhance detection sensitivity. One such blocking agent is PBS containing 10% casein and 5% bovine serum albumin (BSA), referred to as 10C5B, whose blocking efficiency has been tested. Another formulation, CB1002, consists of PBS containing 10% casein and 1% (w / v) B1002, as a low-BSA alternative to 10C5B. Additionally, a blocking solution containing 5% BSA and 0.1% Tween-20 has been used, although it showed a higher background signal in some experiments. A Biolipidure mixture was also tested, prepared by mixing 50 µL of B203, B206, B802, B804, and B1002 (each a 5% (w / v) solution) with 4750 µL of PBS to explore its effectiveness in minimizing background interference. These formulations were evaluated to determine the optimal blocking agent for detection. Such blocking agents can also be used in BIQL assays.

[0218] In some embodiments, blocking buffers are used to prevent or reduce the activity of a catalyst (e.g., a polymerase). In some embodiments, terminating or blocking agents quench the enzymatic catalytic activity that binds component building blocks to the growing biomacromolecule chain. Typically, these methods involve terminating and / or blocking agents that are specific or effective for the catalyst enzyme used to stop, reduce, or otherwise modulate the activity of the catalyst enzyme. Blocking buffers and terminating agents effective for specific catalyst enzymes are known in the art.

[0219] iii. Protein labeling reagents

[0220] In some embodiments, when the target analyte binds directly to particles modified with affinity-binding pair members, the kit of the present invention includes a protein labeling reagent for introducing the complementary member of the affinity-binding pair into the sample. In these embodiments, the protein labeling reagent can universally label all proteins in the sample—while specific detection of the target analyte relies on a second binding agent and its corresponding nucleic acid barcode. For example, all biotinylated proteins can bind to streptavidin on modified magnetic particles; however, only the target protein (analyte) will be recognized and bound by the second binding agent coupled with the nucleic acid barcode, and the unique nucleic acid barcode of each analyte enables the detection and differentiation of the analyte.

[0221] Protein labeling reagents can attach one or more molecules to proteins in a non-covalent or covalent manner, a process that can be achieved through chemical or enzymatic methods. Typically, chemical labeling of proteins involves using protein labeling reagents containing reactive groups that are responsible for binding to both the protein and the labeled molecule.

[0222] In some embodiments, the reactive group of the protein labeling reagent is an amine-reactive N-hydroxysulfosuccinimide ester. The NHS ester reacts with a primary amine at pH 7–9 to form a stable amide bond, simultaneously releasing the N-hydroxysulfosuccinimide leaving group. Proteins typically possess multiple primary amines on lysine residue side chains and at the N-terminus of each polypeptide chain, which can serve as targets for the NHS ester crosslinking reagent. Other examples of reactive groups that can be used for protein labeling in the kit include maleimides (e.g., reacting with thiol groups), primary amines combined with carbodiimides (e.g., reacting with carboxyl groups), hydrazines and alkoxyamines (e.g., reacting with glycoproteins), and any combination thereof. In some embodiments, the protein labeling reagent also includes a linker between the reactive group and an affinity pair member (such as biotin, 2-iminobiotin, glutathione, maltose, or an aptamer). Polyethylene glycol is commonly used as a linker to improve the solubility of the protein labeling reagent.

[0223] In some embodiments, the protein labeling agent is a biotinylation agent comprising biotin or a biotin derivative, an amine reactive group (such as an NHS ester), and optionally a linker between the reactive group and the biotin or biotin derivative. For example, the biotinylation agent may contain (PEG)n (where n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more repeating ethylene glycol subunits) as a linker between the reactive group and the biotin or biotin derivative. In an exemplary kit, the biotinylation agent is EZ-Link NHS-PEG4-Biotin, which consists of an NHS ester as the reactive group, (PEG)4 as the linker, and biotin as the labeling group.

[0224] C. Usage Method

[0225] A method is provided for detecting one or more analytes in a sample using the disclosed kit. This method typically involves forming an immune complex in the presence of the analyte to be detected and amplifying a DNA barcode on a second binding partner. The entire process typically takes a total of four hours to complete. In some embodiments, the entire procedure can be completed in up to four hours. For example, the time required to complete the procedure is approximately 30 minutes to 4 hours, 30 minutes to 3 hours, 30 minutes to 2 hours, 30 minutes to 1 hour, 1 hour to 2 hours, 1 hour to 3 hours, 1 hour to 4 hours, 2 hours to 4 hours, 2 hours to 3 hours, or 3 hours to 4 hours.

[0226] In one specific embodiment, the formation and purification of the immune complex (ONA-DAB-antigen-CAB-biotin-streptavidin-magnetic beads) are as follows: The sample is co-incubated with DAB-ONA and CAB-biotin-streptavidin-magnetic beads in a provided 96-well plate. In the presence of the target protein, DAB-ONA binds to the target protein and connects to the CAB-biotin-streptavidin-magnetic beads via biotin-streptavidin interaction; unbound protein is removed by washing with a magnetic automated washer.

[0227] In other embodiments, the construction and purification process of the immune complex (ONA-DAB-analyte-biotin-SA-magnetic bead complex) formed between the analyte and the second binding agent is as follows: First, all proteins in the sample are universally biotinylated using a biotinylation reagent. Then, the biotinylated protein is co-incubated with streptavidin magnetic beads and a DNA barcode-labeled detection antibody in a provided 96-well plate. The biotinylated protein binds to the magnetic beads via the biotin-streptavidin interaction. When the target analyte is present, the DNA barcode-labeled detection antibody specifically binds to the analyte bound to the magnetic beads, while unbound proteins are removed by an automated magnetic cleaning device.

[0228] In this system, all proteins in the sample are first biotinylated for full-spectrum labeling. These biotinylated proteins are immobilized on the surface of streptavidin-coated magnetic beads and then incubated with a set of DNA barcode-labeled detection antibodies to form highly specific immune complexes. Unlike traditional sandwich assays that require secondary antibodies, this technology platform utilizes DNA tags as unique molecular identifiers for direct quantitative analysis via quantitative PCR or next-generation sequencing. BIQL technology combines the femtogram sensitivity of bead-based quantitative immunoPCR with the scalable multiplex detection capabilities of biotinylated sample arrays. By integrating direct protein biotinylation, magnetic bead capture, and DNA barcode antibody detection, BIQL can achieve digital, highly specific quantitative detection of over 1000 proteins in a single run—a feature that makes it an ideal solution for clinical biomarker discovery, systems biology research, and next-generation diagnostic technologies.

[0229] PCR amplification: The bound immune complexes are released from the magnetic beads using a suitable elution buffer and transferred as a template for qPCR. Primers and the PCR reaction mixture are added to the wells, and data are collected using qPCR. The Ct values ​​obtained from qPCR are used to calculate the antigen concentration in each sample, where a lower Ct value indicates a higher antigen concentration. During the experiment, a set of target protein standards at known concentrations are run simultaneously to generate a standard curve for quantifying unknown samples.

[0230] 1. Analyte to be detected

[0231] The disclosed kits can be used to detect one or more analytes (also referred to herein as analyte molecules). In some forms, the methods and kits described herein can be used for immunoassays to detect one or more of the following biomarker classes: cytokines, circulating tumor-specific proteins, proteins associated with one or more infectious diseases, intracellular markers, and combinations thereof. In some forms, the analytes are selected from the group consisting of: IL-8 (interleukin-8), ALPP (alkaline phosphatase, e.g., placental type (EC 3.1.3.1)), CD38 (differentiation group 38), SOD1 (superoxide dismutase-1), and VCAN (chondroitin), or VCAN (multifunctional proteoglycan), or combinations thereof.

[0232] In some embodiments, the analyte is MIP-1α, eosinophil chemokine, IL-22, IL-12p40, IL-12p70, EXN4, IFN-γ, IL-1β, IL-6, or TNF-α, or any combination thereof.

[0233] In some forms, the kits disclosed herein can bind target analytes, such as homodimers, homotrimers, etc., wherein each monomer of the dimer binds to a first binding agent and the second monomer binds to a second binding agent.

[0234] The kits and methods disclosed herein can be used to determine the concentration of one or more analytes in a sample. Therefore, one or more analytes can be measured in the same sample. Combinations of analytes that can be measured in the same sample include, for example, combinations of analytes or activities associated with disease states or physiological conditions. Some such combinations include combinations of cytokines and their receptors (e.g., TNF-α, TNF-β, IL1-α, IL1-β, IL2, IL4, IL6, IL-10, IL-12, IFN-γ, etc.), combinations of growth factors and their receptors (e.g., EGF, VGF, TGF, VEGF, etc.), abused drugs, therapeutic drugs, vitamins, pathogen-specific antibodies, autoantibodies (e.g., one or more antibodies against Sm, RNP, SS-A, SS-α, J0-1, and Sc1-70 antigens), allergen-specific antibodies, tumor markers (e.g., CEA, PSA, CA-125 II, CA 15-3, CA 19-9, CA 72-4, CYFRA, etc.). 21-1, NSE, AFP, etc.), cardiac disease markers (including markers for congestive heart failure and / or acute myocardial infarction, such as troponin T, troponin I, troponin C, myoglobin, CKMB, myeloperoxidase, glutathione peroxidase, β-natriuretic peptide (BNP), α-natriuretic peptide (ANP), endothelin, aldosterone, C-reactive protein (CRP), etc.), hemostasis-related markers (such as fibrin monomer, D-dimer, thrombin-antithrombin complex, prothrombin fragments 1 and 2, anti-Xa factor, etc.), markers of acute viral hepatitis infection (such as anti-hepatitis A virus IgM antibody, anti-hepatitis B core antigen IgM antibody, hepatitis B surface antigen, anti-hepatitis C virus antibody, etc.), Alzheimer's disease markers (α-amyloid protein, etc.). Markers for various diseases include: white blood cells, β-amyloid protein, Aβ42, Aβ40, Aβ38, Aβ39, Aβ37, Aβ34, tau protein, etc.; osteoporosis markers (e.g., cross-linked N-terminal C-peptide, total deoxypyridine cross-linking, free deoxypyridine cross-linking, osteocalcin, alkaline phosphatase, type I collagen C-terminal propeptide, bone-specific alkaline phosphatase, etc.); markers for fertility status or fertility-related disorders (e.g., estradiol, progesterone, follicle-stimulating hormone (FSH), luteinizing hormone (LH), prolactin, hCG, testosterone, etc.); markers for thyroid diseases (e.g., thyroid-stimulating hormone (TSH), total T3, free T3, total T4, free T4 and reverse T3); and prostate cancer markers (e.g., total PSA, free PSA, complex PSA, prostate acid phosphatase, creatine kinase, etc.). Some forms of disclosure include measurements of analytes associated with a specific disease state or physiological condition (e.g., analytes in the above combinations; for example, combinations for the diagnosis of thyroid diseases may include thyroid-stimulating hormone (TSH), total T3, free T3, total T4, free T4, and reverse T3).

[0235] In some forms, the ensemble includes one or more low-abundance analytes from a conventional sample matrix, such as analytes with concentrations below about 100 fg / mL, preferably below about 10 fg / mL. A non-limiting list of analytes that may be included in the ensemble includes, for example, IL-17, IL-21, IL-31, Ab-38, Ab-40, Ab-42, Ab-39, Ab-43, Ab-15, Ab-16, Ab-17, Aβ oligomers, C-peptides, IL-13, IL-17A, IL-2, IL-4, IL-5, IL-6, IL-8, IL-12 / 23p40, IL-12p70, INF-γ, PSA, PSAc, Tau, phosphorylated Tau, TNFα, etc. Troponin I, Cardiac Troponin T, Troponin C, VEGF, VEGF-A, VEGF-B, VEGF-C, VEGF-D, EPO, LC3B, Albumin, CHO-P, Escherichia coli HCP, IgA, IgE, IgG, IgG1, IgG4, IgM, NSO-P, Per-C6, Residual Protein A, IgG2, IgG3, IgG4, AFP, CA125, Activated Caspase-3, CXCL11 / I-TAC, ErbB2 / HER2, HGF R / o-MET, IFN-β, MMP1, MMP2, MMP3, MMP9, β-NGF, TFF3, TIMP1, Kim-1, α-2-macroglobulin, D-dimer, ICAM-1, myeloperoxidase, myoglobin, PAI-1, PCSK9, plasminogen, renin / prorenin, tPA, CXCL1 / GRO-α, CCL2 / MCP1, CCL3 / MIP-1α, CCL4 / MIP-1β, CCL5 / Rantes, CRP, CXCL9 / MI G, CXCL10 / IL-10, G-CSF, GM-CSF, IFN-α, IFN-γ, IL-1α, IL-1β, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-12(p70), IL-13, IL-15, IL-18, IL-22, IL-23, IL-33, c-MET, adiponectin, FGF21, TSLP, GLP-1, growth hormone, IGF1, IGF2, insulin, leptin, prolactin, HIV p24, HB-EGF, AKT, phosphorylated AKT and combinations thereof.

[0236] In some forms, the kits and methods described herein can be used to detect analytes that are low in abundance due to recent exposure and / or infection. For example, early diagnosis of cancer, bacterial infections (such as anthrax), viral infections (such as HIV, hepatitis, human papillomavirus, etc.), and toxin exposures (such as ricin, botulinum toxin A, B, or E, etc.) is limited by the limits of detection (LOD) of existing technologies (such as ELISA) because these technologies have LODs higher than the circulating concentrations of low-abundance proteins that may indicate disease onset. Combinations may include one or more low-abundance analytes in a conventional sample matrix, such as analytes with concentrations below about 100 fg / mL or below about 10 fg / mL. A non-limiting list of analytes that may be included in a combination includes, for example, HIV gp41, HIV gp120, HIV gp160, HIV p24, HIV p66, HIV p51, HIV p17, HIV p31, Tat, Nef, Viv, hepatitis A, B, C, D or E antigens, human papillomavirus types 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 73 and / or 82, HPV-E6 and E7 proteins, IL-17, IL-21, IL-31, IL-22, IL-23, IL-33, cardiac troponin T and combinations thereof.In addition, the combination may include one or more analytes that are low in abundance due to recent illness, exposure, and / or infection: for example, Ab-38, Ab-40, Ab-42, Ab-39, Ab-43, Ab-15, Ab-16, Ab-17, Aβ oligomer, C-peptide, IL-13, IL-17A, IL-2, IL-4, IL-5, IL-6, IL-8, INF-γ, PSA, Tau, phosphorylated Tau, TNFα, troponin I, cardiac troponin White blood cell T, troponin C, VEGF, VEGF-A, VEGF-B, VEGF-C, VEGF-D, EPO, LC3B, albumin, CHO-P, E. coli HCP, IgA, IgE, IgG, IgG1, IgG4, IgM, NSO-P, Per-C6, residual protein A, IgG2, IgG3, IgG4, AFP, CA125, activated Caspase-3, CXCL11 / I-TAC, ErbB2 / HER2, HGFR / o-MET, IFN-β, MMP1, MMP2, MMP3, MMP9, β-NGF, TFF3, TIMP1, Kim-1, α-2-macroglobulin, D-dimer, ICAM-1, myeloperoxidase, myoglobin, PAI-1, PCSK9, plasminogen, renin / prorenin, tPA, CXCL1 / GRO-α, CCL2 / MCP1, CCL3 / MIP-1α, CCL4 / MIP-1β, CCL5 / Ran tes, CRP, CXCL9 / MIG, CXCL10 / IL-10, G-CSF, GM-CSF, IFN-α, IFN-γ, IL-1α, IL-1β, IL-3, IL-7, IL-12(p70), IL-13, IL-15, IL-18, c-MET, adiponectin, FGF21, GLP-1, growth hormone, IGF1, IGF2, insulin, leptin, prolactin, HB-EGF, AKT, phosphorylated AKT and combinations thereof.

[0237] This invention discloses analyzable sample types, including but not limited to food samples (including food extracts, food homogenates, beverages, etc.), environmental samples (e.g., soil samples, environmental sludge, collected environmental aerosols, environmental swab samples, water filtrate, etc.), industrial samples (e.g., starting materials, products, or intermediates in industrial production processes), human clinical samples, veterinary samples, and samples from other biological sources. Analyzable biological samples include, but are not limited to, feces, mucosal swabs, physiological samples, and / or samples containing cell suspensions. Specific examples of biological samples include blood, serum, plasma, feces, mucosal swabs, tissue aspirates, tissue homogenates, cell cultures and cell culture supernatants (including cultures of eukaryotic and prokaryotic cells), urine, saliva, sputum, and cerebrospinal fluid samples.

[0238] The analytes that can be measured using the kits disclosed in this invention include, but are not limited to, proteins, toxins, nucleic acids, microorganisms, viruses, cells, fungi, spores, carbohydrates, lipids, glycoproteins, lipoproteins, polysaccharides, drugs, hormones, steroids, nutrients, metabolites, and any modified derivatives of the above molecules, or any complex or combination containing one or more of the above molecules. The level of a certain analyte in a sample may indicate a disease or pathological state, or may simply indicate whether a patient has been exposed to the analyte.

[0239] In some forms, the methods disclosed in this invention are capable of detecting the various biological and biochemical agents described above. In one form, these methods can be used to detect pathogenic or potentially pathogenic viruses, bacteria, and toxins, including biological warfare agents (“BWAs”), in a variety of relevant clinical and environmental samples (including but not limited to blood, sputum, feces, filters, swabs, etc.). A non-limiting list of pathogens and toxins that can be analyzed individually or in combination using the methods disclosed in this invention includes Bacillus anthracis (anthrax), Yersinia pestis (plague), Vibrio cholerae (cholera), Tulafrancsis (tula fungal infection), Brucella spp. (brucellosis), Coxsella benalei (Q fever), Listeria, Salmonella, Shigella, Vibrio cholerae, Chlamydia trachomatis, Burkholderia pseudomeliformis, poxviruses (including smallpox virus), viral encephalitis, Venezuelan equine encephalitis virus (VEE), Western equine encephalitis virus (WEE), Eastern equine encephalitis virus (EEE), alpha virus, viral hemorrhagic fever, Arenaviridae, Bunyaviridae, Filoviridae, Flaviviridae, Ebola virus, Staphylococcus aureus enterotoxin, ricin, botulinum toxin (A, B, E), and botulinum toxin. Bacillus, mycotoxins, Fusarium, Trichoderma, Cephalosporins, Trichoderma, Erectomonas, Aspergillus niger, glanders, wheat fungi, Bacillus megaterium, Pseudomonas rubrum, yellow rain, trichosporon toxins, Salmonella typhimurium, aflatoxin, rat fleas, mountain fleas, smallpox, monkeypox, Arena virus, Hantavirus, Lassa fever, Argentine hemorrhagic fever, Bolivian hemorrhagic fever, Rift Valley fever virus, Crimean-Congo virus, Hantavirus, Marburg hemorrhagic fever, yellow fever virus, dengue virus, influenza (including human and animal strains, including H5N1 avian influenza, influenza A, H1-specific influenza A, H3-specific influenza A, H5-specific influenza A, 2009-H1N1-specific influenza A, influenza B), respiratory syncytial virus (RSV), human immunodeficiency virus I and II (HIV). Hepatitis I and II), Hepatitis A, Hepatitis B, Hepatitis C, Non-A, B, and C Hepatitis, Enteroviruses, Epstein-Barr virus, Cytomegalovirus, Herpes simplex virus, Chlamydia trachomatis, Neisseria gonorrhoeae, Trichomonas vaginalis, Human papillomavirus, Treponema pallidum, Streptococcus pneumoniae, Borrelia burgdorferi, Haemophilus influenzae, Mycoplasma pneumoniae, Chlamydia pneumoniae, Legionella pneumophila, Staphylococcus aureus, Staphylococcus aureus enterotoxin B (SEB), Ricin toxin, Shiga toxin 1, Shiga toxin 2, Moraxella catarrhalis, Streptococcus pyogenes, Clostridium difficile, Neisseria meningitidis, Klebsiella pneumoniae, Mycobacterium tuberculosis, Group A Streptococcus, Escherichia coli O157, Coronavirus, Coxsackie A virus, Rhinovirus, Parainfluenza virus, Respiratory syncytial virus (RSV), Metapneumovirus, Smallpox virus, and Adenovirus.

[0240] 2. Analyte labeling

[0241] In some embodiments, the method eliminates the need for a sandwich immunoassay using two binding agents; instead, the analyte binds directly to the particle via an affinity pair, followed by a second binding agent that binds to the analyte immobilized on the particle surface. In these embodiments, the method includes a step of labeling the analyte with a protein labeling reagent (as described above). This protein labeling reagent can universally label all proteins in the sample—while specific detection of the target analyte relies on the second binding agent and its corresponding nucleic acid barcode. For example, all biotinylated proteins can bind to streptavidin on modified magnetic particles; however, only the target protein (analyte) is specifically recognized and bound by the second binding agent that binds to that target protein. These second binding agents are coupled to nucleic acid barcodes, and the unique nucleic acid barcode for each analyte enables detection and differentiation. After the labeling step, the sample containing the labeled analyte (and all other labeled proteins) is co-incubated with modified magnetic particles containing the complementary member of the binding pair.

[0242] When the method includes an analyte labeling step, the sample containing the analyte is incubated with a protein labeling reagent in a buffer. This step can use any buffer that promotes the reaction between the target analyte and the protein labeling reagent. For example, phosphate-buffered saline (PBS) with a pH in the range of 7 to 8 can be used for this labeling reaction. During incubation, the analyte reacts with the protein labeling reagent, attaching one member of the affinity pair to the analyte. This member introduced onto the analyte is complementary to and binds to the member on the modified particle surface. This allows the analyte to be anchored to the modified magnetic particle surface without the need for a surface binding agent. For example, a biotinylation reagent attaches biotin to the analyte, which then binds to streptavidin on the modified magnetic particle surface.

[0243] 3. Sample incubation to form immune complexes.

[0244] The method disclosed in this invention involves co-incubating a sample with modified magnetic particles and a second binding agent to form an immune complex. In some embodiments, the modified magnetic particles are pre-coated with a first binding agent, such as a biotinylated capture antibody (CAB), which binds to an affinity pair (e.g., streptavidin / biotin pair) on the particle surface. The sample containing the target antigen is co-incubated with these particles and a second binding agent (e.g., a detection antibody (DAB)) coupled to an oligonucleotide (ONA) barcode. During incubation, the target antigen specifically binds to the first binding agent on the magnetic particles, while the second binding agent simultaneously binds to another epitope of the same antigen. This forms a sandwich-like immune complex (e.g., CAB-antigen-DAB), where the biotin-streptavidin interaction immobilizes the complex on the magnetic particles. This step ensures high specificity and efficient binding, laying the foundation for subsequent purification and detection.

[0245] In some embodiments, the method does not use two binding agents to form a sandwich-like immune complex; instead, it directly binds the labeled protein to affinity-paired molecules (e.g., streptavidin / biotin pairs) on the particle surface. In these embodiments, the target analyte binds to the modified magnetic particles via a biotin-streptavidin interaction, and the second binding agent is the only binding agent involved in the formation of the immune complex.

[0246] 4. Washing and eluting DNA barcodes

[0247] The washing process involves multiple steps to remove unbound and non-specifically bound molecules from the immune complexes. After incubating the sample with magnetic particles and the binding agent, the reaction plate is placed on a magnetic support to immobilize the particles. The supernatant containing unbound components is carefully removed, and the wells are washed multiple times with washing buffer (such as PBS containing 0.1% Tween-20). This process can be automated using a magnetic automated washer to ensure thorough cleaning and reduce background noise. After the final washing step, residual liquid is removed by centrifugation or drying.

[0248] To release oligonucleotide (ONA) barcodes from magnetic particles, NaOH is typically used as the elution buffer. The solution is incubated at room temperature for 10 minutes to allow the barcodes to separate from the immune complex. The reaction plate is then placed back onto the magnetic scaffold to separate the particles, and the supernatant containing the eluted DNA barcodes is carefully transferred to a clean PCR plate for subsequent amplification.

[0249] 5. Perform nucleic acid amplification or sequencing.

[0250] The method disclosed in this invention includes nucleic acid amplification and / or sequencing of nucleic acid barcodes.

[0251] i. PCR

[0252] The method disclosed in this invention includes nucleic acid amplification, such as quantitative PCR (qPCR), after the formation and purification of the aforementioned immune complex. For qPCR, oligonucleotide (ONA) barcodes coupled with a second binding agent (such as DAB) are released from magnetic particles by elution with NaOH. The eluted oligonucleotides are transferred to a qPCR reaction mixture containing a PCR master mixture (including DNA polymerase and nucleotides), oligonucleotide primers specific to the ONA sequence, and TaqMan probes labeled with fluorescent reporter and quencher groups. During qPCR, the ONA barcodes are amplified, and the fluorescence signal is monitored in real time, where a lower Ct value corresponds to a higher antigen concentration.

[0253] In some embodiments, qPCR is performed using a detection probe and a quenching oligonucleotide. A detection probe is a labeled oligonucleotide that can be used to indicate the presence of a specific target nucleic acid. Typically, the detection probe can form a double-stranded structure with a sequence within the amplified target nucleic acid because the probe is complementary to the sequence in the target region. In some embodiments, the detection probe includes a fluorophore, a first region containing a first PCR primer tag sequence (or a portion thereof), and a second region containing a (target-specific) sequence complementary to the amplified target nucleic acid product. In some embodiments, the detection probe includes a fluorophore and a second region containing a (target-specific) sequence complementary to the amplified target nucleic acid product. In some embodiments, the first region contains about 7-12 nucleotides, and the second region contains about 15-25 nucleotides.

[0254] Typically, the melting temperature (Tm) of the detection probe is designed to be approximately 70-78°C.

[0255] Typically, the annealing temperature (Ta) of the detection probe is designed to be approximately 65-83°C.

[0256] In some implementations, the detection probe is designed to hybridize / anneal with the target at a higher temperature (e.g., 5-10°C higher) than the annealing temperature of the forward and / or reverse primers to ensure detection before primer extension. If the detection probe binds to the target at the same time as or later than the binding time of the forward / reverse primers, the polymerase may begin replicating the target that has not bound to the detection probe. As a result, the newly synthesized DNA will not be detectable by the fluorescence from the previous round. This situation can lead to inaccurate data.

[0257] In some embodiments, the detection probe is designed to bind to the target at 70°C or higher. In some embodiments, the detection probe is designed to be quenched at 58-62°C (inclusive) in the absence of target binding (e.g., due to binding to quenching oligonucleotides).

[0258] A quenching oligonucleotide is an oligonucleotide that can hybridize with a detection probe. In some embodiments, the quenching oligonucleotide includes a fluorescent quenching group and a sequence that is fully or partially complementary to a first region of the detection probe. In some embodiments, the quenching oligonucleotide includes a fluorescent quenching group and a sequence that is fully complementary to the detection probe. Typically, the quenching oligonucleotide contains about 10-12 nucleotides, and the detection probe contains 30 or more nucleotides (e.g., 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more nucleotides).

[0259] Typically, the melting temperature (Tm) of quenchers is designed to be approximately 24-62°C.

[0260] Typically, the annealing temperature (Ta) of the quencher is designed to be approximately 19-65°C.

[0261] Typically, quenching oligonucleotides and detection probes can hybridize with each other, which can lead to fluorescence quenching. The detection probe / quenching oligonucleotide can have different structures under different conditions, which can be reflected by changes in fluorescence. When the detection probe and quenching oligonucleotide hybridize in a stable double-stranded structure, the fluorophore and quencher approach each other. The fluorophore can be quenched by the quencher, and the detection probe becomes non-fluorescent at the emission wavelength of the fluorophore. Under denaturing conditions, such as at high temperatures, the detection probe and quenching oligonucleotide separate, and the fluorophore becomes fluorescent. In the presence of the target amplification product and under suitable conditions, the detection probe can spontaneously bind to one strand of the amplification product instead of quenching the oligonucleotide, and the fluorophore becomes fluorescent. In some embodiments, the double-stranded structure formed by the detection probe and the target amplification product is thermodynamically more stable than the double-stranded structure formed with the quenching oligonucleotide.

[0262] In some implementations, the 3' end of the quenching oligonucleotide and / or detection probe is blocked to prevent polymerase extension.

[0263] Suitable blocking groups include phosphate groups, quenching groups, or biotin. In some embodiments, the 3' end of the quenched oligonucleotide is blocked by a quenching group (e.g., Black Hole Quencher® (BHQ®)) to prevent polymerase elongation. In some embodiments, the 3' end of the detection probe is phosphorylated.

[0264] The fluorophore and fluorescence quenching group can be located on the terminal or internal bases of the detection probe or quenching oligonucleotide.

[0265] In some embodiments, they are located at complementary bases at the opposite ends of the two strands. Therefore, in some embodiments, the fluorophore may be attached to the 5' or 3' end of the detection probe, and / or the fluorescence quenching group may be attached to the 5' or 3' end of the quenching oligonucleotide. In some embodiments, the fluorophore is attached to the 5' end of the detection probe. In some embodiments, the fluorescence quenching group is attached to the 3' end of the quenching oligonucleotide.

[0266] In some implementations, the detection probe and the quenching oligonucleotide are not linked and are therefore two separate oligonucleotides.

[0267] In some implementations, primers are also probes.

[0268] By fluorescently labeling one or more primers, the amplification of a target can be indirectly measured using only the primers (which also serve as probes) without the need for additional probes, thereby realizing the strategy disclosed in this invention for indirectly measuring target amplification by measuring unbound or unused probes. Therefore, the composition may also contain one or more fluorescently labeled primers (e.g., forward and / or reverse primers). These primers (e.g., forward or reverse primers) can be used for the amplification of nucleic acid molecules in the methods disclosed in this invention. In some embodiments, the fluorescently labeled forward or reverse primers may be universal or generic primers (e.g., the same forward and reverse primers can be used to amplify two or more different targets). In other forms, the forward and reverse primers are target-specific.

[0269] In some implementations, the fluorescently labeled forward or reverse primers contain a tag sequence at the 5' end and a target-specific binding sequence at the 3' end.

[0270] Primers typically contain at least 10, 15, 18, 20, 25, 30, 40, 50, or 60 nucleotides. In some embodiments, fluorescently labeled primers are preferably about 25 to about 45 nucleotides in length, more preferably about 30 to about 40 nucleotides (e.g., 31 or 39 nucleotides). However, there is no standard primer length for optimal hybridization or amplification. The optimal length for a particular primer application can be easily determined by those skilled in the art.

[0271] In some embodiments, the fluorescently labeled forward or reverse primers are designed to have a melting temperature (Tm) of about 66-74°C.

[0272] In some implementations, fluorescently labeled forward primers can be used to initiate qPCR (or dPCR or isothermal) reactions and can also be used to measure the amount of unused primers in each qPCR (or dPCR or isothermal) cycle.

[0273] The oligonucleotides disclosed in this invention can be modified on the base moiety, sugar moiety, or phosphate backbone, and can contain other additional groups or tags, as long as they do not affect their intended function.

[0274] For example, oligonucleotides may contain one or more modified base moieties, such as 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, dihydrouracil, β-D-galactosylguanine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, and 2-methylguanine.

[0275] Suitable modified sugar moieties include arabinose, 2-fluoroarabinose, xylulose, and hexose.

[0276] Suitable phosphate backbone modifications include thiophosphates, dithiophosphates, aminothiophosphates, aminophosphates, diaminophosphates, methylphosphonates, alkyl phosphates, and methyl acetals or their analogues.

[0277] In some embodiments, the oligonucleotides and related methods disclosed in this invention utilize the principle of molecular energy transfer (MET), and preferably utilize fluorescence resonance energy transfer (FRET).

[0278] In some embodiments, the oligonucleotides and related methods disclosed in this invention utilize the principles of static or contact quenching, molecular energy transfer, and FRET. When the acceptor fluorophore is close to the donor fluorophore (e.g., 20–100 Å), the fluorescence intensity of the acceptor fluorophore increases, while the fluorescence intensity of the donor fluorophore decreases due to the increased efficiency of fluorescence resonance energy transfer (FRET) from donor to acceptor fluorophore. When the two parts are even closer, the intensities of both the donor and acceptor fluorophores decrease; this phenomenon is called static or contact quenching. At this close distance, most of the absorbed energy is dissipated as heat, and only a small amount of energy is emitted as light. For example, proximity probes and TaqMan probes utilize the FRET mechanism, where the distance between the donor and acceptor parts leads to FRET quenching. On the other hand, in competitive hybridization probes and molecular beacons, when the probe is not hybridizing with the target, the two fluorescent parts are very close to each other, resulting in contact or static quenching (see, for example, Marras SA et al., Nucleic Acid Research, 30(21):e122(2002)). A useful feature of contact quenching is that all fluorophores can be quenched to the same degree, regardless of whether the emission spectrum of the fluorophore overlaps with the absorption spectrum of the quencher. This is one of the key conditions that determines the efficiency of FRET.

[0279] In some embodiments, the method relies on contact quenching because the detection probe and the corresponding quenching oligonucleotide are designed to hybridize with each other, thereby bringing the fluorophore and the fluorescence quencher close to each other.

[0280] Oligonucleotides can be labeled with donor and / or acceptor moieties.

[0281] In some embodiments, the acceptor portion may quench the emission of the donor portion only, or it may itself emit energy upon excitation by the emission of the donor portion. In some embodiments, the donor portion is a fluorophore, and the acceptor portion may or may not be a fluorophore, such that the fluorescence energy emitted by the donor portion is absorbed by the acceptor portion. In some embodiments, the acceptor portion is a fluorescence quencher.

[0282] Fluorescence quenchers can quench the signal of fluorophores to varying degrees.

[0283] For example, in some embodiments, the detected fluorescence signal in the presence of a fluorescence quencher may be 90% or less, 80% or less, 70% or less, 60% or less, 50% or less, 40% or less, 30% or less, 20% or less, 15% or less, 10% or less, or 5% or less of the signal detected in the absence of a quencher. In some embodiments, no signal is detected in the presence of a fluorescence quencher (e.g., a signal above the background).

[0284] In some embodiments, suitable fluorophores are selected from:

[0285] Alexa Fluor® dyes, ATTO™ dyes (such as ATTO™ 390, ATTO™ 425, ATTO™ 465, ATTO™ 488, ATTO™ 495, ATTO™ 514, ATTO™ 520, ATTO™ 532, ATTO™ Rho6G, ATTO™ 542, ATTO™ 550, ATTO™ 565, ATTO™ Rho3B, ATTO™ Rho11, ATTO™ Rho12, ATTO™Thio12, ATTO™ Rho101, ATTO™ 590, ATTO 594, ATTO™ Rho13, ATTO™ 610, ATTO™ 620, ATTO™ Rho14, ATTO™ 633, ATTO™ 647, ATTO™ 647N, ATTO™ 655. ATTO™ Oxa12, ATTO™ 665, ATTO™ 680, ATTO™ 700, ATTO™ 725, ATTO™ 740), DyLight® dyes, cyanine dyes (e.g., Cy™ 2, Cy™ 3™, Cy™ 3.5, Cy™ 3b, Cy™ 5™, Cy™ 5.5, Cy™ 7, Cy™ 7.5), FluoProbes dyes, SulfoCy™ dyes, Seta™ dyes, IRIS™ dyes, SeTau™ dyes, Srfluor dyes, Square dyes, fluorescein (FITC), tetramethylrhodamine (TRITC). Examples of Alexa Fluor® dyes include, but are not limited to: Alexa Fluor® 350, Alexa Fluor® 405, Alexa Fluor® 430, Alexa Fluor® 488, Alexa Fluor® 500, Alexa Fluor® 514, Alexa Fluor® 532, Alexa Fluor® 546, Alexa Fluor® 555, Alexa Fluor® 568, Alexa Fluor® 594, Alexa Fluor® 610, Alexa Fluor® 633, Alexa Fluor® 635, Alexa Fluor® 647, Alexa Fluor® 660, Alexa Fluor® 680, Alexa Fluor®700, Alexa Fluor® 750, Alexa Fluor® 790, etc.

[0286] In some embodiments, the fluorophore is selected from:

[0287] Fluorescein (FAM™), Hexachlorofluorescein (HEX™), 2-chloro-7'-phenyl-1,4-dichloro-6-carboxyfluorescein (VIC®), 5'-dichloro-dimethoxyfluorescein (JOE™), Tetrachlorofluorescein (TET™), SUN™, Tetramethylrhodamine (TAMRA™), QUASAR® 670, CAL Fluor® Orange (CF560), CAL Fluor® Red 610 (CF610), and Texas Red® (sulfonylrhodamine 101 acid chloride).

[0288] Examples of fluorescence quenchers include, but are not limited to:

[0289] Dark quenchers, Black Hole Quencher® (BHQ®) (e.g., BHQ®-0, BHQ®-1, BHQ®-2, BHQ®-3), Qx1 quenchers, ATTO™ quenchers (e.g., ATTO™ 540Q, ATTO™ 580Q, and ATTO™ 612Q), dimethylaminoazobenzenesulfonic acid (Dabsyl), Iowa Black® RQ, Iowa Black® FQ, IRDye® QC-1, QSY® dyes (e.g., QSY® 7, QSY® 9, QSY® 21), AbsoluteQuencher™, and Eclipse™. In some embodiments, the fluorescence quencher is a dark quencher. Dark quenchers can absorb excitation energy and dissipate the energy in different ways (e.g., in the form of heat). Therefore, dark quenchers themselves have little or no fluorescence (do not emit fluorescence). Further examples of dark quenchers are described in the following U.S. Patents: Nos. 8,822,673 and 8,586,718; U.S. Patent Publications Nos. 20140378330, 20140349295 and 20140194611; and International Patent Applications: WO200142505 and WO200186001, all of which are incorporated herein by reference in their entirety.

[0290] Other suitable fluorescence quenchers are known in the art, including but not limited to:

[0291] 1,4-Bis(3-hydroxypropylamino)-anthraquinone, 1-(3-(4,4'-dimethoxytriphenylmethyloxy)propylamino)-4-(3-hydroxypropylamino)-anthraquinone, 1-(3-(2-cyanoethoxy(diisopropylamino)phosphoryloxy)propylamino)-4-(3-(4,4'-dimethoxytriphenylmethyloxy)propylamino)-anthraquinone (#Q1), 1,5-Bis(3-hydroxypropylamino)-anthraquinone, 1-(3-hydroxypropylamino)-5-(3-(4,4'-dimethoxytriphenylmethyloxy)propylamino)-anthraquinone, 1-(3-(cyanoethoxy(diisopropylamino)phosphoryloxy)propylamino)-5-(3-(4,4'-dimethoxytriphenylmethyloxy)propylamino)-anthraquinone Anthraquinone (#Q2), 1,4-bis(4-(2-hydroxyethyl)phenylamino)anthraquinone, 1-(4-(2-(4,4'-dimethoxytriphenylmethyloxy)ethyl)phenylamino)-4-(4-(2-hydroxyethyl)phenylamino)anthraquinone, 1-(4-(2-(2-cyanoethoxy(diisopropylamino)phosphoryloxy)ethyl)phenylamino)-4-(4-(2-(4,4'-dimethoxytriphenylmethyloxy)ethyl)phenylamino)anthraquinone, 1,8-bis(3-hydroxypropylamino)anthraquinone, and 4-((4-(dimethylamino)phenyl)azo)benzoic acid (Dabcyl).

[0292] In some implementations, it may be advantageous to attach different quenchers to the same quenching oligonucleotide (e.g., for the detection of two or more targets in multicolor multiplex detection).

[0293] For example, BHQ®-1, BHQ®-2, and BHQ®-3 can quench different fluorophores. For instance, FAM™ can be quenched by BHQ®-1, while Quasar670 can be quenched by BHQ®-2 or BHQ®-3. In some embodiments, the fluorophore quencher is selected from BHQ®-1, BHQ®-2, and BHQ®-3.

[0294] In some implementations, SYBR Green can also be used as a detection method for PCR to amplify and quantify DNA.

[0295] SYBR Green is a fluorescent dye that non-specifically binds to double-stranded DNA during amplification. As DNA is amplified in the PCR cycle, the dye intercalates into the newly formed double-stranded DNA, leading to an increase in fluorescence intensity, which is positively correlated with the amount of DNA amplified.

[0296] ii. Next-Generation Sequencing (NGS)

[0297] In some implementations, oligonucleotide barcodes are prepared for sequencing, such as next-generation sequencing (NGS). This involves tagging oligonucleotide barcodes with unique identifiers corresponding to different samples or targets, then mixing them and sequencing them. The NGS platform identifies and quantifies the barcodes, providing sensitive, multiplex detection results for the level of the target antigen in the sample. In these forms, each analyte can be identified by a unique DNA barcode, allowing the detection / analysis of hundreds to thousands of analytes using a single kit / detection method. These methods ensure accurate detection and quantification of the target antigen with high sensitivity and specificity.

[0298] In some implementations, NGS platforms include, but are not limited to, Illumina sequencing, Ion Torrent sequencing, PacBio sequencing (SMRT), Oxford Nanopore sequencing, Roche 454 sequencing, SOLiD sequencing, BGI / MGI sequencing (DNBSeq), and Helicos sequencing.

[0299] Table 2: Sample reagents for NGS testing (showing target, catalog number, and supplier)

[0300]

[0301] The nucleic acid substrate used for sequencing can be nucleic acids in the original sample and / or its amplified nucleic acid products, such as products generated by a qPCR protocol.

[0302] In various aspects, the analysis may include sequencing nucleic acids using, but is not limited to, the following methods: Sanger sequencing, single-molecule real-time (SMRT) sequencing, nanopore DNA sequencing, massively parallel signature sequencing (MPSS), colony sequencing, 454 pyrosequencing, Illumina sequencing, combined probe anchoring synthesis (cPAS), SOLiD sequencing, Ion Torrent semiconductor sequencing, DNA nanosphere sequencing, Heliscope single-molecule sequencing, or any combination thereof, optionally using a microfluidic system. In some embodiments, sequencing is performed using Illumina, Ion Torrent, PacBio, or Oxford Nanopore technologies, or any similar next-generation sequencing platform.

[0303] For comprehensive analysis, sequencing (such as next-generation sequencing (NGS)) can be used to analyze raw nucleic acids and / or PCR products.

[0304] This method enables detailed analysis of gene expression and identification of analytes. The versatility of this workflow allows it to be adapted to various sequencing platforms, including but not limited to Illumina, Ion Torrent, PacBio, and Oxford Nanopore technologies, NanoString nCounter, and Miser sequencing (i.e., PCR sequencing from Illumina).

[0305] In some embodiments, molecular analysis of the analyte involves sample indexing, adapter ligation, and / or library normalization.

[0306] Sample indexes (“barcodes”) are used to assign unique identifiers to multiple targets and / or samples, such as hundreds to thousands of targets and / or samples, enabling them to be processed together on high-throughput sequencing platforms. Adapter ligation can be performed according to the specific protocols of the sequencing platform, adding platform-compatible end sequences and unique index sequences to DNA or RNA fragments specific to kidney biomarkers. Libraries can be prepared at concentrations suitable for sequencing and amplified or diluted to achieve the desired DNA or RNA concentrations. The concentration of nucleic acids in the library can be measured using methods such as quantitative real-time PCR (qPCR) or fluorescence-based instruments such as ThermoFisher Qubit. Sequencing libraries can include amplified DNA, RNA, or cDNA fragments. Sequencing platforms such as Illumina, Oxford Nanopore, and PacBio can then be used to generate read sequences, providing detailed information on gene expression, transcript abundance, and molecular patterns associated with kidney injury or disease progression. This workflow allows for multiplex analysis of analytes in multiple samples in a single sequencing run, supporting comprehensive analysis and detection of analytes.

[0307] In some embodiments, the sequencing methods disclosed in this invention (such as next-generation sequencing (NGS)) can be used to simultaneously detect and analyze five or more analytes in a single and / or multiple samples, optionally hundreds to thousands of analytes, for example from 100 to 10,000 analytes.

[0308] In some embodiments, the NGS method used in the methods disclosed in this invention can achieve simultaneous detection and analysis of multiple analytes in a single sample, providing a comprehensive characterization of numerous analytes in a single sample.

[0309] For example, the NGS method disclosed in this invention can be used to analyze 2, 5, 10, 50, 100, 500, 1,000, 5,000, 10,000 or more target analytes in a single sample, such as from 10 to 10,000, from 100 to 10,000, from 10 to 1,000 or from 100 to 1,000 target analytes in a single sequencing run.

[0310] In some implementations, the NGS method can process multiple independent samples simultaneously, each containing one or more target analytes.

[0311] For example, the NGS method disclosed in this invention can be used to analyze 2, 5, 10, 50, 100, 500, 1,000, 5,000 or more independent samples in a single sequencing run, each sample may contain multiple target analytes, such as from 10 to 10,000, from 100 to 10,000, from 10 to 1,000 or from 100 to 1,000 target analytes.

[0312] 5. Determine the concentration

[0313] Optionally, the method includes a step of determining the concentration of the target analyte. The concentration of the target antigen is determined by amplifying the eluted DNA barcode using qPCR. The DNA is quantified using a PCR master mixture, barcode-specific oligonucleotide primers, and a detection method based on SYBR Green or TaqMan probes. Fluorescence data is recorded during amplification, and the resulting Ct (cycle threshold) is compared with a standard curve generated using a known concentration of the target antigen. A lower Ct value corresponds to a higher antigen concentration in the original sample. This quantitative analysis allows for accurate and sensitive determination of protein levels.

[0314] The standard curve is generated by running a series of target antigens or antigens at known concentrations simultaneously with the sample during the BIQ-ELISA process. These known concentrations are prepared by serial dilutions of standard stock solutions and typically cover a wide range to encompass the expected concentrations in the sample. Each standard is processed in the same manner as the test sample, including incubation, washing, elution, and qPCR amplification.

[0315] During qPCR, fluorescence data is collected in real time, and a Ct value is determined for each standard. The Ct value represents the number of PCR cycles required for the fluorescence signal to cross a predefined threshold and is inversely proportional to the antigen concentration. A lower Ct value indicates a higher antigen concentration.

[0316] To generate a standard curve, the Ct values ​​(y-axis) are plotted against the logarithm of the known concentrations of the standard solution (x-axis). The data points are fitted using linear regression to generate an equation of the form: y = mx + b, where y is the Ct value, x is the logarithmic concentration, m is the slope of the line, and b is the y-intercept.

[0317] For concentration determination of unknown samples, the Ct value is measured and input into the standard curve equation. The resulting x value is the logarithmic concentration of the target antigen in the sample. This value is then exponentially (anti-logarithmically) calculated to determine the actual concentration. The standard curve ensures accurate quantification of the target antigen by providing a reference for converting Ct values ​​into precise concentrations.

[0318] The disclosed compositions and methods can be further understood through the following numbered paragraphs.

[0319] 1. A kit for detecting a target analyte in a sample, comprising: (a) a first reagent; and (b) a second reagent, wherein: (i) the first reagent comprises magnetic particles modified with a first binding agent for the target analyte; and (ii) the second reagent comprises a second binding agent for the target analyte, the second binding agent being coupled to a nucleic acid barcode.

[0320] 2. The kit according to paragraph 1, wherein the first binder and the second binder bind to different epitopes of the target analyte.

[0321] 3. A kit for detecting two or more target analytes in a sample, comprising: (a) modified magnetic particles containing two or more first binding agents; and (b) two or more second binding agents, wherein the two or more first binding agents and the two or more second binding agents form two or more binding groups, each binding group containing one first binding agent and one second binding agent, the first binding agent and the second binding agent in the same binding group targeting the same target analyte, each second binding agent being coupled to a nucleic acid barcode, and the two or more analytes being distinct from each other.

[0322] 4. The kit according to any one of paragraphs 1-3, wherein the first binder and the second binder in each binding group bind to different epitopes or the same epitope of the target analyte.

[0323] 5. The kit according to any one of paragraphs 1-4, wherein the first binder and the second binder are each independently an antibody, an aptamer or a peptide, or a combination thereof.

[0324] 6. The kit according to any one of paragraphs 1-5, wherein the diameter of the modified magnetic particles is about 0.5µm to 5µm, 0.3µm–5.5µm, 0.2µm–6µm, 1µm–4.5µm, 1.5µm–4µm, 2µm–3.5µm or 2.5µm–3µm.

[0325] 7. The kit according to any one of paragraphs 1-6, wherein the modified magnetic particles are provided in the form of an aqueous suspension with a density of approximately 1.4 gDS / cm³.3 –1.8gDS / cm 3 1.3 gDS / cm 3 –1.9gDS / cm 3 1.5gDS / cm 3 –1.7gDS / cm 3 1.2 gDS / cm 3 –2.0gDS / cm 3 1.6 gDS / cm 3 –1.9gDS / cm 3 1.1 gDS / cm 3 –2.1gDS / cm 3 Or 1.0 gDS / cm 3 –2.5gDS / cm 3 .

[0326] 8. The kit according to any one of paragraphs 1-7, wherein the first binder is coupled to the modified magnetic particles via an affinity pair selected from the group consisting of: avidin family protein / biotin, aptamer / target molecule pairs, receptor / ligand pairs, natural or synthetic receptor / ligand pairs, or amines and carbonyl compounds.

[0327] 9. The kit according to paragraph 8, wherein the avidin family protein is streptavidin, avidin, or neutral avidin.

[0328] 10. The kit according to paragraph 5, wherein the antibody is a monoclonal antibody, polyclonal antibody, recombinant antibody, humanized antibody, human antibody, chimeric antibody, functional fragment thereof, or combination thereof.

[0329] 11. The kit according to any one of paragraphs 1-10, wherein the analyte is selected from the group consisting of IL-8 (interleukin-8), ALPP (alkaline phosphatase, e.g., placental type), CD38 (differentiation cluster 38), SOD1 (superoxide dismutase-1), and VCAN (multifunctional proteoglycan).

[0330] 12. The kit according to paragraph 11 contains DAB / CAB pairs selected from Table 2, wherein the nucleic acid barcodes are optionally selected from the group consisting of SEQ ID NO:1-5 and SEQ ID NO:20-24.

[0331] 13. The kit according to any one of paragraphs 1-12, wherein the analyte is present in the sample, optionally the sample being a food sample, environmental sample, industrial sample, human clinical sample, veterinary sample, or other biologically derived sample, further optionally the sample being blood, serum, plasma, feces, mucosal swabs, tissue aspirates, tissue homogenates, cell cultures, cell culture supernatants (including eukaryotic and prokaryotic cell cultures), urine, saliva, sputum, and / or cerebrospinal fluid.

[0332] 14. The kit according to paragraph 10, wherein the functional fragment is a single-chain variable fragment, a Fab fragment, a nanobody, a bispecific antibody, a biantibody, a triantibody, or a combination thereof.

[0333] 15. The kit according to any one of paragraphs 1-14, wherein the second binding agent is coupled to the nucleic acid barcode via a linker.

[0334] 16. The kit according to paragraph 15, wherein the linker is , where n1 is an integer from 1 to 10, 1 to 8, 1 to 6, 2 to 10, 2 to 8, 4 to 10 or 4 to 8, for example 6; and wherein the secondary amino group is derived from the second binding agent and the nucleic acid barcode, respectively.

[0335] 17. The kit according to any one of paragraphs 1-16, wherein the nucleic acid barcode comprises: (a) a region for hybridization with TaqMan probes; (b) a region for primer binding during PCR amplification; and (c) a region for target specificity.

[0336] 18. The kit described in any of paragraphs 1-17 further comprises one or more buffer solutions and one or more reagents.

[0337] 19. The kit according to paragraph 18, wherein the one or more buffers comprise: (a) a dilution buffer for preparing standards and diluting samples; (b) a wash buffer for removing unbound material from magnetic particles; (c) an elution buffer containing sodium hydroxide for releasing ONA from immune complexes; and (d) a blocking buffer for reducing nonspecific binding.

[0338] 20. The kit according to paragraph 18, wherein the one or more reagents comprise: (a) a PCR premix containing DNA polymerase and nucleotides for qPCR amplification; (b) one or more oligonucleotide primers for amplifying ONA barcodes; and (c) a TaqMan probe labeled with a fluorescent reporter group and a quencher group for detecting ONA during qPCR amplification.

[0339] 21. The kit described in any of paragraphs 1-20 also includes instructions for use.

[0340] 22. A method for detecting one or more analytes in a sample using a kit described in any one of paragraphs 1-21, comprising: (i) incubating the sample with modified magnetic particles and a second binding agent to form an immune complex; and (ii) amplifying and / or sequencing the nucleic acid barcode signal.

[0341] 23. The method described in paragraph 22 further includes (a) purifying the immune complex after step (i).

[0342] 24. The method according to paragraph 23, wherein step (a) includes washing the immune complex with a washing buffer to remove unbound material and separating the immune complex from the buffer using a magnetic field or centrifugation.

[0343] 25. The method described in any of paragraphs 22-24 further includes, after step (i), eluting the nucleic acid barcode from the immune complex using an elution buffer.

[0344] 26. The method described in any of paragraphs 22-25, wherein step (ii) includes adding PCR mixture to the nucleic acid barcode and amplifying the eluted nucleic acid using qPCR.

[0345] 27. The method described in any of paragraphs 22-26 further includes (b) determining the concentration of each target analyte after step (ii).

[0346] 28. The method according to paragraph 27, wherein step (b) includes generating a standard curve for each analyte and calculating the concentration of the analyte in the sample based on the Ct value obtained in step (ii).

[0347] 29. The method described in any of paragraphs 22-28, wherein step (ii) is performed using qPCR or sequencing or a combination thereof.

[0348] 30. The method described in any of paragraphs 22-29, wherein the sequencing is performed using next-generation sequencing, such as Illumina sequencing, IonTorrent semiconductor sequencing, PacBioSMRT sequencing, Oxford Nanopore sequencing, nanostringnCounter and / or Miser sequencing.

[0349] 31. The method according to paragraph 30, wherein the NGS includes the simultaneous analysis and detection of five or more analytes (optionally hundreds to thousands of analytes, such as 100 to 10,000 analytes) in a single and / or multiple samples.

[0350] The disclosed compositions and methods can be further understood through the following numbered paragraphs.

[0351] 32. A kit for detecting a target analyte in a sample, the kit comprising: (a) a first reagent; and (b) a second reagent, wherein: (i) the first reagent comprises magnetic particles modified with affinity-binding pair members, and (ii) the second reagent comprises a second binding agent specifically targeting the analyte and a nucleic acid barcode, wherein the second binding agent is coupled to the nucleic acid barcode.

[0352] 33. A kit for detecting two or more target analytes in a sample, the kit comprising: (a) a first reagent; and (b) a second reagent, wherein: (i) the first reagent comprises magnetic particles modified with affinity-binding pair members; and (ii) the second reagent comprises two or more second binding agents, each binding agent being specific to one target analyte, wherein each second binding agent is coupled to a nucleic acid barcode, wherein the two or more target analytes are distinct from each other, and wherein the nucleic acid barcode corresponding to each target analyte is unique to that target analyte.

[0353] 34. The kit according to paragraph 32 or 33, wherein the diameter of the modified magnetic particles is about 0.5µm to 5µm, 0.3µm–5.5µm, 0.2µm–6µm, 1µm–4.5µm, 1.5µm–4µm, 2µm–3.5µm or 2.5µm–3µm.

[0354] 35. The kit according to any one of paragraphs 32-34, wherein the modified magnetic particles are in the form of an aqueous suspension with a density of approximately 1.4 gDS / cm³. 3 –1.8gDS / cm 3 1.3 gDS / cm 3 –1.9gDS / cm 3 1.5gDS / cm 3 –1.7gDS / cm 3 1.2 gDS / cm 3 –2.0gDS / cm 3 1.6 gDS / cm 3 –1.9gDS / cm 3 1.1 gDS / cm 3 –2.1gDS / cm 3 Or 1.0 gDS / cm 3 –2.5gDS / cm 3 .

[0355] 36. The kit according to any one of paragraphs 32-35, wherein the analyte is present in the sample, optionally the sample being a food sample, environmental sample, industrial sample, human clinical sample, veterinary sample, or other biologically derived sample, further optionally the sample being blood, serum, plasma, feces, mucosal swabs, tissue aspirates, tissue homogenates, cell cultures, cell culture supernatants (including eukaryotic and prokaryotic cell cultures), urine, saliva, sputum, and / or cerebrospinal fluid.

[0356] 37. The kit according to any one of paragraphs 32-36, wherein the nucleic acid barcode comprises: (a) a region for hybridization with TaqMan probes; (b) a region for primer binding during PCR amplification; and (c) a region for target specificity.

[0357] 38. The kit described in any of paragraphs 32-37 may also contain one or more buffer solutions and one or more other reagents.

[0358] 39. The kit according to paragraph 38, wherein the one or more buffers comprise: (a) a dilution buffer for preparing standards and diluting samples; (b) a wash buffer for removing unbound material from magnetic particles; (c) an elution buffer containing sodium hydroxide for releasing ONA from immune complexes; and / or (d) a blocking buffer for reducing nonspecific binding.

[0359] 40. The kit according to paragraph 38 or 39, wherein the one or more other reagents comprise: (a) a PCR premix containing DNA polymerase and nucleotides for qPCR amplification; (b) one or more oligonucleotide primers for amplifying ONA barcodes; and / or (c) a TaqMan probe labeled with a fluorescent reporter group and a quencher group for detecting ONA during qPCR amplification.

[0360] 41. The kit described in any of paragraphs 32-40 also includes instructions for use.

[0361] 42. The kit described in any of paragraphs 32-41 further comprises protein labeling reagents.

[0362] 43. The kit according to any one of paragraphs 32-42, wherein the affinity binding pair member is an avidin family protein.

[0363] 44. The kit according to paragraph 43, wherein the avidin family protein is streptavidin, avidin, or neutral avidin.

[0364] 45. The kit according to any one of paragraphs 42-44, wherein the protein labeling reagent is a biotinylated reagent.

[0365] 46. ​​The kit according to any one of paragraphs 32-45, wherein the nucleic acid barcode is selected from the group consisting of SEQ ID NO:1-5, SEQ ID NO:34 and SEQ ID NO:35.

[0366] 47. The kit according to any one of paragraphs 32-46, wherein the analyte is selected from the group consisting of MIP-1α, eosinophil chemokine, IL-22, IL-12p40, IL-12p70, EXN4, IFN-γ, IL-1β, IL-6 and TNF-α.

[0367] 48. The kit according to any one of paragraphs 32-47, wherein the second binding agent is coupled to the nucleic acid barcode via a linker.

[0368] 49. The kit according to paragraph 48, wherein the linker is, wherein n1 is an integer from 1 to 10, 1 to 8, 1 to 6, 2 to 10, 2 to 8, 4 to 10 or 4 to 8, for example 6; and wherein the secondary amino group is derived from the second binding agent and the nucleic acid barcode, respectively.

[0369] 50. The kit according to any one of paragraphs 32-49, wherein the second binding agent is an antibody, an aptamer, or a peptide, or a combination thereof.

[0370] 51. The kit according to paragraph 50, wherein the antibody is a monoclonal antibody, a polyclonal antibody, a recombinant antibody, a humanized antibody, a human antibody, a chimeric antibody, an antibody functional fragment, or a combination thereof.

[0371] 52. The kit according to paragraph 51, wherein the antibody functional fragment is a single-chain variable fragment (scFv), a Fab fragment, a nanobody, a bispecific antibody, a biantibody, a triantibody, or a combination thereof.

[0372] 53. A method for detecting one or more analytes in a sample using the kit described in any one of paragraphs 42-52, the method comprising: (i) labeling the one or more analytes with the protein labeling reagent; (ii) incubating the sample with the modified magnetic particles and the second reagent to form an immune complex; and (iii) amplifying and / or sequencing the nucleic acid barcode.

[0373] 54. The method according to paragraph 53, wherein the protein labeling reagent is a biotinylation reagent.

[0374] 55. The method according to paragraph 53 or 54 further includes (a) purifying the immune complex after step (ii).

[0375] 56. The method according to any one of paragraphs 53-55, wherein step (a) includes washing the immune complex with a washing buffer to remove unbound material and separating the immune complex from the buffer using a magnetic field or centrifugation.

[0376] 57. The method according to any one of paragraphs 53-56 further includes, after step (ii), eluting the nucleic acid barcode from the immune complex using an elution buffer.

[0377] 58. The method according to any one of paragraphs 53-57, wherein step (iii) includes adding PCR mixture to the nucleic acid barcode and amplifying the eluted nucleic acid using qPCR.

[0378] 59. The method described in any of paragraphs 53-58 further includes (b) determining the concentration of each target analyte after step (iii).

[0379] 60. The method according to paragraph 59, wherein step (b) includes generating a standard curve for each analyte and calculating the concentration of the analyte in the sample based on the Ct value obtained in step (iii).

[0380] 61. The method described in any of paragraphs 53-60, wherein step (iii) is performed using qPCR or sequencing or a combination thereof.

[0381] 62. The method described in any of paragraphs 53-61, wherein the sequencing is performed using next-generation sequencing (NGS), such as Illumina sequencing, Ion Torrent semiconductor sequencing, PacBio SMRT sequencing, Oxford Nanopore sequencing, nanostring nCounter and / or Miser sequencing.

[0382] 63. The method according to paragraph 62, wherein the NGS includes the simultaneous analysis and detection of five or more analytes (optionally hundreds to thousands of analytes, such as 100 to 10,000 analytes) in a single and / or multiple samples.

[0383] The present invention can be further understood through the following specific embodiments.

[0384] Example 1. Sequence screening and preparation method of oligonucleotide (ONA) barcodes, and their conjugation method with antibodies.

[0385] method

[0386] I. Preparation of Oligonucleotide (ONA) Barcodes

[0387] The 5' terminal amino-modified oligonucleotide sequence ONA was purchased from IDT and consists of three parts: a shared PCR primer region at both ends (P1: 26 bp; P2: 34 bp) and a specific coding region in the middle (20 bp). After PCR amplification, the total length of the product was 80 bp.

[0388] 5'- / 5AmMC6 / AGCACACATTGCTGGTTCTGCTCACGTCTGACTA CAGGCATTCCGTCTGTCTCTTATACACATCTCCGAGCCCACGAGAC-3' (SEQ ID NO: 1).

[0389] II. Preparation of Antibody-Oligonucleotide Conjugate (DAB-ONA)

[0390] 1. Prepare HPLC-purified oligonucleotides modified with 5' amino groups into a 200 µM solution using a coupling buffer (200 mM HEPES, pH 8.5).

[0391] 2. Prepare a 50 mM solution of bis(sulfosuccinimide) sebacate (BS3) in dimethyl sulfoxide (DMSO).

[0392] 3. Mix 200 µM oligonucleotide solution with 50 mM bis(sulfosuccinimide) caprylate solution at a volume ratio of 2:1 and shake well. Let stand at room temperature for 30 minutes to complete activation.

[0393] While waiting, pre-treat the desalted column: centrifuge at 1000×g for 1 minute to remove the preservation solution. Add coupling buffer to the column and centrifuge at 1000×g for 1 minute to remove the coupling buffer. Repeat the addition of coupling buffer and centrifugation once more, then place the column in a new collection tube for later use.

[0394] 5. After 30 minutes, the activated oligonucleotide mixture was added to a Zeba desalting column equilibrated with coupling buffer and centrifuged at 1000×g for 2 minutes to collect the purified activated oligonucleotides.

[0395] 6. Mix the purified activated oligonucleotides with the purified antibody to be coupled at a ratio of 7:1 or 10:1 and shake well. Let stand overnight at room temperature until the coupling reaction is complete.

[0396] III. Purification of antibody-oligonucleotide conjugates

[0397] 1. Prepare FPLC buffer A (150 mM NaCl, 50 mM Tris HCl, pH 8.0) and buffer B (1 M NaCl, 50 mM Tris HCl, pH 8.0), and filter them through a 0.22 µm filter membrane.

[0398] 2. Dilute the antibody-oligonucleotide conjugation reaction mixture appropriately with buffer A.

[0399] 3. Equilibrate the Nuvia HP Q column using buffer A. After equilibration, load the diluted antibody-oligonucleotide conjugate reaction mixture into the column at a flow rate of 1 mL / min.

[0400] 4. After the sample loading is complete, rinse with buffer A for an additional 2 column volumes to bring the UV260 and 280 signals back to baseline.

[0401] 5. Elute within 16 column volumes using a gradient of 0-100% buffer B at a flow rate of 1 mL / min, and collect the chromatographic peaks.

[0402] 6. Concentrate the collected chromatographic peaks containing antibody-oligonucleotide conjugates using a protein concentration tube, and replace with phosphate-buffered saline (PBS) buffer to remove excess salt.

[0403] 7. Add bovine serum albumin (BSA) and sodium azide (NaN3) as preservatives and store at 4°C for a long time.

[0404] IV. Preparation of antibody-coated magnetic particles

[0405] 1. Shake the Dynabeads™ M-280 streptavidin-coated magnetic particles for 30 seconds to ensure thorough mixing. Transfer an appropriate amount of magnetic particles to a clean centrifuge tube and place it on a magnetic rack for 2 minutes. Once the magnetic particles have stabilized, carefully remove the supernatant.

[0406] 2. Resuspend the magnetic particles to their original volume using phosphate-buffered saline (PBST) containing 0.05% (v / v) Tween-20, shake vigorously, and then place them back on the magnetic rack for 2 minutes. Once the magnetic particles have stabilized, carefully remove the supernatant. Repeat the washing once to remove the supernatant.

[0407] 3. Add an appropriate amount of biotinylated antibody to be coated according to the ratio of 15 µg biotinylated antibody per 100 µL of magnetic particles, and mix thoroughly.

[0408] 4. Incubate the magnetic particles and antibody at 1000 rpm for 30 minutes at room temperature.

[0409] 5. After incubation, place the centrifuge tube back on the magnetic rack for 2 minutes. Once the magnetic particles have stabilized, carefully remove the supernatant.

[0410] 6. Wash the magnetic particles twice with PBST to remove uncoated antibodies.

[0411] 7. Resuspend the magnetic particles in phosphate buffer containing bovine serum albumin (BSA) and sodium azide (NaN3) at the same volume as the original volume, and store at 4°C for an extended period.

[0412] V. Testing of crosslinking agents

[0413] Crosslinking agent 1: Sulfo-SMCC

[0414] Characteristics: It has unique directionality and is often used for coupling.

[0415] plan:

[0416] 1. Reduce the thiol-modified DNA oligonucleotides with 100 times the molar excess of TCEP and incubate at room temperature for 30 minutes.

[0417] 2. Purify reduced DNA oligonucleotides containing thiol groups (-SH) by ethanol precipitation.

[0418] 3. Activate the antibody with a 10-fold molar excess of Sulfo-SMCC and incubate at room temperature for 30 minutes.

[0419] 4. Purify the activated antibody using a desalting column.

[0420] 5. Mix the activated antibody with the reduced oligonucleotide and incubate overnight.

[0421] The conjugation efficiency was estimated by replacing the antibody with streptavidin.

[0422] Streptavidin was conjugated with an oligonucleotide in a 3-fold molar excess. Percentages represent yields compared to the original input. Results showed that most streptavidin was not conjugated with the oligonucleotide, indicating low efficiency. To test the oligonucleotide-to-streptavidin ratio, a gradient of oligonucleotides was used to conjugate with the same amount of streptavidin. The conjugates were analyzed by SDS-PAGE. The gel was stained with SYBR Gold to observe the DNA. A higher oligonucleotide-to-protein ratio improved the conjugate yield. To better understand the progress of the conjugation reaction, samples were collected every 30 minutes for analysis. Longer incubation times improved the conjugate yield. To improve the activation efficiency of streptavidin via Sulfo-SMCC, different incubation times, temperatures, and Sulfo-SMCC solvent conditions were tested. However, these conditions did not produce significant differences. Since the conjugation efficiency via Sulfo-SMCC could not be significantly improved, other methods were tested.

[0423] Crosslinking agent 2: DBCO-azide reaction

[0424] Characteristics: It has unique directionality and is often used for coupling.

[0425] Disadvantages: Reagents and azide-modified oligonucleotides are more expensive than other methods.

[0426] plan:

[0427] 1. Activate streptavidin with a 20-fold molar excess of DBCO-ester and incubate at room temperature for 30 minutes.

[0428] 2. Remove excess DBCO-esters using a desalting column.

[0429] 3. Mix 3 molar excess of azide-modified oligonucleotide with activated streptavidin and incubate overnight at 4°C.

[0430] Two batches of streptavidin conjugates prepared by the DBCO method were analyzed by SDS-PAGE. However, although the conjugates were present in the second batch, they were not present in the first batch. Furthermore, the yield of the conjugates in the second batch was still below 50%. Due to the high cost of reagents, this method may not be suitable for constructing hundreds of barcode DNA conjugate antibodies.

[0431] Crosslinking agent 3: DSS

[0432] Succinimide succinate (DSS) is a homobifunctional linker that can react with amino groups (-NH2) at both ends. This chemical is insoluble in water. However, amino-modified oligonucleotides and DSS are much cheaper.

[0433] According to a 2019 study by Li et al. (<https: / / doi.org / 10.1002 / cbic.201900027> DSS can be used as a cross-linking agent for antibody and oligonucleotide conjugation.

[0434] - Since amino-DNA is relatively inexpensive, DNA is usually activated first (in DMSO, with the help of acetonitrile-triethylamine).

[0435] - To avoid the formation of DNA dimers, use an excess of DSS (250 or 500 times molar excess).

[0436] - The activated DNA can be purified by ethanol precipitation or HPLC.

[0437] - Use approximately 3-4 times the molar excess of activating DNA for protein coupling.

[0438] - The coupling reaction was carried out overnight at room temperature.

[0439] Since HPLC was unavailable, the activated DNA was first purified using ethanol. Because both ends of the DSS react with oligonucleotides, the DSS:oligonucleotide ratio needed to be determined to avoid excessive oligonucleotide self-aggregation. Fewer oligonucleotide self-aggregates were produced when the DSS:oligonucleotide ratio was too low or too high. At a DSS:oligonucleotide ratio of 250, almost no oligonucleotide dimers were formed. This ratio was used for subsequent tests. Because DSS can also cause proteins to form self-aggregates, streptavidin was treated with different amounts of DSS, and the supernatant from the activated oligonucleotide purification was used. To purify the activated oligonucleotides, precipitation was performed using anhydrous ethanol, followed by washing twice with 75% ethanol.

[0440] More DSS can activate more streptavidin to form larger bands. Even after washing, excessive DSS remains in the supernatant. To purify the activated oligonucleotides, anhydrous ethanol was used for precipitation, followed by washing twice with 75% ethanol.

[0441] DSS can be relatively quantified by changes in A260 after hydrolysis. A standard curve has been prepared. The DSS sample preparation is the same as the DNA activation reaction, and the final DSS concentration is 16.7 mM. After one desalting column purification: 0.528 mM. After two desalting column purifications: 0.161 mM. The expected concentration of purified DNA is 0.2 mM (no loss). Excessive DSS residue remains, possibly due to the insolubility of DSS, preventing its capture by the desalting column. BS3 was subsequently used to improve purification efficiency.

[0442] Crosslinking agent 4: BS3

[0443] BS3 is a soluble version of DSS. Therefore, BS3 uses the same parameters as DSS. BS3 has been identified as a suitable cross-linking agent for linking binders to nucleic acid barcodes. Figures 4A-4D ).

[0444] VI. Testing streptavidin magnetic beads

[0445] The tested magnetic beads are as follows Figures 5A-5D As shown:

[0446] 1. HV0150 Hi-SurMag Streptavidin, 150 nm, 2 mL, 1 mg / mL (custom-made).

[0447] 2. MV1000-002 MonoMag Streptavidin, 1 µm, 2 mL (custom-made).

[0448] 3. HV1000-02 HiSur Streptavidin, 1 µm, 2 mL (custom-made).

[0449] 4. 2574067 1 mL Dynabeads™ M-280 Streptavidin, 2.8 µm.

[0450] 5. 01342559 1 mL Dynabeads™ M-270 Streptavidin, 2.8 µm.

[0451] 6. 01342859 1 mL Dynabeads™ MyOne™ Streptavidin C1, 1µm.

[0452] 7. 01340664 1 mL Dynabeads™ MyOne™ Streptavidin T1, 1µm.

[0453] 8. Bioeast M2800S3-XC, 2.8 µm.

[0454] 9. Beaver 22307-1, 1 µm.

[0455] To test its effectiveness in PCR reactions:

[0456] Take 5 µL of each type of magnetic bead; wash twice with PBS.

[0457] Perform PCR reactions with / without magnetic beads.

[0458] Dynabeads™ M-280 has been identified as the most suitable magnetic beads for downstream PCR.

[0459] Table 3: Specifications of Magnetic Beads

[0460]

[0461] VII. Comparison of Magnetic Scrubbers and Filter Plates

[0462] The filter plates were tested during the washing step before using the magnetic particle washer. A total of seven different filter plates were tested. The results showed that the HV filter plate performed best. The detection method on the filter plate was further optimized. The HV filter plate is best suited for reducing background signal, but may result in higher ΔCT values. Direct mixing of reagents in a pre-wetted HV filter plate yielded the best results.

[0463] Studies have found that magnetic particle scrubbers can improve detection sensitivity by reducing background signals (see...). Figures 6A-6J ).

[0464] Reactions conducted in a 10 µL reaction volume (5 µL sample + 5 µL magnetic bead mixture) showed better consistency and the lowest coefficient of variation (CV) (see [link to reaction volume]). Figure 7 ).

[0465] VIII. Elution Complex

[0466] Antibodies and antigens bound to magnetic particles were denatured and inactivated using sodium hydroxide solutions of varying concentrations, and then separated from the magnetic particles. The sodium hydroxide treatment conditions were 10 minutes at room temperature. The magnetic particles were then washed with phosphate-buffered saline (PBST) containing 0.05% Tween-20 to remove the supernatant and resuspended to the initial volume. Biotinylated antibodies still attached to the magnetic particles were detected using fluorescently labeled secondary antibodies. With increasing sodium hydroxide concentration, the number of biotinylated antibodies attached to the magnetic particles decreased under the same treatment conditions, indicating higher elution efficiency of the complex.

[0467] Example 2. BIQ-ELISA assay

[0468] 1. Dilute the fully resuspended antibody-coated magnetic particles and antibody-oligonucleotide conjugate in the detection diluent at an appropriate ratio and mix thoroughly. Use a pipette to add 5 µL of the mixture to each well of a V-bottom 96-well plate.

[0469] 2. Add the appropriate test standard or sample to each well, 5 µL per well.

[0470] 3. Seal the reaction wells with sealing film. Centrifuge at 500 × g for 1 minute to allow the sample, magnetic particles, and antibody-oligonucleotide conjugates to aggregate at the bottom of the reaction wells.

[0471] 4. Incubate the reaction plate at 700 rpm for 150 minutes at room temperature.

[0472] 5. After incubation, centrifuge at 500 × g for 1 minute to allow all liquid to pool at the bottom of the reaction well, and carefully remove the sealing film.

[0473] 6. Add 40 µL of detection diluent to each reaction well to bring the total volume to 50 µL.

[0474] 7. Place the reaction plate on the magnetic rack and let it stand for 2 minutes to ensure the magnetic particles are completely stable. Transfer the reaction plate and magnetic rack to an automated washer and wash the reaction wells 5 times with washing buffer (phosphate buffer containing 0.1% Tween-20).

[0475] 8. Remove the reaction plate from the magnetic rack and add 40 µL of elution buffer (10 mM sodium hydroxide) to each well. Use an automated washer or pipette to thoroughly mix the magnetic particles with the elution buffer, then let stand at room temperature for 10 minutes to release the oligonucleotides from the magnetic particles.

[0476] 9. Place the reaction plate back on the magnetic rack and let it stand for 2 minutes. Use a pipette to transfer 5 µL of the oligonucleotide-containing supernatant from each well into a clean PCR plate.

[0477] 10. Add 15 µL of PCR primer premix (10 µL of 2×Luna® universal qPCR premix) to the PCR well containing the supernatant. Seal the PCR well with sealing film using 5 µL of water and 25 nM forward and reverse primers.

[0478] 11. Centrifuge at 11,500×g for 1 minute to allow all liquid to pool at the bottom of the PCR wells. Place the PCR plate into a qPCR instrument to perform the reaction and record the SYBR Green signal value changes.

[0479] 12. Plot a standard curve based on the Ct values ​​generated from the standard samples and the concentrations of the standard samples, and calculate the concentration of the target protein in the original samples using the Ct values ​​generated from the location samples and the dilution factor.

[0480] Example 3. Comparison of SIMOA technology and BIQ-ELISA for the detection of TNFα

[0481] Table 4: Limit of Detection (LOD) Sensitivity for Five Targets

[0482]

[0483] Table 5: Detection of TNFα in patient serum samples

[0484]

[0485] Figure 2 The diagram shows a comparison between the single-molecule array (SIMOA) technique and the BIQ-ELISA for detecting TNFα. Using the SIMOA method, five samples were not detected; using the BIQ method, all samples were detected.

[0486] Example 4. Operation Procedure of RayBio® Human Interleukin-6 (IL-6) BIQ-ELISA Kit

[0487] RayBio® Beam-based quantitative enzyme-linked immunosorbent assay (BIQ-ELISA) combines the specificity of sandwich ELISA, the sensitivity of real-time PCR, and the ease of microsphere handling, making it a unique protein detection method.

[0488] In this system, the detection antibody (DAB) is coupled with a unique oligonucleotide (ONA) barcode (DAB-ONA) for signal amplification, while the capture antibody (CAB) is biotin-labeled and pre-adsorbed onto streptavidin-coated magnetic beads (CAB-Biotin-SABeads).

[0489] The whole process is simple and straightforward, and the total laboratory testing time is four hours.

[0490] The experimental procedure includes the following steps:

[0491] Step 1: Formation and purification of immune complexes (ONA-DAB antigen-CAB-Biotin-SABeads)

[0492] The sample was co-incubated with DAB-ONA and CAB-Biotin-SABeads in a filter plate. In the presence of the target protein, DAB-ONA bound to the target protein and linked to CAB-Biotin-SABeads via biotin-streptavidin interactions. Unbound protein was removed by washing.

[0493] Step 2: PCR amplification

[0494] The bound immune complexes are released from the magnetic beads and transferred as templates for qPCR. Primers and the PCR master mixture are added to the wells, and data are collected using qPCR. The antigen concentration in each sample is then calculated based on the Ct values ​​obtained from qPCR, where lower Ct values ​​indicate higher antigen concentrations. In actual experiments, a set of target protein standards with known concentrations are run simultaneously to generate a standard curve for quantifying unknown samples.

[0495] Reagent and Sample Preparation

[0496] 1. Simply centrifuge the primer and probe mixture tube, then redissolve the powder in 0.55 µL of nuclease-free water. Before use, dilute the diluent twice with deionized or distilled water. It is recommended to dilute normal serum / plasma 2–10 times. Note: Target protein levels may vary in different samples. Researchers must determine the optimal dilution factor for each sample. Prepare one bottle of Wash Buffer I and one bottle of Wash Buffer II. If visible crystals are present in the 20× wash buffer, heat to room temperature and gently stir until dissolved. Dilute 15 mL of 20× wash buffer to deionized or distilled water to obtain 300 mL of 1× wash buffer. Dilute 0.5 mL of 10× elution buffer to 4.5 mL of distilled water to obtain 5 mL of 1× elution buffer. Gently rotate the oligonucleotide-binding antibody bottle and resuspend. Measure 500 µL of the suspended antibody in the diluent.

[0497] 2. Preparation of Human Interleukin-6 Standard: Briefly describe the human interleukin-6 standard vial. Add 1 mL of the prepared 1× diluent to prepare a 0.4 ng / mL standard solution. Gently stir the powder until completely dissolved. Pipette 160 µL of the diluent for measurement and place it into 7 additional test tubes. Prepare a dilution series using the 0.4 ng / mL standard solution (as shown below). Mix each test tube thoroughly before each transfer. The 1× diluent is used as a blank control.

[0498] Operating procedures

[0499] 1. Before use, bring all reagents and samples to room temperature (18-25°C). The PCR master mixture, primer and probe mixture should be stored on ice after thawing. It is recommended that all standards and samples be tested in duplicate or triplicate.

[0500] 2. Label the filter plates appropriately according to the experimental requirements.

[0501] 3. Prewet each well with 200 µL of diluent and incubate at room temperature for 5 minutes. Choose one of the following methods depending on the available equipment.

[0502] Vacuum Setup: Turn on the vacuum pump, open the valve, and place the filter plate on the vacuum setup. Do not use pressure exceeding 10 inches of mercury (254 mmHg). After purging the orifices, close the valve and remove the filter plate. Wipe the bottom of the tray dry with absorbent paper to remove any residual liquid.

[0503] Centrifugation: Stack the filter plates on a 96-well flat-bottom plate and label them "wash plates". Ensure the wells are aligned. Centrifuge the wash plates at 500g for 1 minute, then carefully discard the effluent and wipe the wash plates dry with absorbent paper for later use.

[0504] 4. Add 5 µL of oligonucleotide-binding antibody to a vial coated with human IL-6 antibody. Rotate the vial for 30 seconds to thoroughly mix the components. Dispense 25 µL into each well. Note: This amount is sufficient for 48 wells.

[0505] 5. Add 25 µL of each standard to each appropriate well, making the total volume of each well 50 µL. Cover the well. Place the steel plate on a steel shaker. Shake at 700 rpm for 2.5 hours at room temperature.

[0506] 6. Following step 3, discard the solution in each well. Add 200 µL of 1× wash buffer I to wash the plate and incubate at room temperature for 1 minute to remove liquid, as described in step 3.

[0507] 7. Repeat the washing steps four times, for a total of five washes.

[0508] Note: It is recommended that after the final cleaning, even if a vacuum device is used, centrifuge at 500g for 1 minute to completely remove any liquid residue. This helps reduce misalignment between the holes.

[0509] 8. Add 200 µL of 1× Wash Buffer II to each well to wash the plate and incubate at room temperature for 1 minute to remove liquid. Repeat the washing step twice, for a total of three washes.

[0510] 9. To completely remove liquid residue, stack the filter plates on a 96-well flat-bottom plate labeled "wash plates". Wash the plates by centrifugation at 500g for 1 minute, then discard the wash plates.

[0511] 10. Add 25 µL of elution buffer to each well and incubate at room temperature for 10 minutes.

[0512] 11. Stack the filter plates on the 96-well flat plate and label it as the collection plate. Ensure the holes are aligned.

[0513] 12. Centrifuge at 500g for 1 minute, then carefully separate the two plates.

[0514] Note: The oligonucleotide-coupled antibody-antigen complex is currently in the collection plate and should not be discarded. Prepare a 1×PCR master mixture by mixing 2 volumes of the 2×PCR master mixture with 1 volume of the primer and probe mixture. 15 µL is required for each well.

[0515] 13. Transfer 5 µL of oligonucleotide antibody-antigen complex from the collection plate (step 11) to the corresponding well in the PCR plate, which already contains 15 µL of 1×PCR mixture, to bring the total volume of each well to 20 µL.

[0516] 14. Use a pipette to thoroughly stir the wells (at least 3 times up and down). Cover the plate with the provided polymerase chain reaction plate membrane, ensuring the membrane is evenly pressed onto the plate and forming a sealing ring around each well.

[0517] 15. Centrifuge the sealed polymerase chain reaction plate at 500g for 1 minute, collecting all liquid at the bottom of the wells. Place the plate in a real-time PCR instrument and perform the following detection settings using a VIC-compatible wavelength.

[0518] Experimental Procedure

[0519] 1. Prepare all necessary reagents, samples, and standards.

[0520] 2. Pre-wetting the filter plate.

[0521] 3. Add 25 µL of the magnetic bead and coupling agent mixture, along with 25 µL of each standard and sample, to each well. Shake and incubate at room temperature for 2.5 hours.

[0522] 4. Washing board.

[0523] 5. Add 25 µL of elution buffer to each well. Incubate at room temperature for 10 minutes. Collect the eluent.

[0524] 6. Perform real-time polymerase chain reaction.

[0525] Result Calculation

[0526] The primary data output of the BIQ-ELISA kit is the Ct value. These values ​​represent the number of cycles required for the sample to pass the fluorescence threshold. As DNA is amplified, additional fluorescence signals are generated, with each cycle causing the DNA to roughly double. Therefore, the higher the DNA level (directly related to the amount of antigen in the sample), the lower the Ct value.

[0527] If any obvious outliers exist, remove them from the results.

[0528] Calculate the mean Ct value for each of the three standards, controls, and samples. Subtract the control group's Ct value from the Ct value of each sample to obtain the difference between the control and samples (Delta CT). Plot the standard values ​​on the X-axis using a logarithmic scale. This chart is the fastest, although not the most accurate, way to visualize the results. If you use this method, you can estimate the concentration of unknown samples using a best-fit logarithmic line. The best-fit line will have the equation y = k(x) + b, where y is the Delta CT value and x is the concentration. To calculate the concentration of unknown samples, you can input it into Excel in the following format:

[0529]

[0530] Where y is the Delta CT obtained during the measurement, and b and k are obtained from the best-fit line.

[0531] Standard curve

[0532] These standard curves are for demonstration purposes only. The standard curves must be run for each measurement.

[0533] The lowest detectable concentration of human interleukin-6 is 0.03 pg / mL.

[0534] The recovery rate of spiked IL-6 in human serum was 105%, ranging from 94% to 126%.

[0535] The recovery rate of cell culture medium was 101%, with a recovery rate between 93% and 112%.

[0536] Repeatability analysis: Internal CV < 10%; External CV < 15%.

[0537] Example 5: Optimization of reaction conditions

[0538] 1) Optimize buffer solution

[0539] Different buffer solutions have a significant impact on experimental background. Therefore, different buffer compositions were compared to select the combination with the lowest background.

[0540] Based on this result, a mixture of 10% casein, 5% bovine serum albumin (BSA), and B1002 may be a better combination.

[0541] However, subsequent experiments revealed that the presence of BSA resulted in high background levels in many detection results. Therefore, BSA was removed in later experiments.

[0542] Table 6: Identification of Suitable Blocking Buffers

[0543]

[0544] An aqueous solution of 5% BSA and 0.1% Tween 20

[0545] Add 50 µL of B203, B206, B802, B804 and B1002, all of which are 5% (w / v) solutions, to 4750 µL of PBS. The resulting mixture is called the Bioliposome Mixture.

[0546] PBS (10C5B) containing 10% casein and 5% BSA.

[0547] PBS containing 10% casein and 1% (w / v) B1002 (CB1002).

[0548] Using blocked DNA (such as salmon sperm DNA and short synthetic blocked DNA) has no effect on the results.

[0549] 2) Optimize magnetic automatic washing conditions

[0550] To compare different washing conditions and parameters, DNA sequences were directly coated onto the surface of magnetic particles and amplified directly by PCR to compare Ct values.

[0551] In the initial testing, the parameters required for the washing machine needle to be centered in the hole were determined visually, and further optimization was carried out based on this.

[0552] Table 7: Comparison of washing conditions and parameters for magnetic particle DNA amplification

[0553]

[0554] Based on this result, the parameters set in condition 6 seem to have the best overall effect.

[0555] Under these conditions, the needle movement speed was set to the default value of 3. According to the instructions, selecting a faster movement speed helps retain magnetic particles when washing them. A simple comparison was made.

[0556] Table 8: Comparison of the effects of washing conditions and moving speed on Ct value

[0557]

[0558] If liquid residue remains during each wash cycle, it will reduce washing efficiency and may cause an increase in background signal. Therefore, it is necessary to compare the liquid residue situation at different washing machine needle movement rates.

[0559] If there is residual liquid, the needle delay time should be increased until the liquid can be completely absorbed.

[0560] Table 9: Effect of travel rate on liquid residue and delay time to completely dry

[0561]

[0562] The magnetic particles were mixed with a DNA solution of a certain concentration, washed under different conditions, resuspended to the original volume, and then subjected to PCR.

[0563] Table 10: The impact of travel rate and delay / s on the Ct value

[0564]

[0565] Considering the loss of magnetic particles and the washing background, the optimal conditions are a residence time of 6 CW and 5 seconds.

[0566] 3) Optimize the raw materials and reaction conditions for qPCR.

[0567] Because the supernatant of the eluted DNA-labeled antibody contains sodium hydroxide (NaOH), it may affect subsequent PCR reactions. Therefore, it is necessary to compare the concentration and volume of NaOH solution that the PCR reaction can tolerate.

[0568] 2×PCR premix containing the same concentration of DNA and primers was mixed with equal volumes of NaOH solutions of different concentrations, and PCR was performed to compare changes in Ct values.

[0569] Table 11: Effects of NaOH concentration on pH, sodium ion level, and Ct value

[0570]

[0571] Based on these results, the PCR reaction was unaffected when the NaOH solution concentration was below 7.5 mM during equal-volume mixing. However, considering that the elution efficiency of the complex might be low under these conditions, reducing the volume of supernatant used for PCR while using a higher concentration of NaOH could increase the initial template content while ensuring the PCR reaction remained unaffected. Therefore, 10 mM NaOH was used to elute the complex, and half the volume of the 2×PCR premix was used for detection.

[0572] In this PCR detection system, the use of SYBR Green dye led to the generation of nonspecific primer dimers, causing background noise. To reduce primer dimer formation, thereby lowering the background and improving sensitivity, PCR reactions were performed using different concentrations of primers to compare the background levels.

[0573] Table 12: Effect of primer concentration on Ct value

[0574]

[0575] Table 13: Effect of primer concentration on Ct value of IL-1β detection

[0576]

[0577] Based on these results, the background of the PCR reaction was very low when the primer concentration was approximately 25 nM. Although the Ct values ​​of positive samples also increased, the overall ΔCt range was larger, which helps to improve the sensitivity and discrimination ability of the reaction.

[0578] 4) Adjust the concentration ratio of different reaction components

[0579] Based on past experience, magnetic particle suspensions and samples are mixed in medium volumes for detection. In the initial reaction design, both magnetic particle and sample volumes were 25 µL, resulting in a final reaction volume of 50 µL. To reduce the sample volume, smaller volumes of sample and magnetic particles were attempted. However, approximately 40 µL was required to ensure adequate contact between the system and the toroidal magnet.

[0580] The Ct values ​​of the same sample containing a mixture of magnetic particles and DNA-coupled antibody complexes at different volumes were compared by mixing, incubation, washing, and PCR detection.

[0581] Table 14: Comparison of Ct values ​​for IL-6 detection

[0582]

[0583] Table 14: Comparison of Ct values ​​for IL-6 detection

[0584] The system volume was further reduced. Based on this result, using a reaction volume of 10 µL did not cause a significant change in the Ct value. However, this condition could significantly save reagents and samples, and was therefore selected as the optimal condition.

[0585] Table 15: Effect of reaction system volume on the Ct value detected by IL-6

[0586]

[0587] See primer design for BIQ system. Figure 3 In the following text, the 20 'y's in the barcode sequence correspond to a 20bp ONA (DNA barcode); a matching TaqMan probe was designed based on this. Primer 2 was used alone for individual BIQ-ELISA. Primers 1 and 3 were used for NGS library construction.

[0588] For barcode and primer design in Next-Generation Sequencing (NGS), see [link to documentation]. Figure 8A .

[0589] A complete barcode sequence is an example of (29+33+30+20+34+8+24=178 bases):

[0590] 5'-AATGATACGGCGACCACCGAGATCTACAC-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-NNNNAGCACACATTGCTGGTTCTGCTCACG-yyyyyyyyyyyyyyyyyyyyyyyyyyyyyy-CTGTCTCTTATACACATCTCCGAGCCCACGAGAC-xxxxxxxxx-ATCTCGTATGCCGTCTTCTGCTTG-3' (SEQ ID NO:13)

[0591] Primer 1: (29+33+30=92bp)

[0592] 5'-AATGATACGGCGACCACCGAGATCTACAC-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-NNNNAGCACACATTGCTGGTTCTGCTCACG (SEQ ID NO:14)

[0593] Primer 2: (26+20+34=80 bases)

[0594] 5'-AGCACACATTGCTGGTTCTGCTCACG-yyyyyyyyyyyyyyyyyyy-CTGTCTCTTATACACATCTCCGAGCCCACGAGAC (SEQ ID NO:15)

[0595] Primer 3: (34+8+24=66 bases)

[0596] CTGTCTCTTATACACATCTCCGAGCCCACGAGAC-xxxxxxxx-ATCTCGTATGCCGTCTTCTGCTTG-3' (SEQ ID NO:16)

[0597] Sequencing primers: AGCACCATTGCTGGTTCTGC (SEQ ID NO: 17, 21bp) and RD2SP (GTCTCGTGGGCTCGGAGATG (SEQ ID NO: 12, 20bp): PCR product was 80bp.

[0598] TaqMan probe: CACG-yyyyyyyyyyyyyyyyyyy (24bp, Tm62).

[0599] The above yyyyyyyyyyyyyyyyyyyy represents the antibody, and xxxxxxxx represents the i7 index to distinguish different samples.

[0600] 5) NGS reaction conditions and concepts

[0601] Five pairs of non-cross-reactive combinations were selected to test the NGS method. The combinations ALPP, CD38, IL-8, SOD1, and VCAN were validated, demonstrating that there was no cross-reactivity between them.

[0602] like Figure 8B As shown, their detection antibodies were barcoded with different DNA probes and mixed in the reaction in the same proportion. Their biotinylated capture antibodies were coated with streptavidin magnetic beads at optimal dilution. Nine different samples were amplified using PCR with different sample indices. Equal volumes of PCR products were mixed for NGS. Samples 1-5 each contained 10 ng / mL of a single recombinant antigen (ALPP, CD38, IL-8, SOD1, VCAN). Sample 6 was a mixture of the above five antigens at a concentration of 10 ng / mL, further diluted 10-fold to prepare Sample 7; Sample 8 was a blank negative control, and Sample 9 was a 10-fold diluted normal serum sample. NGS data were decoded by the NGS service provider.

[0603] The results showed that single detection and multiplex detection had similar detection sensitivity, and NGS could be successfully used for multiplex protein quantification (see Tables 16-17).

[0604] Table 16: Sample Analysis of CAB-bio, Antigen, and DAB-DNA Components

[0605]

[0606] Table 17: NGS-based multiplex protein quantification and detection sensitivity across targets

[0607]

[0608] Primer sequences:

[0609] Forward primer: 5'-AATGATACGGCGACCACCGAGATCT-3' (SEQ ID NO:18), Tm=62℃,

[0610] Reverse primer: 5'-CAAGCAGAAGACGGCATACGAGAT-3' (SEQ ID NO:19), Tm=59℃.

[0611] Primer and probe design for multiplex TaqMan detection

[0612] Table 18: Five Unique DNA Barcodes

[0613]

[0614] Five matching TaqMan probes

[0615] Probe Name: TaqMan Probe Sequence |

[0616] Tp1: FAM-5'- CACG TCTGACTACAGGCATTCCGT (SEQ ID NO:6)

[0617] Tp3: VIC-5'-CACGTCAACCTAGTGCGACGATAC (SEQ ID NO:7)

[0618] Tp5: ABY-5'-CACGCCGAGGTCTGTCACAGTGTA (SEQ ID NO:8)

[0619] Tp7: JUN-5'-CACGGTGAACCGTATCTGACGGCA (SEQ ID NO:9)

[0620] Tp9: CY5-5'-CACGTCCCGTTGTATTAGCCGCCG (SEQ ID NO:10)

[0621] Sequencing primers

[0622] Forward_P: AGCACACATTGCTGGTTCTGCTCACG (SEQ ID NO:11)

[0623] Reverse_R:GTCTCGTGGGCTCGGAGATG (SEQ ID NO:12)

[0624] Table 19.

[0625]

[0626] Table 20

[0627]

[0628] The experimental steps are as follows:

[0629] Diluted magnetic beads for the five targets were dispensed into PCR tubes.

[0630] The human serum sample is diluted to the required concentration in the test diluent.

[0631] Diluted serum samples were aliquoted into PCR tubes and then added to magnetic bead tubes corresponding to the target.

[0632] After incubation, the supernatant was removed using a magnetic rack.

[0633] Clean the magnetic beads four times with a magnetic rack.

[0634] Add the coupling complex prepared with the detection diluent to each well and incubate for 2 hours, shaking occasionally during the process.

[0635] Clean the magnetic beads four times with a magnetic rack.

[0636] After the final rinse, briefly centrifuge the tubes again, return them to the magnetic rack, and remove the liquid using a pipette.

[0637] Resuspend the magnetic beads in 20 µl of nuclease solution, and add 5 µl of the solution to 10 µl of 2× PCR premix (containing 100 nM primers).

[0638] Add 5 µl of water to each tube to bring the total volume to 20 µl.

[0639] Perform PCR under the following conditions:

[0640] Table 21

[0641]

[0642] Investigating serum levels of the selected target

[0643] Table 22

[0644]

[0645] To ensure similar Ct values, the serum dilution factor was optimized as follows:

[0646] Table 23

[0647]

[0648] DNA barcodes used in the test

[0649] Table 24

[0650]

[0651] Table 25

[0652]

[0653] Table 26 shows the concentration of purified PCR products. The concentration of double-stranded DNA was determined using the Qubit DsDNA High Sensitivity Detection Kit.

[0654]

[0655] Table 27

[0656]

[0657] This invention provides a development of a magnetic microbead-based quantitative immunoassay (BIQ-ELISA) platform for ultrasensitive protein quantification. The BIQ-ELISA technology combines the specificity of sandwich ELISA, the sensitivity of real-time PCR, and the ease of handling magnetic microbeads to reduce background interference, integrating them into a single, easy-to-use platform. The BIQ-ELISA method achieves a detection sensitivity of femtograms per milliliter (fg / ml), which is 1000 times higher than that of conventional ELISA.

[0658] Unlike ortho-linked assays (PLA) and ortho-extension assays (PEA), which require two antibodies with DNA sequences that need to be close together for PCR amplification, BIQ-ELISA uses only one antibody with a DNA barcode for each analyte. The detection antibody (DAB) binds to an oligonucleotide (ONA) barcode, allowing direct PCR amplification. This method eliminates the need for two DNA tags for ortho-linked amplification, thus improving detection sensitivity and making the system simpler and potentially more stable. The capture antibody (CAB) is biotin-tagged and pre-adsorbed onto streptavidin-coated magnetic beads. These magnetic beads not only increase the surface area for antibody-antigen interactions, reducing reaction volume through homogenized assays, simplifying handling and washing steps, but also improve sensitivity through a solid-phase assay system. In summary, compared to ortho-linked methods such as PLA and PEA, BIQ-ELISA simplifies the workflow while maintaining ultra-high sensitivity. This is achieved by utilizing a single DNA barcode for PCR amplification and the convenient handling of magnetic beads, thereby improving assay efficiency and sensitivity.

[0659] This procedure consists of only two steps, with a total testing time of four hours. Step 1: Formation and purification of the immune complex (ONA-DAB-antigen-CAB-biotin-streptavidin-microbeads). The test sample is incubated with DAB-ONA and CAB-biotin-streptavidin-microbeads in a 96-well plate. In the presence of the target protein, DAB-ONA binds to the target protein and is linked to the CAB-biotin-streptavidin-microbeads via biotin-streptavidin interaction. Unbound protein is removed by a magnetic automated washer. Step 2: PCR amplification. The bound immune complex is released from the microbeads and used as a template for qPCR. Primers and PCR reaction mixture are added to the wells, and data is collected via qPCR. The Ct values ​​obtained from qPCR are used to calculate the amount of antigen in each sample, with lower Ct values ​​indicating higher antigen concentrations.

[0660] TaqMan assays and SYBR Green assays are two popular methods for real-time PCR. TaqMan assays use sequence-specific probes to generate a fluorescent signal, while SYBR Green binds non-specifically to any double-stranded DNA. Because non-specific products (such as primer dimers or non-target amplification products) can interfere with SYBR Green assays, TaqMan assays offer higher specificity and accuracy than SYBR Green. Furthermore, unlike SYBR Green (which is limited to detecting a single amplification product in each reaction), TaqMan allows the use of probes with unique fluorescent labels to distinguish multiple targets. TaqMan assays are widely used in molecular biology, primarily for quantitative PCR (qPCR) applications to detect and quantify nucleic acids. However, they have not traditionally been used for direct protein detection. Studies have shown that TaqMan technology can be successfully integrated into immunoPCR for highly sensitive protein detection.

[0661] The BIQ-ELISA kit and detection method described in this invention have the following advantages:

[0662] - Specificity: Based on the sandwich method, it conforms to ELISA standards;

[0663] - Sensitivity: PCR-based detection; magnetic bead washing reduces background noise;

[0664] - Ease of use: Only two steps required;

[0665] - Sample volume: Homogeneous determination, low sample consumption;

[0666] - Automation: Improves efficiency and throughput, enabling data acquisition within 4 hours;

[0667] - Detection method: qPCR or dPCR can be selected, no expensive equipment required;

[0668] - Ultra-high sensitivity: 1000 times higher sensitivity than traditional ELISA;

[0669] - Ultra-low sample volume: less than 10 microliters;

[0670] - Can be used for multiple detection.

[0671] This article reports the development of BIQ-ELISA technology, including antibody-DNA conjugation using BS3 cross-linking agent; adsorption of biotinylated antibodies using streptavidin-coated magnetic microbeads; optimization of the detection method; setup of an automated magnetic washing device; and qPCR conditions for detection. Using the optimized system, at least five BIQ-ELISA kits were developed for the detection of IL-6, IL-1β, IL-12p70, IFNγ, and TNFα. Standard curve testing showed that the detection sensitivity for these five targets was comparable to SIMOA and 1000 times higher than that of conventional ELISA. In the detection of TNFα in more than a dozen patented serum samples, BIQ-ELISA detected TNFα in all samples, while SIMOA failed to detect it in five samples. The correlation between the two methods in calculating protein concentrations was 98%.

[0672] Overall, BIQ-ELISA offers comparable detection sensitivity to SIMOA while providing significant advantages such as smaller sample volume, shorter detection time, higher throughput, and compatibility with standard qPCR instruments. These characteristics make BIQ-ELISA a promising high-sensitivity, multiplex protein detection method, particularly suitable for detecting low-abundance protein biomarkers.

[0673] In the newly developed BIQ system, the TaqMan method demonstrated detection sensitivity comparable to or even higher than that of conventional SYBR Green qPCR. Furthermore, by designing TaqMan probes with different fluorescent labels and pairing them with antibodies labeled with unique DNA barcodes, multiplex detection of five different targets was successfully achieved. In this system, the detection antibodies for the five different targets were assigned unique DNA barcodes. qPCR detection was performed using TaqMan probes with different fluorescent labels against these five DNA sequences. The study shows that this system can successfully achieve multiplex detection of up to five different protein targets in a single assay, with performance comparable to single-target detection.

[0674] Integrating TaqMan technology into immunoPCR provides an innovative approach for protein detection. The BIQ system utilizes TaqMan's fluorescent probe detection technology to improve the accuracy and reliability of immunoPCR. This method retains the high sensitivity of traditional immunoPCR while introducing the advantages of multiplexing. This previously unrecognized application of TaqMan technology expands its use from traditional nucleic acid quantification to more advanced multiplex protein detection, which has significant implications for diagnostics and research.

[0675] Example 6: Biotinylated Sample Immunoquantitative PCR Detection Method Based on Magnetic Beads

[0676] Materials and Methods

[0677] Recombinant protein assay: Ten recombinant proteins (MIP-1α, eosinophil chemokine, IL-22, IL-12p40, IL-12p70, EXN4, IFN-γ, IL-1β, IL-6, and TNF-α) were biotinylated using EZ-Link NHS-PEG4-Biotin (Thermo Fisher, catalog number #21362) according to the manufacturer's instructions. To remove excess unreacted biotin, the biotinylated proteins were purified using a 7K molecular weight cutoff desalting column.

[0678] Biotinylated proteins were serially diluted and analyzed using both the BIQ and BIQL platforms. In the BIQ system, the biotinylated protein was first incubated with a target-specific capture antibody pre-immobilized on streptavidin-coated magnetic beads. After binding, a DNA-conjugated detection antibody was added to form a sandwich complex. Following incubation, unbound components were removed by multiple washes using a magnetic washer. The bound immune complex was then eluted with elution buffer, and its relative abundance was quantified by qPCR. In contrast, the BIQL system simplifies the workflow by directly incubating the biotinylated protein with streptavidin-coated magnetic beads, eliminating the need for pre-immobilization of the capture antibody. Subsequent steps, including incubation with the DNA-conjugated detection antibody, washing, elution, and qPCR detection, were identical to the BIQ protocol. To ensure accurate comparison between the two systems, equal amounts of magnetic beads and DNA-conjugated detection antibody were used for the same target.

[0679] NGS amplicon library construction

[0680] DNA barcode design

[0681] The DNA barcodes used in the BIQL system are carefully designed to simultaneously meet several key requirements for compatibility with both NGS-based and TaqMan-based detection, while optimizing synthesis costs and detection efficiency. Design goals include:

[0682] Design a unique DNA sequence for each target (insertion sequence) to achieve precise target identification;

[0683] Each barcode is equipped with a dedicated sequencing primer binding site;

[0684] It is compatible with sample barcode labeling and supports multiple analysis across samples;

[0685] It can be decoded using both next-generation sequencing (NGS) and TaqMan probe-based qPCR.

[0686] Integrates all necessary Illumina sequencing components, including P5, i5, Read 1 sequencing primers (Rd1SP), Read 2 sequencing primers (Rd2SP), i7, and P7;

[0687] The compact design ensures that all DNA fragments are no longer than 100 base pairs, reducing synthesis costs and increasing efficiency.

[0688] To meet these requirements, three different DNA fragments were designed:

[0689] Sequence 1 (Seq1: 92 bp) (SEQ ID NO: 25): Contains Illumina P5 (29 bp), i5 index (8 bp), and Read 1 sequencing primer (Rd1SP, 33 bp). It includes a 30 bp barcode sequencing primer site, with the first 4 nucleotides randomly designed to maximize sequencing diversity and fidelity.

[0690] Sequence 2 (Seq2: 80 bp), selected from Table 28:

[0691] Contains a unique 20 bp target-specific DNA barcode

[0692] Includes a 30 bp barcode sequencing primer site

[0693] Includes Read 2 sequencing primers (Rd2SP, 34 bp).

[0694] To improve TaqMan detection efficiency, a 4 bp shared sequence was added to the 3' end of the sequencing primer region, forming a 24 bp TaqMan probe region.

[0695] Sequence 2 is conjugated to the detection antibody as the primary target identifier.

[0696] Sequence 3 (Seq3: 66 bp), selected from Table 29:

[0697] Includes additional Illumina sequencing components: Read 2 sequencing primers (Rd2SP, 34 bp), i7 index (8 bp, for sample indexing), and P7 adapter (24 bp).

[0698] In the BIQL workflow, sequence 2 (linked to the detection antibody) carries a unique barcode for each target. This barcode can be read via NGS using its dedicated sequencing primers, or via TaqMan detection using its unique 24 bp probe region.

[0699] When paired with sequence 3, the i7 index provides NGS with sample-specific identifiers, greatly expanding the capabilities of multiplex detection. For example, combining 200 unique target barcodes with 100 unique i7 sample indices can theoretically achieve 20,000 unique detection events.

[0700] Primer and probe design

[0701] Table 28: Barcode sequences used for sequence 2:

[0702]

[0703] Table 29: Source of Sequence 3:

[0704]

[0705]

[0706]

[0707] Table 30 Matching TaqMan Probes

[0708]

[0709] Table 31 Primer Sequences

[0710]

[0711] Before constructing the NGS library, Sequence 1 needs to be added to complete the Illumina library structure. The unique i5 index contained in Sequence 1 can serve as a batch identifier, providing additional multiple detection layers and further improving diversity. By combining 200 unique target barcodes, 100 i7 sample indexes, and 5 i5 batch indexes, a single sequencing run can theoretically achieve up to 100,000 different detection events.

[0712] This compact, modular barcode design enables BIQL systems to achieve scalable, cost-effective, and highly multiplexed protein detection, while remaining compatible with NGS and TaqMan-based workflows.

[0713] Evaluation of NGS amplicon library construction methods

[0714] To construct NGS amplicon libraries, four different methods were evaluated using three DNA fragments (Sequence 1, Sequence 2, and Sequence 3). Figure 12 ):

[0715] Method 1: Direct PCR was performed by mixing all three DNA fragments. Sequence 1 and Sequence 3 were used as primers (Seq1, Sequence 2, Sequence 3).

[0716] Method 2: A two-step PCR strategy was adopted. In the first round, SP2 primers were used to amplify sequences 2 and 3, followed by purification of the PCR products. In the second round, sequences 1 and SP7 primers were used for further amplification.

[0717] Method 3: Direct PCR was performed using all three fragments, with specific SP5 and SP7 primers.

[0718] Method 4: Two-step PCR was used. In the first round, sequences 2 and 3 were amplified using primers SP2 and SP7, and the products were purified using a PCR purification kit. In the second round, sequence 1 was added to the purified product, and then amplified using primers SP5 and SP7.

[0719] All four methods successfully obtained the expected 170 bp amplification product, but the following differences exist:

[0720] Methods 1 and 2: The higher levels of non-specific background signal may be due to the use of longer DNA templates as primers, which have lower specificity than shorter primers.

[0721] Method 3: The background signal is low, but the total product yield is limited.

[0722] Method 4: High product yield with good PCR product purity. Furthermore, introducing sequence 1 during the NGS pretreatment step, rather than treating it separately, helps reduce inter-sample variability.

[0723] Based on the above results, Method 4 was selected as the subsequent optimization scheme. The final optimization conditions are as follows:

[0724] Template concentration: 1 nM each for sequence 1 and sequence 3

[0725] Primer concentration:

[0726] First round of PCR: 30 nM each for SP2 and SP7.

[0727] Second round of PCR: 20 nM each for SP5 and SP7.

[0728] This optimization scheme ensures high-quality and stable NGS library construction.

[0729] Based on this, this study selected five cytokines (IFNγ, IL1β, IL6, IL12p70, and TNFα) for validation. Different concentrations of biotinylated protein standards were used to test these proteins in both singleton and multiplex detection modes. Serially diluted biotinylated serum samples were amplified using primers with different i7 indices (binding sequence 3), and 25 PCR cycles were run to ensure the amplification was in the exponential phase (early Ct value stage).

[0730] After purification of the PCR products, 3 μL was taken from each reaction and mixed, followed by a second round of PCR (30 cycles) using primers containing sequence 1. The final library was evaluated using SDSPAGE gel electrophoresis, and library concentration was determined using Qubit quantitative PCR. The mixed library was sequenced on an Illumina platform. Data were first analyzed according to the i7 index and further confirmed using unique target-specific barcodes.

[0731] Table 32

[0732]

[0733] Here, we propose a novel, advanced platform for high-throughput, ultrasensitive protein quantification by combining bead-based immunoqPCR with biotinylated sample quality level (BIQL) technology. See also Figure 9 In this system, all proteins in the sample are first biotinylated for universal labeling. These biotinylated proteins are immobilized on streptavidin-coated magnetic beads and then co-incubated with a set of DNA barcoded detection antibodies to form highly specific immune complexes. Unlike traditional sandwich assays that require secondary antibodies, this platform utilizes DNA tags as unique molecular identifiers for direct quantification via qPCR or next-generation sequencing. BIQL technology combines the femtogram sensitivity of bead-based quantitative immunoPCR with the scalable multiplex detection capabilities of biotinylated sample arrays. By integrating direct protein biotinylation, magnetic bead capture, and DNA barcoded antibody detection, BIQL enables the digital, highly specific quantification of over 1000 proteins in a single run—making it an ideal tool for clinical biomarker discovery, systems biology, and next-generation diagnostics.

[0734] This article discloses the development progress of BIQL (Biodex-based Quantitative ImmunoPCR with Labeled Samples) technology, which integrates several key innovations to achieve sensitive, high-throughput protein detection. Its workflow includes sample biotinylation, immobilization of biotinylated proteins on streptavidin-coated magnetic beads, and antibody-DNA conjugation using BS3 cross-linking agent. The system further features optimized detection conditions, a rational DNA barcode design, and an NGS amplicon library construction scheme to support multiplex detection.

[0735] Using the optimized BIQL platform, we successfully evaluated two proteomes covering both high-abundance and low-abundance plasma proteins. BIQL demonstrated detection sensitivity comparable to BIQ and SIMOA, while offering unique advantages including lower sample requirements, shorter detection times, higher throughput, and the ability to perform up to five-fold detection on standard qPCR instruments. Furthermore, BIQL signals can be read using next-generation sequencing technology, enabling scalable, ultrasensitive, and highly multiplexed protein detection.

[0736] Importantly, by employing a plasma stratification strategy based on protein abundance range grouping, BIQL technology holds promise for detecting thousands of proteins from a single drop of blood, making it a highly promising tool for biomarker discovery and clinical applications, particularly for low-abundance protein targets.

[0737] Example 7: The BIQL system's detection sensitivity for biotinylated recombinant proteins is equal to or better than that of the BIQ system.

[0738] Ten recombinant proteins (MIP1α, Eotaxin, IL22, IL12p40, IL12p70, EXN4, IFNγ, IL1β, IL6, and TNFα) were biotinylated using EZLink NHSPEG4Biotin (Thermo Fisher, catalog number #21362) according to the manufacturer's instructions. To remove excess unreacted biotin, the biotinylated proteins were purified using a 7K molecular weight cutoff desalting column.

[0739] The purified biotinylated protein was serially diluted and analyzed on both the BIQ and BIQL platforms. In the BIQ system, the biotinylated protein was first incubated with a target-specific capture antibody pre-coated on streptavidin magnetic beads. Following this binding step, a DNA-conjugated detection antibody was added to form a sandwich complex. After incubation, unbound components were removed by multiple washes using a magnetic bead washer. The bound immune complex was then eluted with elution buffer, and its relative abundance was quantified by qPCR. In contrast, the BIQL system simplifies the workflow by directly incubating the biotinylated protein with streptavidin magnetic beads, eliminating the pre-coating step of the capture antibody. Subsequent operations, including incubation with the DNA-conjugated detection antibody, washing, elution, and qPCR detection, were consistent with the BIQ protocol. To ensure a fair comparison between the two systems, the amount of magnetic beads and DNA-conjugated detection antibody used for the same target was consistently maintained.

[0740] For most targets, the cyclic thresholds (CT values) obtained by BIQL and BIQ systems are comparable, confirming that they have similar detection sensitivities. Figures 10A-10C It is worth noting that the detection sensitivity of IL1β in the BIQL system is significantly improved compared to the BIQ system. This performance improvement may be due to the BIQL system effectively reducing the interference of sub-preferred binding affinity between biotinylated IL1β and its capture antibody—an issue that may affect the detection performance of the traditional BIQ system, but is effectively mitigated in the BIQL system.

[0741] Detection sensitivity was determined based on a standard curve generated using the BIQ kit. Among the five representative targets evaluated, BIQL demonstrated similar or superior sensitivity to BIQ, as shown in Table 33. These results highlight the stability and superior performance of the BIQL system, especially for targets where antibody-antigen interactions may be limited in traditional detection methods.

[0742] Table 33. Comparison of detection sensitivity of BIQ and BIQL for selected targets

[0743]

[0744] Note: Detection sensitivity is expressed as the lowest detectable concentration (pg / mL) based on qPCR readings.

[0745] Example 7

[0746] Both recombinant HPX protein and a normal serum sample were biotinylated, and their concentrations were determined using the HPX BIQ kit. In subsequent experiments, biotinylated HPX protein was used as a standard, and the HPX concentration in the same biotinylated serum sample was determined using the BIQL system. The calculated HPX concentrations in biotinylated serum, obtained using the BIQ method and the BIQL method, were 360 ​​μg / ml and 364 μg / ml, respectively.

[0747] Table 34. Results of BIQL system validation using HPX recombinant protein and serum samples

[0748]

[0749] Example 9: Multiple Applications of TaqMan Detection Technology

[0750] The TaqMan assay offers superior sensitivity and multiplex detection capabilities compared to SYBR Green.

[0751] TaqMan detection technology has been widely used in molecular biology, primarily for quantitative PCR (qPCR) to achieve nucleic acid detection and quantitative analysis. However, this technology has not traditionally been directly used for protein detection. This patent demonstrates that TaqMan technology can be successfully integrated into immunoPCR for highly sensitive protein detection. TaqMan and SYBR Green assays are two commonly used methods in real-time PCR. TaqMan uses sequence-specific probes to generate a fluorescent signal, while SYBR Green non-specifically binds to any double-stranded DNA. Because non-specific products such as primer dimers or off-target amplification products can interfere with SYBR Green detection, TaqMan generally has higher specificity and accuracy.

[0752] To verify this hypothesis, we processed serially diluted biotinylated IL6 samples using the BIQL detection system and compared two detection chemical methods: the TaqMan probe method and the SYBR Green method. Figure 11Both systems showed consistent trends in CT values, as expected, demonstrating a significant negative correlation with IL-6 concentration. However, the SYBR Green method exhibited a higher background signal, resulting in lower apparent CT values ​​for blank or low-concentration samples, consistent with its known susceptibility to nonspecific amplification and primer dimer interference. In contrast, the TaqMan method maintained a lower background signal and higher overall specificity. The calculated limits of detection (LODs) for the TaqMan and SYBR Green methods were 0.005 pg / mL and 0.047 pg / mL, respectively. These results confirm that the TaqMan-based BIQL detection method has superior detection sensitivity compared to the traditional SYBR Green method, further supporting the integrated application of TaqMan technology as the preferred high-sensitivity protein detection method in the BIQL platform.

[0753] Another key advantage of the TaqMan assay is its multiplex detection capability. Because SYBR Green nonspecifically binds to all double-stranded DNA, it can only detect a single amplification product per reaction; while the TaqMan platform, by using sequence-specific probes labeled with different fluorescent groups, can achieve simultaneous detection of multiple targets.

[0754] This study successfully achieved multiplex detection of five protein targets—IL1β, IL6, IL12p70, IFNγ, and TNFα—by pairing detection antibodies with unique DNA barcodes with corresponding TaqMan probes (each probe labeled with a different fluorescent group). Each antibody was conjugated to a unique DNA sequence, and paired TaqMan probes were designed to specifically hybridize this sequence in qPCR detection. Subsequently, the multiplex (quintet) detection was compared in parallel with the corresponding single-detection assays using the same set of standard protein concentrations. The results showed that all five protein targets could be reliably detected in a single reaction, with performance metrics (sensitivity, dynamic range, and repeatability) comparable to single-detection assays. This confirms the stability of TaqMan-based multiplex detection in the BIQL system and provides a powerful tool for high-throughput multi-target protein quantification with limited sample sizes.

[0755] The integration of TaqMan technology into immunoPCR represents a significant innovative advancement in the field of protein detection. By utilizing TaqMan's sequence-specific fluorescent probe detection principle, the BIQL system significantly improves the accuracy, specificity, and reliability of detection while maintaining the inherent high sensitivity of traditional immunoPCR. Furthermore, the introduction of TaqMan chemistry enables stable multiplex analysis, representing a significant improvement over traditional single-target detection methods. This innovative application expands the applicability of TaqMan technology from traditional nucleic acid quantification to the field of high-sensitivity multiplex protein detection, constructing a multifunctional technology platform. The resulting BIQL TaqMan system demonstrates immense potential in biomarker discovery, clinical diagnosis, and high-throughput protein analysis, meeting key needs in both basic research and translational applications.

[0756] Table 35. Results of protein target detection using BIQL-TaqMan

[0757]

[0758] Table 36. Results of protein target detection using BIQL-TaqMan

[0759]

[0760] NGS Experimental Results

[0761] This first sequencing attempt aimed to evaluate the feasibility of the system, including its specificity, sensitivity, multiplexing capability, and performance in serum samples. We first used the i7 index to segment and analyze NGS libraries from 20 samples, and then decoded them using unique target-specific barcodes corresponding to five cytokines.

[0762] Despite a relatively high background signal in the initial test, the results clearly showed that all five cytokines were accurately detected. Sequencing read counts were positively correlated with cytokine concentrations, and the performance of multiplex detection was comparable to that of singlex detection (see [link to original text]). Figure 13 Furthermore, all five cytokines were detectable in biotinylated serum samples diluted 20-fold, with IL12p70 and IFNγ remaining detectable even at 200-fold dilution.

[0763] In summary, these findings demonstrate that NGS technology can be successfully integrated into the BIQ / BIQL platform to achieve ultrasensitive, highly specific, and multiplexed cytokine quantification. The system reliably distinguishes targets through unique barcodes, maintaining consistent performance between singleton and multiplex detection, and achieving stable detection even in diluted biotinylated serum samples. These results confirm the feasibility of applying NGS-based detection protocols in BIQ / BIQL systems, providing a scalable, high-throughput strategy for protein biomarker analysis.

[0764] It should be understood that the methods and compositions disclosed herein are not limited to the specific methods, protocols, and reagents described, as these can vary. It should also be understood that the terminology used herein is for describing specific embodiments only and is not intended to limit the scope of the invention, which is defined solely by the appended claims.

[0765] Those skilled in the art will be able to identify or determine many equivalents of specific embodiments of the methods and compositions described herein using methods not exceeding conventional experimental techniques. These equivalents are intended to be covered by the following claims.

Claims

1. A kit for detecting a target analyte in a sample, wherein, The kit includes: (a) the first reagent; and (b) Second reagent, in: (i) The first reagent contains magnetic particles modified with a first binder specific to the target analyte; (ii) The second reagent contains a second binding agent that is specific to the target analyte and is coupled to a nucleic acid barcode; The first binder and the second binder bind to different epitopes of the target analyte.

2. A kit for detecting two or more target analytes in a sample, characterized in that, The kit includes: (a) Magnetic particles modified with two or more first binders; and (b) Two or more second binders, Two or more first binders and two or more second binders form two or more binding pairs. Each binding pair contains a first binding agent and a second binding agent, both targeting the same analyte; Each second binding agent is coupled to a nucleic acid barcode, and different second binding agents correspond to different nucleic acid barcodes; Furthermore, the two or more target analytes are different from each other; In each binding pair, the first and second binders bind to different or the same epitopes of the target analyte.

3. The kit according to any one of claims 1-2, wherein, The first and second binders in each binding pair are independently an antibody, a nucleic acid aptamer, a peptide, or a combination thereof. Preferably, the antibody is a monoclonal antibody, a polyclonal antibody, a recombinant antibody, a humanized antibody, a human antibody, a chimeric antibody, a functional fragment thereof, or a combination thereof.

4. The kit according to any one of claims 1-3, wherein, The diameter of the modified magnetic particles is approximately 0.2 µm to 6 µm, preferably 0.3 µm to 5.5 µm, more preferably 0.5 µm to 5 µm, more preferably 1 µm to 4.5 µm, more preferably 1.5 µm to 4 µm, more preferably 2 µm to 3.5 µm, or more preferably 2.5 µm to 3 µm.

5. The kit according to any one of claims 1-4, wherein, The density of the modified magnetic particles is approximately 1.4 gDS / cm³. 3 Up to 1.8 g DS / cm 3 1.3 g DS / cm 3 Up to 1.9 g DS / cm 3 1.5 g DS / cm 3 Up to 1.7 g DS / cm 3 1.2g DS / cm 3 Up to 2.0 g DS / cm 3 1.6 g DS / cm 3 Up to 1.9 g DS / cm 3 1.1 g DS / cm 3 Up to 2.1 g DS / cm 3 Or 1.0 g DS / cm 3 Up to 2.5 g DS / cm³.

6. The kit according to any one of claims 1-5, wherein, The first binder is coupled to the modified magnetic particles via affinity pairs selected from the group consisting of: streptavidin family protein / biotin, nucleic acid aptamer / target molecule pairs, receptor / ligand pairs, natural or synthetic receptor / ligand pairs, or amines and carbonyl compounds.

7. The kit according to claim 6, wherein, The streptavidin family proteins are streptavidin, avidin, or neutral avidin.

8. The kit according to any one of claims 1-7, wherein, The target analyte is selected from at least one of the following: IL-8 (interleukin-8), ALPP (alkaline phosphatase), CD38 (differentiation cluster 38), SOD1 (superoxide dismutase-1), and VCAN (chondroitin).

9. The kit according to claim 3, wherein, The functional fragment is a single-chain variable fragment (scFv), a Fab fragment, a nanobody, a bispecific antibody, a bisomatic antibody, a trisomatic antibody, or a combination thereof.

10. The kit according to any one of claims 1-9, characterized in that, The first and second binders for the same target analyte are selected from the corresponding combinations of biotin-modified capture antibodies (CABs) and nucleic acid barcode-modified detection antibodies (DABs) listed in Table 2.

11. The kit according to any one of claims 1-10, wherein, The second binding agent is coupled to the nucleic acid barcode via a linker.

12. The kit according to claim 11, wherein, The connector is n1 is an integer from 1 to 10, preferably from 1 to 8, preferably from 1 to 6, preferably from 2 to 10, preferably from 2 to 8, preferably from 4 to 10 or from 4 to 8.

13. The kit according to any one of claims 1-12, wherein, The nucleic acid barcode includes: (a) The region used for hybridization with the TaqMan probe; (b) The region used for primer binding during PCR amplification; and (c) Regions used for target-specific binding in the detection system.

14. The kit according to claim 13, wherein, The nucleic acid barcode is selected from SEQ ID NO:1-5, or from SEQ ID NO:20-SEQ ID NO:

24.

15. The kit according to any one of claims 1-14, characterized in that, It also contains one or more buffer solutions and one or more reagents.

16. The kit of claim 15, wherein one or more buffers comprise: (a) Dilution buffer used for preparing standards and diluting samples; (b) Washing buffer for removing unbound material from magnetic particles; (c) Elution buffer containing sodium hydroxide for releasing oligonucleotides (ONA) from immune complexes. (d) Blocking buffer used to reduce nonspecific binding; Preferably, the blocking buffer is a PBS solution containing casein and Biolipidure 1002 (B1002), more preferably a PBS solution containing 10±1% casein and 1±0.1% (w / v) B1002.

17. The kit according to claim 15, wherein one or more reagents comprise: (a) A PCR reaction mixture containing DNA polymerase and nucleotides for qPCR amplification; (b) One or more oligonucleotide primers for amplifying oligonucleotide (ONA) barcodes; (c) TaqMan probes with fluorescent reporter and quencher groups for detecting oligonucleotides (ONA) during qPCR amplification.

18. A method for detecting one or more target analytes in a sample using the kit described in claims 1-17, characterized in that, The method includes: (i) Incubating the test sample with the modified magnetic particles and the second binding agent to form an immune complex; and (ii) Amplify and / or sequence the nucleic acid barcode.

19. The method according to claim 18, wherein, Step (ii) involves adding PCR mixture to the nucleic acid barcode and amplifying the eluted nucleic acid by qPCR.

20. The method according to any one of claims 18-19, further comprising, after step (ii), (b) determining the concentration of each target analyte.

21. The method according to claim 20, wherein, Step (b) includes generating a standard curve for each target analyte and calculating the concentration of the target analyte in the sample based on the Ct value obtained in step (ii).

22. The method according to any one of claims 18-21, wherein, Step (ii) is performed by qPCR or next-generation sequencing or a combination thereof.

Citation Information

Patent Citations

  • Identification and engineering of antibodies with variant Fc regions and methods of using same

    US20050037000A1

  • Identification and engineering of antibodies with variant Fc regions and methods of using same

    US20050064514A1

  • Stabilized nucleic acid dark quencher-fluorophore probes

    US20140194611A1

  • Method for detecting target nucleic acid

    US20140349295A1

  • Multi-primer Assay for Mycoplasma Detection

    US20140378330A1