Human LAD-1 IgA Autoantibody ELISA Detection Kit and Its Application

By using microwell strips of deglycosylated LAD-1 recombinant protein and enzyme-labeled antibodies via ELISA, the problem of complex and time-consuming LAD-1 IgA antibody detection in existing technologies has been solved, achieving rapid, simple and highly specific detection results.

CN122109543APending Publication Date: 2026-05-29DAQING OIL FIELD GENERAL HOSPITAL

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
DAQING OIL FIELD GENERAL HOSPITAL
Filing Date
2026-01-28
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

There is a lack of economical, rapid and scalable methods for detecting LAD-1 IgA autoantibodies in the current technology, and the immunoblotting method is complex, time-consuming and has low specificity.

Method used

The ELISA method was used, with micro-well strips coated with recombinant LAD-1 protein combined with horseradish peroxidase-labeled rabbit anti-human IgA antibody. LAD-1 IgA antibody in human serum was measured by microplate reader. Deglycosylated recombinant LAD-1 protein was selected to improve antibody reactivity.

Benefits of technology

It enables rapid, simple, and highly specific detection of LAD-1 IgA antibodies, which is easier to apply clinically than immunoblotting and improves the sensitivity and specificity of detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure SMS_1
    Figure SMS_1
Patent Text Reader

Abstract

The application discloses a human LAD-1 IgA autoantibody ELISA detection kit and application thereof. The kit comprises LAD-1 recombinant protein coated micro-pore strips. Preferably, the LAD-1 recombinant protein is deglycosylated LAD-1 recombinant protein. Further, the application also provides application of the human LAD-1 IgA autoantibody ELISA detection kit in preparation of a reagent for detecting LAD-1 IgA autoantibody or diagnosing linear IgA bullous dermatosis (LABD). Compared with existing immunoblotting, the ELISA method is easier to be applied to clinical diagnosis of LABD, and through deglycosylation treatment of the LAD-1 recombinant protein, the reaction capacity of the antibody to the LAD-1 recombinant protein is increased, and the detection sensitivity is improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to an ELISA kit and its application, and more particularly to an ELISA detection kit for LAD-1 IgA autoantibodies and its application. This invention belongs to the field of pharmaceutical technology. Background Technology

[0002] BP180, also known as type XVII collagen or bullous pemphigoid antigen 2, has a relative molecular mass of 180,000 and is a major structural protein located on hemidesmosomes. As an important component of the hemidesmosome-anchor fiber complex, BP180 plays a crucial role in maintaining the integrity of the hemidesmosome complex and the normal adhesion between the epidermis and dermis. LABD97 and LAD-1 are soluble fragments generated by proteolytic hydrolysis of the extracellular region of BP180; their biological functions are not fully elucidated, but they may be related to keratinocyte migration and basement membrane formation. BP180-related autoimmune bullous diseases include bullous pemphigoid (BP), linear IgA bullous dermatosis (LABD), pemphigoid of pregnancy, and mucosal pemphigoid. The extracellular region of BP180 contains multiple sites for autoantibody responses. Current research shows that the target sites for autoimmune vesicular diseases on BP180 exhibit heterogeneity, and different clinical manifestations of the same disease are also related to target site heterogeneity.

[0003] Currently, the diagnosis of LABD requires laboratory detection of IgA autoantibodies recognizing the self-antigen LAD-1 (120 kDa) in the patient's serum. However, there are currently no clinically applicable kits for detecting LAD-1 IgA autoantibodies. Laboratories primarily use Western blotting with concentrated HaCaT cell supernatant as the antigen to detect LAD-1 IgA autoantibodies in patient serum. The main drawbacks of this method are the need for concentrated HaCaT cell supernatant, the complex and expensive procedure, and the low specificity due to the fact that HaCaT cell supernatant is a mixture. Furthermore, the complex, time-consuming, and technically challenging nature of Western blotting limits its widespread adoption. These drawbacks have resulted in only a very small number of laboratories both internationally and domestically being able to perform Western blotting experiments using concentrated HaCaT cell supernatant as the antigen.

[0004] Therefore, establishing an economical, rapid, and scalable method for detecting LAD-1 IgA type autoantibodies is a technical problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0005] The purpose of this invention is to provide a human LAD-1 IgA autoantibody ELISA detection kit and its application.

[0006] To achieve the above objectives, the present invention employs the following technical means:

[0007] The present invention provides a human LAD-1 IgA autoantibody ELISA detection kit, wherein the kit includes microwell strips coated with LAD-1 recombinant protein.

[0008] Preferably, the human LAD-1 recombinant protein is a deglycosylated LAD-1 recombinant protein.

[0009] Preferably, the amino acid sequence of the recombinant human LAD-1 protein is shown in SEQ ID NO.1.

[0010] Preferably, the recombinant human LAD-1 protein is obtained by expression using an insect baculovirus expression system.

[0011] Preferably, the kit further includes:

[0012] (1) Standard serum 1 (1×): 20 mM PBS containing 0.05% w / v NaN3, pH 7.4;

[0013] (2) Standard serum 2 (1×): 20 mM PBS containing 100 U / ml LAD-1 IgA type autoantibody and 0.05% w / v NaN3, pH 7.4;

[0014] (3) Enzyme-labeled antibody: Rabbit anti-human IgA antibody labeled with horseradish peroxidase;

[0015] (4) Reaction buffer (1×): 20 mM PBS containing 0.05% v / v Tween 20 and 0.05% w / v NaN3, pH 7.4;

[0016] (5) Washing buffer (10×): 200mM PBS containing 0.5% v / v Tween20, pH 7.4;

[0017] (6) Enzyme substrate solution: TMB colorimetric solution;

[0018] (7) Termination solution: 0.5N hydrochloric acid solution.

[0019] Furthermore, the present invention also proposes the application of the human LAD-1 IgA autoantibody ELISA detection kit described in any of the above claims in the preparation of reagents for detecting LAD-1 IgA autoantibodies.

[0020] Furthermore, the present invention also proposes the application of the human LAD-1 IgA autoantibody ELISA detection kit described in any of the above claims in the preparation of reagents for diagnosing linear IgA bullous dermatosis (LABD).

[0021] This invention relates to a human LAD-1 IgA autoantibody ELISA kit, which qualitatively measures LAD-1 IgA antibodies in human serum using an ELISA method. During detection, patient serum and standard serum are added to microwells coated with recombinant LAD-1 protein. The LAD-1 IgA antibody binds to the antigen. After washing, unbound serum protein is removed. Then, horseradish peroxidase-labeled anti-human IgA antibody is added to the microwells to bind with human IgA. After washing, horseradish peroxidase substrate is added to react with horseradish peroxidase. Finally, the enzyme reaction is terminated by adding acid solution. The absorbance is measured using an ELISA reader to quantify the detection results.

[0022] Compared with the prior art, the beneficial effects of the present invention are:

[0023] (1) This invention is the first kit to use the ELISA method to detect LAD-1 IgA antibodies. Compared with the existing immunoblotting method, the ELISA method is easier to apply to the clinical diagnosis of LAD-1.

[0024] (2) The micro-well strips of the kit of the present invention are coated with LAD-1 recombinant protein, which has better specificity than concentrated HaCaT supernatant. Furthermore, the deglycosylation treatment of LAD-1 recombinant protein increases the reactivity of the antibody with the antigen and improves the sensitivity of the detection. Attached Figure Description

[0025] Figure 1 The results of SDS-PAGE and Western blot analysis of recombinant LAD-1 protein;

[0026] M: Protein molecular weight marker; P: Positive control; 1: Whole cell lysate; 2: Cell lysate supernatant; 3: Flow-through buffer; 4: Washing buffer; 5: Eluted with 20 mM imidazole; 6: Eluted with 50 mM iminodiacetic acid; 7-9: Eluted with 250 mM imidazole; 10: Eluted with 500 mM iminodiacetic acid; 11: Protein solution sterilized through a 0.22 μm filter;

[0027] Figure 2 This is the result of Western blot detection of LAD-1 antibody;

[0028] M: Protein marker; 1 and 2 use recombinant LAD-1 protein as antigen; 3 and 4 use deglycosylated recombinant LAD-1 protein as antigen; 1 and 3 use commercially available LAD-1 antibody as primary antibody; 2 and 4 use serum from LAD patients as primary antibody. Detailed Implementation

[0029] The present invention will be further described below with reference to specific embodiments, but the present invention is not limited to the following embodiments. Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present invention without departing from the spirit and scope of the present invention, but all such modifications and substitutions fall within the protection scope of the present invention.

[0030] Example 1 Expression of recombinant LAD-1 protein

[0031] 1. Design the amino acid sequence of the LAD-1 recombinant protein.

[0032] The amino acid sequence of the LAD-1 recombinant protein is shown below:

[0033] (SEQ ID NO.1 shown)

[0034] 2. Construction of baculovirus plasmids

[0035] The DNA sequence encoding the LAD-1 amino acid sequence (excluding the His tag) was synthesized and cloned into the His-tagged targeting vector pFastBac1 for expression in insect cells. The DH10Bac strain was used to generate the recombinant plasmid. The presence of the LAD-1 sequence gene in the plasmid was confirmed by PCR and sequencing. The sequencing primer sequences are as follows:

[0036] C714C912G0-2-seq1F: ACGTGGAGAGGTCGGTCTTC

[0037] C714C912G0-2-seq2F:GTGAGACTTTCTTGTCAGGA

[0038] C714C912G0-2-seq3F:TTGGACTATGCTGAACTTAG

[0039] C714C912G0-2-seq4F:CATTCCAGTTCCGTAGGCG

[0040] PFastBac-seqF1:AAATGATAACCATCTCGC

[0041] The recombinant plasmid obtained was named pFastBac-LAD-1, and its sequence is shown in SEQ ID NO.2.

[0042] 3. Expression and identification of LAD-1 recombinant protein

[0043] 3.1 Production of recombinant baculovirus

[0044] The DH10Bac strain was used to produce baculovirus plasmids. The positive recombinant baculovirus plasmids containing the target sequence were then confirmed using quantitative real-time PCR and ultimately used for subsequent virus production.

[0045] 3.2. Virus Production

[0046] Sf9 cells were cultured in Sf-900 II SFM medium (Life Technologies, catalog number: 10902-088) at 27°C in Erlenmeyer flasks on a shaker. The day before transfection, cells were seeded at an appropriate density in 6-well plates. On the day of transfection, the positive recombinant baculovirus plasmid and transfection reagent (PROMEGA, catalog number: E2691) were mixed at the optimal ratio and added to the cell culture dishes prepared for transfection. Cells were cultured in Sf-900 II SFM medium for 4 days at 27°C before harvest. After centrifugation, the supernatant was collected, and the P1 generation virus stock solution was obtained. The P1 generation virus was then used to amplify the P2 generation virus for subsequent infection.

[0047] 3.3 Expression and identification of target proteins

[0048] Protein expression was performed on 2L Sf9 cells infected with P2 generation virus. Cells were harvested after 3 days of culture in SIM SF medium, and protein expression was detected by Western blot.

[0049] 4. Large-scale purification and analysis of LAD-1 recombinant protein

[0050] Cell pellets were collected and lysed using an appropriate cell lysis buffer. The supernatant from the cell lysis buffer was incubated with a nickel column pre-equilibrated with equilibration buffer (20 mM Tris-HCl, 500 mM NaCl, 20 mM imidazole, pH 8.0), washed with wash buffer (20 mM Tris-HCl, 500 mM NaCl, pH 8.0), and then eluted with elution buffer (20 mM Tris-HCl, 500 mM NaCl, pH 8.0) containing 20 mM imidazole, 50 mM imidazole, 250 mM imidazole, and 500 mM imidazole to capture the target protein. The resulting high-purity proteins were pooled and subsequently sterilized through a 0.22 μm filter. Protein analysis was performed by SDS-PAGE and Western blot using standard protocols for molecular weight and purity measurements. The primary antibody used for Western blot was mouse anti-His antibody (GenScript, product number A00186). Its concentration was determined using the Bradford protein assay with BSA as the standard. Purity and molecular weight were determined by SDS-PAGE. The SDS-PAGE and Western blot analysis results of the LAD-1 recombinant protein are shown below. Figure 1 As shown.

[0051] Example 2: Establishment of an ELISA method for detecting LAD-1 IgA autoantibodies

[0052] 1. Coating of LAD-1 microporous strips

[0053] (1) The coating material is LAD-1 recombinant protein.

[0054] The LAD-1 recombinant protein was prepared in Example 1.

[0055] (2) Deglycosylation and dilution of LAD-1 recombinant protein

[0056] LAD-1 recombinant protein was dissolved in PBS at a storage concentration of 0.1 mg / ml. Deglycosylation was performed using the PNGase F deglycosylation kit (NEB, Beijing, China). The specific method was as follows:

[0057] 1) In a 1.5 ml centrifuge tube, mix 84 μl LAD-1 (10 μg), 10 μl Glycoprotein Denaturing Buffer (10×), and 6 μl water to prepare a 100 μl reaction solution;

[0058] 2) Incubate at 100℃ for 10 minutes;

[0059] 3) Cool on ice and collect samples instantly;

[0060] 4) Add 20 μl Glycobuffer 2 (10×), 20 μl 10% NP40, 50 μl water and 10 μl PNGase F to the centrifuge tube;

[0061] 5) Incubate at 37℃ for 24 hours;

[0062] 6) Mix the above desaccharified product (10 μg LAD-1 recombinant protein) with 10 ml PBS to prepare the antigen for the next ELISA experiment (96-well plate, 100 μl / well).

[0063] The recognition of pre- and post-deglycosylated LAD-1 recombinant protein by commercially available antibodies and patient serum was detected by Western blotting. Results are shown in [Figure number missing]. Figure 2 The results showed that both commercially available antibodies and patient serum responded more strongly to the deglycosylated recombinant LAD-1 protein.

[0064] (3) Wrapped

[0065] Dilute with PBS to achieve a final concentration of 1 ng / μl for deglycosylated recombinant LAD-1 protein (or undeglycosylated recombinant LAD-1 protein). Coat each well of a 96-well plate with the antigen, adding 100 µl of deglycosylated recombinant LAD-1 protein (or undeglycosylated recombinant LAD-1 protein) (1 ng / μl) and incubate overnight (12-16 hours) at 4°C.

[0066] 2. Establishment of an ELISA method for detecting LAD-1 IgA autoantibodies

[0067] (1) Reagent preparation

[0068] Before the experiment, place all test materials at room temperature (20-30℃); dilute an appropriate amount of washing buffer (200mM PBS containing 0.5% v / v Tween20, pH 7.4) with distilled water at a ratio of 1:10 as needed.

[0069] (2) Sample preparation

[0070] Dilute each patient's serum 1:50: Add 500µl of reaction buffer (20mM PBS containing 0.05% v / v Tween 20 and 0.05% w / v NaN3, pH 7.4) to 10µl of serum and mix well;

[0071] (3) Detection steps

[0072] Add 100 µl of diluted sample (1:50) to a 96-well plate and incubate at room temperature (20-30℃) for 60 minutes; at the same time, add standard serum 1 (20 mM PBS containing 0.05% w / v NaN3, pH 7.4) and standard serum 2 (containing 100 U / ml LAD-1 IgA autoantibody and 0.05% w / v NaN3 in 20 mM PBS, pH 7.4) as controls;

[0073] 1) Wash the 96-well plate: Wash three times with diluted washing buffer;

[0074] 2) Add horseradish peroxidase-labeled rabbit anti-human IgA antibody at 100 µl / well and react at room temperature (20-30℃) for 45 minutes;

[0075] 3) Wash the 96-well plate: Wash three times with diluted washing buffer;

[0076] 4) Add 100 µl of TMB colorimetric solution to each well and incubate at room temperature (20-30°C) for 15 minutes;

[0077] 5) Add the stop solution (0.5N hydrochloric acid solution) at a rate of 100µl / well.

[0078] 6) Read absorbance (450nm)

[0079] 7) Result Calculation and Judgment

[0080] Formula for calculating unit value (U / ml):

[0081] (A) 450 <Sample>-A 450 <Standard Serum 1>)*100 / (A 450 <Standard Serum 2> - A 450 <Standard Serum 1>)

[0082] Judgment criteria: A value <20 is negative; a value ≥20 is positive.

[0083] 8) Quality Control

[0084] Each test result must meet the following conditions, otherwise the result is invalid:

[0085] The OD450 of standard serum 1 is less than or equal to 0.100.

[0086] The OD450 of standard serum 2 is greater than or equal to 0.500.

[0087] 3. Sensitivity and specificity experiments of the method established in this invention.

[0088] First, serum samples from 20 patients known to be positive for LAD-1 IgA antibodies and 50 normal control serum samples were selected. The first round of testing was performed using the method described above. The results showed a clear distinction between the patient serum and the normal control serum. At this point, the cutoff value was set as the mean + 3 SD of the OD450 of the 50 normal control serum samples. A patient serum sample with an OD450 of 0.75 was selected as a positive control, and its relative value was set to 100. The corresponding relative cutoff value was 20. Using the established experimental method, we further tested 300 new normal control serum samples, 50 samples from the disease group, and two disease control groups (50 serum samples each). The specific experimental results are shown in Table 1.

[0089] Table 1

[0090] The results above demonstrate that using deglycosylated LAD-1 recombinant protein as the coating protein for ELISA not only improves the specificity of IgA autoantibody detection but also enhances the sensitivity of autoantibodies in recognizing LAD-1 antigen.

[0091] 4. Repeatability

[0092] The method established in this invention was used to replicate serum samples from five patients who were positive for LAD-1 IgA antibodies six times. The CV% value of each replicate was less than 15%, indicating that the method of this invention has good reproducibility.

[0093] 5. Detection range

[0094] The detection range of this kit is 10-150 U / ml.

[0095] 6. Interfering substances

[0096] It is necessary to avoid using highly hemolyzed samples, as well as high-concentration serum diluted too low for testing.

[0097] Example 3 Assembly of LAD-1 IgA autoantibody ELISA detection kit

[0098] The LAD-1 IgA autoantibody ELISA kit includes:

[0099] (1) LAD-1 microporous strip (96-well or 48-well)

[0100] (2) Standard serum 1 (1×): 20 mM PBS containing 0.05% w / v NaN3, pH 7.4;

[0101] (3) Standard serum 2 (1×): 20 mM PBS containing 100 U / ml LAD-1 IgA type autoantibody and 0.05% w / v NaN3, pH 7.4;

[0102] (4) Enzyme-labeled antibody: Rabbit anti-human IgA antibody labeled with horseradish peroxidase;

[0103] (5) Reaction buffer (1×): 20 mM PBS containing 0.05% v / v Tween 20 and 0.05% w / v NaN3, pH 7.4;

[0104] (6) Washing buffer (10×): 200mM PBS containing 0.5% v / v Tween20, pH 7.4;

[0105] (7) Enzyme substrate solution: TMB colorimetric solution;

[0106] (8) Termination solution: 0.5N hydrochloric acid solution.

Claims

1. A human LAD-1 IgA autoantibody ELISA detection kit, characterized in that, The kit includes microwell strips coated with LAD-1 recombinant protein.

2. The human LAD-1 IgA autoantibody ELISA detection kit as described in claim 1, characterized in that, The LAD-1 recombinant protein mentioned above is a deglycosylated LAD-1 recombinant protein.

3. The human LAD-1 IgA autoantibody ELISA detection kit as described in claim 1, characterized in that, The amino acid sequence of the LAD-1 recombinant protein is shown in SEQ ID NO.

1.

4. The human LAD-1 IgA autoantibody ELISA detection kit as described in claim 1, characterized in that, The LAD-1 recombinant protein was obtained by expression using an insect baculovirus expression system.

5. The human LAD-1 IgA autoantibody ELISA detection kit as described in claim 1, characterized in that, The kit also includes: (1) Standard serum 1 (1×): 20 mM PBS containing 0.05% w / v NaN3, pH 7.4; (2) Standard serum 2 (1×): 20 mM PBS containing 100 U / ml LAD-1 IgA type autoantibody and 0.05% w / v NaN3, pH 7.4; (3) Enzyme-labeled antibody: Rabbit anti-human IgA antibody labeled with horseradish peroxidase; (4) Reaction buffer (1×): 20 mM PBS containing 0.05% v / v Tween 20 and 0.05% w / v NaN3, pH 7.4; (5) Washing buffer (10×): 200mM PBS containing 0.5% v / v Tween20, pH 7.4; (6) Enzyme substrate solution: TMB colorimetric solution; (7) Termination solution: 0.5N hydrochloric acid solution.

6. The use of the human LAD-1 IgA autoantibody ELISA detection kit according to any one of claims 1-5 in the preparation of reagents for detecting LAD-1 IgA autoantibodies.

7. The use of the human LAD-1 IgA autoantibody ELISA detection kit according to any one of claims 1-5 in the preparation of reagents for diagnosing linear IgA bullous dermatosis (LABD).