A method for rapid preparation of three-dimensional self-assembled DNA crystals in a closed homogeneous system

Abstract

This invention belongs to the field of biotechnology and relates to a method for rapidly preparing three-dimensional self-assembled DNA crystals in a closed homogeneous system. The operation process of this invention is highly simplified, employing a "one-click annealing" mode. The reaction conditions are highly standardized, exhibiting excellent batch-to-batch reproducibility, and can stably obtain DNA crystals with regular morphology and uniform size, laying the foundation for subsequent large-scale preparation. More importantly, this strategy demonstrates good versatility and scalability, having been successfully validated on DNA structural motifs of different geometries and sizes (such as 2-turn and 4-turn stretched integral triangles). Its universality has been proven through two independent pathways: specific sequence design and chemical modification, indicating its potential to develop into a universal platform for DNA crystal construction.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a method for rapidly preparing three-dimensional self-assembled DNA crystals in a closed homogeneous system. Background Technology

[0002] DNA self-assembly technology, relying on the Watson-Crick base pairing principle, enables the bottom-up construction of complex nanostructures with atomic-level precision, marking a significant advancement in materials science and bioengineering. Among its many applications, DNA self-assembled crystals are particularly noteworthy. These crystals, composed of long-range ordered three-dimensional lattices formed by DNA motifs arranged periodically with sticky ends, exhibit programmable lattice parameters, pore sizes, and surface functions. These properties endow DNA self-assembled crystals with immense potential in fields such as nanophotonics, biomimetic catalysis, biosensing, and information technology.

[0003] However, despite its promising prospects, current mainstream DNA crystal preparation methods, such as the hanging drop and sitting drop methods, primarily rely on the principle of vapor diffusion to achieve the crystallization process (CN117384231A). Specifically, these methods require suspending DNA droplets above a high-concentration salt solution and creating a concentration gradient through slow evaporation, causing the DNA to reach a supersaturated state and crystallize. Unfortunately, this method has significant drawbacks: firstly, the entire crystallization process is extremely time-consuming, typically requiring 3 to 15 days; secondly, the presence of the gas-liquid interface and the uncontrollable concentration gradient lead to random crystal nucleation and growth, resulting in inconsistent product morphology and a wide size distribution; furthermore, the operation is cumbersome and difficult to achieve in batches and uniform preparation. Although some studies have attempted to improve crystallization quality through sequence chemical modification or physical confinement methods (CN119980475B), these efforts have failed to fundamentally solve the problem of heterogeneous concentration gradients, limiting basic research and practical applications of DNA crystals.

[0004] Meanwhile, in the fabrication of size-constrained DNA nanostructures (such as DNA origami), closed homogeneous annealing in test tubes has become the standard procedure. This method offers advantages such as system homogeneity, controllable conditions, and suitability for folding structures of limited size. However, for self-assembly processes requiring infinite periodic growth to form macroscopic crystals, traditional homogeneous annealing is considered insufficient. Therefore, developing a new method that enables rapid and controllable DNA crystal assembly in a homogeneous solution has become a key challenge driving progress in this field. Summary of the Invention

[0005] The purpose of this invention is to address the shortcomings of existing technologies, such as reliance on vapor diffusion, uncontrollable processes, and long processing times, by proposing a method for preparing three-dimensional self-assembled DNA crystals in a closed homogeneous system. This method is simple to operate, highly reproducible, can significantly shorten the preparation cycle, and can achieve control over crystal morphology and size.

[0006] The objective of this invention can be achieved through the following technical solutions:

[0007] A method for rapidly preparing three-dimensional self-assembled DNA crystals in a closed homogeneous system, the method comprising the following steps: combining DNA structural units in a buffer solution containing cations and / or positively charged compounds for closed mixing to obtain a mixture, and then performing gradient annealing for 1 min to 24 h;

[0008] DNA structural unit assembly is a combination of DNA structural units that achieve self-assembly through sequence design and / or chemical modification;

[0009] The sequence-designed DNA structural unit combinations include at least one of the following: DNA structural unit combinations forming a 2-turn tensile overall triangle, DNA structural unit combinations forming a 4-turn tensile overall triangle, DNA structural unit combinations forming a 3-turn tensile overall triangle, DNA square structural unit, double-cross DXL crystal structural unit, hexagonal arrangement structural unit based on tensile overall triangle, 13-mer structural unit, 8-nt structural unit, hexagonal structural unit and its derivative structures, hexagonal reconstructed crystal, amphiphilic DNA structural unit, DNA origami crystal structural unit and its derivative structures;

[0010] The chemically modified DNA structural unit combination specifically refers to chemical modification of the sticky ends of the DNA structural unit combination, including: phosphorylation modification, nucleic acid backbone thiophosphate modification, methylation modification, locked nucleic acid modification, peptide nucleic acid modification, 2'-O-methyl, 2'-fluorine, uracil, halogen substitution, and at least one of these.

[0011] In the above-mentioned method for preparing three-dimensional self-assembled DNA crystals in a closed homogeneous system, the DNA structural unit combination designed by sequence includes one of the following: a DNA structural unit combination that forms a 2-turn tensile overall triangle and a DNA structural unit combination that forms a 4-turn tensile overall triangle.

[0012] The DNA structural units that make up the 2-turn stretched overall triangle are: the S strand shown in SEQ ID NO.1, the M strand shown in SEQ ID NO.2, and the L strand shown in SEQ ID NO.3;

[0013] The DNA structural units that form a 2-turn stretched overall triangle are: the S strand shown in SEQ ID NO.4, the M strand shown in SEQ ID NO.5, and the L strand shown in SEQ ID NO.6;

[0014] And / or the DNA structural units that form a 2-turn stretched overall triangle are: the S strand shown in SEQ ID NO.7, the M strand shown in SEQ ID NO.8, and the L strand shown in SEQ ID NO.6;

[0015] The DNA structural units that form a 4-turn stretched triangular structure are: the S strand shown in SEQ ID NO. 9, the M strand shown in SEQ ID NO. 10, and the L strand shown in SEQ ID NO. 11.

[0016] Preferably, the DNA structural unit combination designed by sequence is a combination of DNA structural units that form a 2-turn stretched overall triangle, specifically: the S chain shown in SEQ ID NO.1, the M chain shown in SEQ ID NO.2, and the L chain shown in SEQ ID NO.3.

[0017] This invention enhances self-assembly performance by regulating the base composition of DNA sequences. Through systematic adjustment of these sequence composition parameters, it achieves fine-tuning of the DNA programming sequence, thereby significantly promoting rapid and orderly crystal assembly under closed homogeneous conditions. Compared to conventionally designed 2-turn sequences, which lack sufficient structural guidance and interaction driving forces due to unoptimized base composition and are difficult to form highly ordered lattice structures in a short time, this invention effectively enhances molecular recognition ability and crystallization tendency by increasing CG content and balancing purine / pyrimidine distribution. Ultimately, it achieves efficient completion of the DNA crystal self-assembly process without the need for external templates or complex environmental interventions. Compared to the traditional self-assembly process that takes 3-15 days, this invention can complete the process in as little as 2 hours. Moreover, compared to DNA crystals prepared by conventional methods, the DNA crystals prepared by this invention show significant improvements in size uniformity and batch reproducibility.

[0018] Preferably, the chemically modified DNA structural unit combination specifically involves 5'-phosphorylation modification or thiophosphate backbone modification at the sticky ends of the DNA structural unit combination.

[0019] Further preferably, the chemically modified DNA structural unit combination specifically involves 5'-phosphorylation modification of the sticky ends of the structural unit combination that forms the 4-turn stretched overall triangle.

[0020] In the above-mentioned method for preparing three-dimensional self-assembled DNA crystals in a closed homogeneous system, the chemically modified DNA structural unit combination specifically involves 5'-phosphorylation modification at the sticky ends of the DNA structural unit combination. The 5'-phosphorylated DNA structural unit combination is as follows:

[0021] Modify the S chain shown in SEQ ID NO.9:

[0022] pTCTTTTGAGTCAGTGGCAGTGTTTT;

[0023] Modify the M chain shown in SEQ ID NO.10:

[0024] pGAAAAACACTGCCTGAATACCGCATCGTGGACTGACTCAAAA;

[0025] The L-chain shown in SEQ ID NO.11:

[0026] CGGTATTCACCACGATGCGGTATTCACCACGATGCGGTATTCACCACGATG;

[0027] Where p represents the 5'-phosphorylated site at the sticky end.

[0028] This invention significantly enhances molecular recognition and adhesion between sticky ends of a specific DNA sequence by modifying it with 5'-phosphorylation at specific sites. This modification introduces a negatively charged phosphate group at the 5' end of the sticky end, which not only enhances the pairing specificity with the complementary chain's 3'-hydroxyl group at both spatial and electrostatic levels, but also provides a chemical basis for subsequent possible linker reactions or metal-ion-mediated interactions. This enhanced end interaction effectively promotes the formation and stabilization of crystal nuclei, thereby significantly accelerating the overall crystallization kinetics. More importantly, 5'-phosphorylation imparts higher directionality and order to the assembly system, allowing crystals to preferentially grow along specific crystal axes, thus achieving preliminary controllable adjustment of the rhombic crystal morphology.

[0029] In the above-mentioned method for preparing three-dimensional self-assembled DNA crystals in a closed homogeneous system, the chemically modified DNA structural unit combination specifically refers to DNA structural units modified with phosphate thioesters. The DNA structural unit combination modified with the phosphate thioester backbone is as follows:

[0030] Modify the S chain shown in SEQ ID NO.9:

[0031] TsCTTTTGAGTCAGTGGCAGTGTTTsT;

[0032] Modify the M chain shown in SEQ ID NO.10:

[0033] GsAAAAACACTGCCTGAATACCGCATCGTGGACTGACTCAAAsA;

[0034] Modify the L-chain shown in SEQ ID NO.11:

[0035] CsGGTATTCACCACGATGCGGTATTCACCACGATGCGGTATTCACCACGATsG;

[0036] Where 's' represents the site of thiophosphate modification.

[0037] This invention modifies the phosphate thioester backbone at specific sites within a specific DNA sequence, replacing a non-bridging oxygen atom in the phosphodiester bond with a sulfur atom. This alters the electron distribution, stereochemistry, and hydrophilicity / hydrophobicity of the nucleic acid backbone. This modification not only significantly enhances the oligonucleotide's resistance to nuclease degradation but also plays a crucial role in fine-tuning the self-assembly process. On one hand, the lower electronegativity of sulfur compared to oxygen leads to a decrease in the local negative charge density of the phosphate backbone, weakening the electrostatic repulsion and hydrogen bonding synergistic effect between terminal base pairs, thus slightly reducing the terminal binding strength. On the other hand, this kinetic "deceleration" effect slows down the initial nucleation rate, making the crystal formation process more controllable. The shift from rapid, mass nucleation to preferential growth of a few nuclei in crystal growth helps obtain larger, more uniform crystals, thereby influencing the final crystal size distribution and crystal quality.

[0038] In the above method for preparing three-dimensional self-assembled DNA crystals in a closed homogeneous system, the molar ratio of S chain, M chain and L chain is (2-5):(2-5):1.

[0039] In the above-mentioned method for preparing three-dimensional self-assembled DNA crystals in a closed homogeneous system, the concentration of cations and / or positively charged compounds in the buffer solution is 0.01-100 mM.

[0040] In the aforementioned method for preparing three-dimensional self-assembled DNA crystals in a closed homogeneous system, the cation-containing compounds include those containing Na. + Li + K + Mg 2+ Ca 2+ 、Sr 2+ Ni 2+ At least one of the metal salt compounds;

[0041] And / or positively charged compounds include at least one of spermidine, spermine, ethylenediamine, formamide, urea, and polyamine derivatives containing azophenyl groups.

[0042] Preferably, the cation is Mg. 2+ .

[0043] Further preferred, the buffer solution contains Mg 2+ TAE buffer containing Mg 2+ The TAE buffer has a pH of 7.5-8.5 and includes: 30-50 mM Tris base, 10-30 mM acetic acid, 1-5 mM ethylenediaminetetraacetic acid (EDTA) and 10-30 mM magnesium acetate.

[0044] In the above-mentioned method for preparing three-dimensional self-assembled DNA crystals in a closed homogeneous system, the concentration of DNA structural unit combinations in the mixture is 1-40 μM.

[0045] Preferably, the closed mixing is carried out in a sealed container, which includes one of the following: PCR tubes, centrifuge tubes, microplates, and beakers.

[0046] In the above-mentioned method for preparing three-dimensional self-assembled DNA crystals in a closed homogeneous system, gradient annealing includes: reducing the temperature from an initial temperature of 50-95℃ to 0-40℃ at an average rate of 0.5-5℃ / min.

[0047] Preferably, gradient annealing includes: starting from 70-90℃, cooling to 20-25℃ at an average rate of 0.1-0.5℃ / min, for a total time of 5-15h;

[0048] Alternatively, the temperature can be lowered from 60-65℃ to 40-50℃ at an average rate of 0.3-0.8℃ / min, and then further lowered to 20-30℃ at an average rate of 0.1-0.2℃ / min, for a total time of 1-5 hours.

[0049] The present invention also provides a three-dimensional self-assembled DNA crystal, which is prepared by the above method. The three-dimensional self-assembled DNA crystal has a size of 100 nm-1 mm, a coefficient of variation of <22%, and has a three-dimensional periodic ordered structure with regular morphology and uniform size distribution.

[0050] The present invention also provides an application of the above-mentioned three-dimensional self-assembled DNA crystal in the preparation of nanophotonic devices, biosensors, biomimetic catalytic carriers, drug delivery or information storage media.

[0051] Compared with the prior art, the present invention has the following beneficial effects:

[0052] 1. This invention significantly shortens the crystallization cycle of traditional vapor-diffusion-dependent hanging drop or sitting drop methods from 3 to 15 days to just a few hours (as short as 2 hours), improving assembly efficiency by more than an order of magnitude and greatly accelerating the experimental process and material screening. Secondly, this method is carried out in a closed, homogeneous solution phase, completely eliminating the interference caused by the gas-liquid interface and uncontrollable concentration gradients in traditional methods. This makes the entire self-assembly system more stable, thereby enabling precise control of the crystal nucleation and growth process and significantly improving product quality.

[0053] 2. This invention features a highly simplified operation process, employing a "one-click annealing" mode. The reaction conditions are highly standardized, exhibiting excellent batch-to-batch reproducibility. It can stably obtain DNA crystals with regular morphology and uniform size, laying the foundation for subsequent large-scale preparation. More importantly, this strategy demonstrates good versatility and scalability, having been successfully validated on DNA structural motifs of different geometries and sizes (such as 2-turn and 4-turn stretched integral triangles). Its universality has been proven through two independent pathways: specific sequence design and chemical modification, indicating its potential to develop into a universal platform for DNA crystal construction.

[0054] 3. The high-quality, long-range ordered DNA crystals obtained by this invention can serve as ideal templates or scaffolds for loading functional molecules, guiding the arrangement of inorganic nanoparticles, or constructing composite functional materials, providing solid support for cutting-edge applications such as nanophotonics, biosensing, and targeted drug delivery, and have broad industrialization prospects. Attached Figure Description

[0055] Figure 1 Examples 1-3 and Comparative Example 1 illustrate the assembly of DNA crystals in a homogeneous solution system via sequence control. (a) Schematic diagram of 2-turn DNA tensile monolithic triangular crystal assembly achieved by thermal annealing in a sealed test tube. (b) 2-turn (Δ 2T -1) Structural unit. (c) Δ reduction of CG content in M ​​and S chains. 2T -2 mode. (d) Assembly time required by the vapor diffusion (VD) method exceeds 24 hours, while assembly by the test tube method requires only 2 hours. (e, f) Δ obtained by the test tube or vapor diffusion method 2T -2. Size distribution and coefficient of variation (CV) of the hexagonal crystals obtained. (g) Δ values ​​of increasing pyrimidine content in the M chain and increasing purine content in the S chain. 2T -3 mode. (h, i) via Δ 2T -3. Size distribution and CV of the rhombohedral crystal obtained. (j) Optimized Δ 2T -4 structural units, modifying the base composition in the L, M, and S chains. (k, l)Δ 2T -4 Crystal size distribution and CV. Scale bar: 50 μm.

[0056] Figure 2 Example 4 illustrates the self-assembly of DNA crystals achieved through viscous end 5'-phosphorylation modification in a homogeneous solution system. (a) 4-turn stretching of the overall triangle (Δ 4T (b) 5'-phosphorylation modified Δ 4T Structural patterns. Left: Sequence design strategy; Right: Representative optical and polarization microscopic images. Scale bar: 50 μm. (c, d) Size distribution and cyclic voltammograms of 5'-phosphorylated DNA crystals obtained by tube or VD crystallization. (e) Structural characterization by negative staining transmission electron microscopy: low-magnification image (left), magnified view of the ordered lattice (top), fast Fourier transform (FFT) of the transmission electron microscopy image (bottom), scale bar: 50 nm.

[0057] Figure 3 Example 5 describes the self-assembly of DNA crystals by modifying the sticky end backbone with phosphorylation (PS) in a homogeneous solution system; (a) a PS-modified Δ 4T (a) Schematic diagram of DNA-stretched triangular phantom; (b) PS-modified Δ 4T Representative polarized light microscopy images of DNA crystals, scale bar: 100 μm; (c, d) Size distribution and coefficient of variation of PS-modified DNA crystals obtained by the tube method or VD method, scale bar: 100 μm.

[0058] Figure 4 DNA crystal assembly in a homogeneous system exhibits excellent batch-to-batch reproducibility. (a) Δ from three independent batches 2T Representative polarization microscopy images of -4 DNA crystals, scale bar: 50 μm; (b, c) from three independent batches of Δ 2T -4. Size distribution and coefficient of variation of DNA crystals. Detailed Implementation

[0059] The following are specific embodiments of the present invention, which further describe the technical solution of the present invention, but the present invention is not limited to these embodiments.

[0060] Example 1:

[0061] S1. DNA Sequence Design: The classic 2-turn stretched overall triangle (Δ) is selected. 2T ) Structural units (such as the 2T7 sequence reported in the literature, denoted as Δ) 2T -1) serves as the initial model. Through bioinformatics analysis, the sequences of its side chains (M), cross chains (S), and central chains (L) are rationally redesigned to obtain the optimized sequence Δ. 2T -4.

[0062] The DNA motifs that make up the 2-turn tensile triangular structural unit are as follows:

[0063] The S4 chain shown in SEQ ID NO.1: TCTTCTGTGGTCTT;

[0064] The M4 chain shown in SEQ ID NO.2: GAAAGACCTGCGCGGACAGAA;

[0065] The L4 chain shown in SEQ ID NO.3: CGCACCGCGCACCGCGCACCG.

[0066] S2. Mix the central chain L, side chain M, and cross chain S in a molar ratio of 1:3:3, and dissolve an equal volume of the mixture in 1×TAE / Mg solution. 2+ The final concentration of DNA structural units was 10 μM in the buffer solution [40 mM Tris base (pH 8.0), 20 mM acetic acid, 2 mM EDTA and 25 mM magnesium acetate].

[0067] S3. Aliquot the above mixed solution into 200μL thin-walled PCR tubes and place them in a thermal cycler. Perform the annealing program: 95℃ for 5 min, 90℃ for 5 min, 85℃ for 5 min, 80℃ for 5 min, 75℃ for 5 min, 70℃ for 5 min, 65℃ for 5 min, 60℃ for 5 min, 55℃ for 5 min, 50℃ for 5 min, 45℃ for 5 min, 40℃ for 5 min, 35℃ for 10 min, 30℃ for 20 min, 25℃ for 30 min, and finally cool down to 22℃.

[0068] Example 2:

[0069] S1. DNA Sequence Design: The classic 2-turn stretched overall triangle (Δ) is selected. 2T ) Structural units (such as the 2T7 sequence reported in the literature, denoted as Δ) 2T -1) serves as the initial model. Through bioinformatics analysis, the sequences of its side chains (M) and cross chains (S) are rationally redesigned to obtain the optimized sequence Δ. 2T -2.

[0070] The DNA motifs that make up the 2-turn tensile triangular structural unit are as follows:

[0071] The S2 chain shown in SEQ ID NO.4: TCTGATTGTGGAGAA, the M2 chain shown in SEQ ID NO.5: GATTCTCCTGTACGGACATCA, and the L chain shown in SEQ ID NO.6: ACACCGTACACCGTACACCGT.

[0072] S2. Mix the central chain L, side chain M, and cross chain S in a molar ratio of 1:3:3, and dissolve an equal volume of the mixture in 1×TAE / Mg solution. 2+ The final concentration of DNA structural units was 10 μM in the buffer solution [40 mM Tris base (pH 8.0), 20 mM acetic acid, 2 mM EDTA and 25 mM magnesium acetate].

[0073] S3. Aliquot the above mixed solution into 200μL thin-walled PCR tubes and place them in a thermal cycler. Perform the annealing program: 95℃ for 5 min, 90℃ for 5 min, 85℃ for 5 min, 80℃ for 5 min, 75℃ for 5 min, 70℃ for 5 min, 65℃ for 5 min, 60℃ for 5 min, 55℃ for 5 min, 50℃ for 5 min, 45℃ for 5 min, 40℃ for 5 min, 35℃ for 10 min, 30℃ for 20 min, 25℃ for 30 min, and finally cool down to 22℃.

[0074] Example 3:

[0075] S1. DNA Sequence Design: The classic 2-turn stretched overall triangle (Δ) is selected. 2T ) Structural units (such as the 2T7 sequence reported in the literature, denoted as Δ) 2T -1) serves as the initial model. Through bioinformatics analysis, the sequences of its side chains (M) and cross chains (S) are rationally redesigned to obtain the optimized sequence Δ. 2T -3.

[0076] The DNA motifs that make up the 2-turn tensile triangular structural unit are as follows:

[0077] The S3 chain shown in SEQ ID NO.7: AGAGATGTGGAGAA, the M3 chain shown in SEQ ID NO.8: CTTTCTCCTGTACGGACATCT, and the L chain shown in SEQ ID NO.6: ACACCGTACACCGTACACCGT.

[0078] S2. Mix the central chain L, side chain M, and cross chain S in a molar ratio of 1:3:3, and dissolve an equal volume of the mixture in 1×TAE / Mg solution. 2+The final concentration of DNA structural units was 10 μM in the buffer solution [40 mM Tris base (pH 8.0), 20 mM acetic acid, 2 mM EDTA and 25 mM magnesium acetate].

[0079] S3. Aliquot the above mixed solution into 200μL thin-walled PCR tubes and place them in a thermal cycler. Perform the annealing program: 95℃ for 5 min, 90℃ for 5 min, 85℃ for 5 min, 80℃ for 5 min, 75℃ for 5 min, 70℃ for 5 min, 65℃ for 5 min, 60℃ for 5 min, 55℃ for 5 min, 50℃ for 5 min, 45℃ for 5 min, 40℃ for 5 min, 35℃ for 10 min, 30℃ for 20 min, 25℃ for 30 min, and finally cool down to 22℃.

[0080] Example 4:

[0081] S1. DNA Sequence Design: Selecting a 4-turn stretched overall triangle (Δ) 4T The structural unit, wherein the DNA motifs that make up the 4-turn tensile overall triangular structural unit are:

[0082] The S-chain shown in SEQ ID NO.9: TCTTTTGAGTCAGTGGCAGTGTTTT;

[0083] The M chain shown in SEQ ID NO.10:

[0084] GAAAAACACTGCCTGAATACCGCATCGTGGACTGACTCAAAA;

[0085] The L-chain shown in SEQ ID NO.11:

[0086] CGGTATTCACCACGATGCGGTATTCACCACGATGCGGTATTCACCACGATG.

[0087] Phosphorylation (5'-Phos) of the sticky ends of the S and M strands yielded the following DNA motifs that form a 4-turn tensile triangular structural unit:

[0088] S chain: pTCTTTTGAGTCAGTGGCAGTGTTTT;

[0089] M-Chain:

[0090] pGAAAAACACTGCCTGAATACCGCATCGTGGACTGACTCAAAA;

[0091] L-chain:

[0092] CGGTATTCACCACGATGCGGTATTCACCACGATGCGGTATTCACCACGATG;

[0093] Where p represents the 5'-phosphorylated site on the sticky end.

[0094] S2. Mix the central chain L, side chain M, and cross chain S in a molar ratio of 1:3:3, and dissolve an equal volume of the mixture in 1×TAE / Mg solution. 2+ The final concentration of DNA structural units was 100 nM in the buffer solution [40 mM Tris base (pH 8.0), 20 mM acetic acid, 2 mM EDTA and 25 mM magnesium acetate].

[0095] S3. Aliquot the above mixed solution into 200μL thin-walled PCR tubes and place them in a thermal cycler. Perform the annealing program: reduce the temperature from 65℃ to 45℃ at a rate of 0.5℃ / min, and then reduce it to 22℃ at a rate of 0.1℃ / min, for a total time of approximately 2 hours.

[0096] Example 5:

[0097] S1. DNA Sequence Design: Selecting a 4-turn stretched overall triangle (Δ) 4T The structural unit, wherein the DNA motifs that make up the 4-turn tensile overall triangular structural unit are:

[0098] The S-chain shown in SEQ ID NO.9: TCTTTTGAGTCAGTGGCAGTGTTTT;

[0099] The M chain shown in SEQ ID NO.10:

[0100] GAAAAACACTGCCTGAATACCGCATCGTGGACTGACTCAAAA;

[0101] The L-chain shown in SEQ ID NO.11:

[0102] CGGTATTCACCACGATGCGGTATTCACCACGATGCGGTATTCACCACGATG.

[0103] Introducing phosphate thioester (PS) modifications to the 5'-end sticky ends of the S, M, and L strands yielded the following DNA motifs that form 4-turn tensile triangular structural units:

[0104] S chain: TsCTTTTGAGTCAGTGGCAGTGTTTsT;

[0105] M-Chain:

[0106] GsAAAAACACTGCCTGAATACCGCATCGTGGACTGACTCAAAsA;

[0107] L-chain:

[0108] CsGGTATTCACCACGATGCGGTATTCACCACGATGCGGTATTCACCACGATsG;

[0109] Where 's' represents the site on the nucleic acid backbone that has been modified with thiophosphate.

[0110] S2. Mix the central chain L, side chain M, and cross chain S in a molar ratio of 1:3:3, and dissolve an equal volume of the mixture in 1×TAE / Mg solution. 2+ The final concentration of DNA structural units was 30 μM in the buffer solution [40 mM Tris base (pH 8.0), 20 mM acetic acid, 2 mM EDTA and 25 mM magnesium acetate].

[0111] S3. Aliquot the above mixed solution into 200μL thin-walled PCR tubes and place them in a thermal cycler. Perform the annealing program: cool from 95℃ to 22℃ at a rate of 0.1℃ / min for a total time of approximately 24 hours.

[0112] In Δ 4T Phosphothioester backbone (PS) modifications were introduced onto specific sticky end chains of the structural units. Since PS modification may delay hybridization, the total DNA concentration was appropriately increased to 30 μM, and the annealing time was prolonged. Large rhombic crystals were observed to form after annealing. Statistical analysis of the crystal size (n>60) showed that the average crystal size reached 81.08 ± 29.7 μm, demonstrating the method's ability to prepare large crystals.

[0113] Example 6:

[0114] The only difference from Example 1 is that the final concentration of the DNA structural units is 100 μM.

[0115] In Example 6, the final concentration of DNA was increased to 100 μM. Although crystals could be formed, the size of the crystals was significantly reduced, and they often exhibited defects such as polycrystalline, fragmented, or irregular morphology. This was mainly due to the excessive number of nucleation sites at high concentrations, which led to a large number of tiny crystal nuclei competing for growth and making it impossible to form an ordered and complete single crystal structure.

[0116] Example 7:

[0117] The only difference from Example 1 is that the final concentration of DNA structural units is 50 nM.

[0118] Example 7 reduced the DNA concentration to 50 nM, which is far below the effective assembly threshold. At this point, the molecular collision frequency is insufficient to overcome the nucleation energy barrier, and crystallization cannot be induced at all.

[0119] Comparative Example 1:

[0120] S1, DNA Sequence Design: Selection Figure 1 -b shows the classic 2-turn tensioned integral triangle (Δ) 2T ) Structural units (such as the 2T7 sequence reported in the literature, denoted as Δ) 2T -1) as the starting model.

[0121] S2. Mix the central chain L, side chain M, and cross chain S in a molar ratio of 1:3:3, and dissolve an equal volume of the mixture in 1×TAE / Mg solution. 2+ The final concentration of DNA structural units was 10 μM in the buffer solution (40 mM Tris base (pH 8.0), 20 mM acetic acid, 2 mM EDTA and 25 mM magnesium acetate).

[0122] S3. Aliquot the above mixed solution into 200μL thin-walled PCR tubes and place them in a thermal cycler. Perform the annealing program: 95℃ for 5 min, 90℃ for 5 min, 85℃ for 5 min, 80℃ for 5 min, 75℃ for 5 min, 70℃ for 5 min, 65℃ for 5 min, 60℃ for 5 min, 55℃ for 5 min, 50℃ for 5 min, 45℃ for 5 min, 40℃ for 5 min, 35℃ for 10 min, 30℃ for 20 min, 25℃ for 30 min, and finally cool down to 22℃.

[0123] Comparative Example 2:

[0124] Traditional vapor diffusion crystallization: Δ 2T DNA sequences are obtained by passing the corresponding strand at 1×TAE / Mg. 2+ Mix in buffer. Then add 5 μL of the solution to the drop plate and grow for 2 days at room temperature in 1.6 mol / L (NH4)2SO4 growth buffer by drop method.

[0125] Comparative Example 3:

[0126] The difference between Example 4 and Example 5 is that no modifications are made to the three chains: the S chain shown in SEQ ID NO. 9, the M chain shown in SEQ ID NO. 10, and the L chain shown in SEQ ID NO. 11.

[0127] Comparative Example 3 did not form regular crystals under homogeneous conditions.

[0128] Comparative Example 4:

[0129] The only difference from Example 4 is that the S chain was not modified with 5'-phosphorylation in step S1.

[0130] Comparative Example 5:

[0131] The only difference from Example 4 is that the M chain was not modified with 5'-phosphorylation in step S1.

[0132] Comparative Example 6:

[0133] The only difference from Example 5 is that step S1 did not modify the S chain with a thiophosphate backbone.

[0134] Comparative Example 7:

[0135] The only difference from Example 5 is that the M chain was not modified with a thiophosphate backbone in step S1.

[0136] Comparative Example 8:

[0137] The only difference from Example 5 is that the L chain was not modified with a thiophosphate backbone in step S1.

[0138] Table 1: DNA sequences used for DNA crystal preparation

[0139]

[0140]

[0141] Where “p” represents a site on the sticky end that has been modified by 5'-phosphorylation; and “s” represents a site on the nucleic acid backbone that has been modified by thiophosphate.

[0142] Comparative Examples 4 and 5 all showed a significant decrease in crystal nucleation efficiency, slow crystal growth and irregular morphology, and the inability to form macroscopic crystals visible to the naked eye. This indicates that the 5'-phosphate group is crucial for promoting sticky end hybridization of the sequence. Its deletion weakens the end adhesion effect and makes it difficult to effectively guide the formation of ordered lattices.

[0143] Comparative Examples 6-8 removed the thiophosphate backbone modification of the S chain, M chain, or L chain, respectively. The results showed that the crystal size was significantly reduced and the integrity was worse. This is attributed to the fact that the PS modification slowed down the initial nucleation rate, making the crystal nucleation process more controllable. The crystal growth shifted from rapid nucleation of a large number of crystals to preferential growth of a few crystal nuclei, which helps to obtain larger crystals with higher uniformity.

[0144] Figure 1Examples 1-3 and Comparative Example 1 illustrate the assembly of DNA crystals in a homogeneous solution system via sequence control. (a) Schematic diagram of 2-turn DNA tensile monolithic triangular crystal assembly achieved by thermal annealing in a sealed test tube. (b) 2-turn (Δ 2T -1) Structural unit. (c) Δ reduction of CG content in M ​​and S chains. 2T -2 mode. (d) Assembly time required by the vapor diffusion (VD) method exceeds 24 hours, while assembly by the test tube method requires only 2 hours. (e, f) Δ obtained by the test tube or vapor diffusion method 2T -2. Size distribution and coefficient of variation (CV) of the hexagonal crystals obtained. (g) Δ values ​​of increasing pyrimidine content in the M chain and increasing purine content in the S chain. 2T -3 mode. (h, i) via Δ 2T -3. Size distribution and CV of the rhombohedral crystal obtained. (j) Optimized Δ 2T -4 structural units, modifying the base composition in the L, M, and S chains. (k, l)Δ 2T -4 Crystal size distribution and CV. Scale bar: 50 μm.

[0145] In Comparative Example 1, Δ 2T Group -1 did not form regular crystals under homogeneous conditions, and in Example 2, Δ 2T -2 groups successfully assembled a large number of regular hexagonal crystals. Using image processing software, the diagonal length of over 100 crystals was randomly measured, and the average size was found to be 15.38 ± 3.98 μm, with a size distribution coefficient of variation (CV) of 25.87%. Using the same DNA solution, Comparative Example 2 crystallized at 20°C for 3 days using the traditional hanging drop or sitting drop method, resulting in crystals with a wider size distribution (17.7 ± 11.97 μm, CV = 67.55%), demonstrating the advantage of the homogeneous method in controlling size distribution. This invention further optimizes sequence design. In Δ 2T Based on the motif sequence -2, this invention increases the pyrimidine (C / T) content in the M3 chain to 9.53%, and simultaneously increases the purine (A / G) content in the S3 chain to 14.28%. In the improved Example 3, Δ 2T -3 sequence successfully induced the formation of rhombohedral crystals in a homogeneous system ( Figure 1 g), but hexagonal crystals still exist. Statistical analysis of rhombic crystals (n>100) showed that their average size was 13.46 ± 3.81 μm (CV = 28.27%), and their uniformity was significantly better than the sitting drop method control group (36.15 ± 27.91 μm, CV = 77.21%) (Figures 1h, 1i). Finally, this invention, through triple sequence optimization, used the Δ of Example 1 2T-4 sequences achieve optimal performance, based on Δ 2T -1 This invention increases the CG base content in L4 to 28.57%, the purine content in M4 to 14.29%, and the pyrimidine content in S4 to 21.43%. After 2 hours of gradient annealing, the sequence forms regularly shaped rhombohedral crystals ( Figure 1 The average size of the crystals (j) was 12.92 ± 2.76 μm (coefficient of variation = 21.36%) (Figures 1k and 1l). Although the sitting drop method can also produce similar crystals, its size distribution (25.07 ± 9.37 μm, coefficient of variation = 37.36%) and crystallization time (>24 hours) are significantly inferior to those of the homogeneous system. The results demonstrate that, through precise sequence design, this invention achieves rapid assembly of relatively uniformly sized DNA crystals under homogeneous conditions in test tubes.

[0146] Figure 2 To achieve self-assembly of DNA crystals by performing sticky end 5'-phosphorylation modification in a homogeneous solution system. (a) 4-turn stretching of the overall triangle (Δ 4T (a) Δ4T structural pattern with 5'-phosphorylation modification. Left: Sequence design strategy; Right: Representative optical and polarization microscopic images. Scale bar: 50 μm (c, d) Size distribution and coefficient of variation of 5'-phosphorylated DNA crystals obtained by tube or VD crystallization. (e) Structural characterization by negative staining transmission electron microscopy: low-magnification image (left), magnified view of ordered lattice (top), fast Fourier transform (FFT) of transmission electron microscopy image (bottom). Scale bar: 50 nm. It can be seen that this invention successfully extends the homogeneous assembly strategy to more complex DNA crystal systems by appropriately chemically modifying large-size building blocks.

[0147] The 5'-phosphorylation modification group successfully assembled regular rhombic plate-like crystals. Statistical analysis showed that the average crystal length was 21.95 ± 2.58 μm, with a CV value as low as 11.77%, exhibiting excellent dimensional uniformity. A small sample of the crystal was negatively stained and observed using a high-resolution transmission electron microscope (HR-TEM). HR-TEM images revealed a clear, highly ordered periodic lattice arrangement, and fast Fourier transform yielded sharp diffraction spots. The results indicate that these motifs exhibit a highly ordered periodic arrangement within the crystal.

[0148] Figure 3 To synthesize large-sized DNA crystals in a homogeneous solution system using a phosphosulfate (PS)-modified backbone. (a) A PS-modified Δ 4T Schematic diagram of a DNA-stretched triangular phantom. (b) PS-modified Δ 4TRepresentative polarized light microscopy images of DNA crystals. Scale bar: 100 μm. (c, d) Size distribution and coefficient of variation of PS-modified DNA crystals obtained by the tube method or VD method. Scale bar: 100 μm. It can be seen that this invention, through modification of DNA motifs with phosphate thioesters, successfully achieved the controllable preparation of large-size DNA crystals in a homogeneous liquid phase environment, further expanding the applicability of this strategy.

[0149] Figure 4 In a homogeneous system, DNA crystal assembly exhibits excellent batch-to-batch reproducibility. (a) Δ from three independent batches 2T Representative polarization microscopy images of -4 DNA crystals. Scale bar: 50 μm. (b, c) from three independent batches. 2T -4. Size distribution and coefficient of variation of DNA crystals. All samples successfully generated crystals with consistent morphology. Quantitative statistical analysis of crystal size showed that the average sizes of the three independent batches were 13.29±1.99 μm, 13.59±2.14 μm, and 13.08±2.42 μm, respectively, with corresponding coefficients of variation (CV) remaining in a low range of 14.94%-18.49%. The results indicate that the homogeneous liquid-phase assembly system established in this invention possesses excellent stability and batch-to-batch reproducibility. Quantitative analysis demonstrates that this method has excellent batch-to-batch reproducibility, meeting the requirements for controllable preparation.

[0150] In summary, this invention features a highly simplified operational process, employing a "one-click annealing" mode. The reaction conditions are highly standardized, exhibiting excellent batch-to-batch reproducibility, and can stably produce DNA crystals with regular morphology and uniform size, laying the foundation for subsequent large-scale preparation. More importantly, this strategy demonstrates good versatility and scalability, having been successfully validated on DNA structural motifs of different geometries and sizes (such as 2-turn and 4-turn stretched integral triangles). Its universality has been proven through two independent pathways: specific sequence design and chemical modification, indicating its potential to develop into a universal platform for DNA crystal construction.

[0151] The embodiments described herein cover any points not exhaustively within the scope of the technical claims of this invention, as well as new technical solutions formed by equivalent substitutions of one or more technical features in the embodiments. These are all within the scope of the claims of this invention. Furthermore, in all listed or unlisted embodiments of this invention, each parameter in the same embodiment merely represents an instance (i.e., a feasible solution) of its technical solution, and there is no strict coordination or limitation relationship between the parameters. The parameters can be substituted for each other without violating axioms and the claims of this invention, unless otherwise stated.

[0152] The technical means disclosed in this invention are not limited to those described above, but also include technical solutions composed of any combination of the above technical features. The above descriptions are specific embodiments of this invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of this invention, and these improvements and modifications are also considered within the scope of protection of this invention.

[0153] The specific embodiments described herein are merely illustrative of the spirit of the invention. Those skilled in the art to which this invention pertains may make various modifications or additions to the described specific embodiments or use similar methods to substitute them, without departing from the spirit of the invention or exceeding the scope defined by the appended claims.

Claims

1. A method for rapidly preparing three-dimensional self-assembled DNA crystals in a closed homogeneous system, characterized in that, The method includes the following steps: combining DNA structural units in a buffer solution containing cations and / or positively charged compounds for blocking and mixing to obtain a mixture, and then performing gradient annealing for 1 min to 24 h; DNA structural unit assembly is a combination of DNA structural units that achieve self-assembly through sequence design and / or chemical modification; The sequence-designed DNA structural unit combinations include at least one of the following: DNA structural unit combinations forming a 2-turn tensile overall triangle, DNA structural unit combinations forming a 4-turn tensile overall triangle, DNA structural unit combinations forming a 3-turn tensile overall triangle, DNA square structural unit, double-cross DXL crystal structural unit, hexagonal arrangement structural unit based on tensile overall triangle, 13-mer structural unit, 8-nt structural unit, hexagonal structural unit and its derivative structures, hexagonal reconstructed crystal, amphiphilic DNA structural unit, DNA origami crystal structural unit and its derivative structures; The chemically modified DNA structural unit combination specifically refers to chemical modification of the sticky ends of the DNA structural unit combination, including: phosphorylation modification, nucleic acid backbone thiophosphate modification, methylation modification, locked nucleic acid modification, peptide nucleic acid modification, 2'-O-methyl, 2'-fluorine, uracil, halogen substitution, and at least one of these.

2. The method for rapidly preparing three-dimensional self-assembled DNA crystals in a closed homogeneous system according to claim 1, characterized in that, The sequence-designed DNA structural unit combination includes one of the following: a structural unit combination that forms a 2-turn tensile overall triangle and a structural unit combination that forms a 4-turn tensile overall triangle; The DNA structural units that make up the 2-turn stretched overall triangle are: the S strand shown in SEQ ID NO.1, the M strand shown in SEQ ID NO.2, and the L strand shown in SEQ ID NO.3; The DNA structural units that form a 2-turn stretched overall triangle are: the S strand shown in SEQ ID NO.4, the M strand shown in SEQ ID NO.5, and the L strand shown in SEQ ID NO.6; The DNA structural units that form a 2-turn stretched overall triangle are: the S strand shown in SEQ ID NO.7, the M strand shown in SEQ ID NO.8, and the L strand shown in SEQ ID NO.6; The DNA structural units that form a 4-turn stretched overall triangle are: the S strand shown in SEQ ID NO.9, the M strand shown in SEQ ID NO.10, and the L strand shown in SEQ ID NO.

11.

3. The method for rapidly preparing three-dimensional self-assembled DNA crystals in a closed homogeneous system according to claim 1, characterized in that, Specifically, the chemically modified DNA structural unit combination involves 5'-phosphorylation modification at the sticky ends of the DNA structural unit combination. The DNA structural unit combination undergoing 5'-phosphorylation modification is as follows: Modify the S chain shown in SEQ ID NO.9: pTCTTTTGAGTCAGTGGCAGTGTTTT; Modify the M chain shown in SEQ ID NO.10: pGAAAAACACTGCCTGAATACCGCATCGTGGACTGACTCAAAA; The L-chain shown in SEQ ID NO.11: CGGTATTCACCACGATGCGGTATTCACCACGATGCGGTATTCACCACGATG; Where p represents the 5'-phosphorylation modified site at the sticky end; And / or the chemically modified DNA structural unit combination specifically refers to DNA structural units modified with phosphate thioesters, and the DNA structural unit combination modified with the phosphate thioester backbone is as follows: Modify the S chain shown in SEQ ID NO.9: TsCTTTTGAGTCAGTGGCAGTGTTTsT; Modify the M chain shown in SEQ ID NO.10: GsAAAAACACTGCCTGAATACCGCATCGTGGACTGACTCAAAsA; Modify the L-chain shown in SEQ ID NO.11: CsGGTATTCACCACGATGCGGTATTCACCACGATGCGGTATTCACCACGAT sG; Where 's' represents the site of thiophosphate modification.

4. The method for rapidly preparing three-dimensional self-assembled DNA crystals in a closed homogeneous system according to claim 1, characterized in that, The molar ratio of S chain, M chain and L chain is (2-5):(2-5):

1.

5. The method for rapidly preparing three-dimensional self-assembled DNA crystals in a closed homogeneous system according to claim 1, characterized in that, The concentration of cations and / or positively charged compounds in the buffer solution is 0.01-100 mM.

6. The method for rapidly preparing three-dimensional self-assembled DNA crystals in a closed homogeneous system according to claim 1, characterized in that, Cation-containing compounds include those containing Na. + Li + K + Mg 2+ Ca 2+ 、Sr 2+ Ni 2+ At least one of the metal salt compounds; And / or positively charged compounds include at least one of spermidine, spermine, ethylenediamine, formamide, urea, and polyamine derivatives containing azophenyl groups.

7. The method for rapidly preparing three-dimensional self-assembled DNA crystals in a closed homogeneous system according to claim 1, characterized in that, The concentration of DNA structural units in the mixture is 1-40 μM.

8. The method for rapidly preparing three-dimensional self-assembled DNA crystals in a closed homogeneous system according to claim 1, characterized in that, Gradient annealing involves starting at a temperature of 50-95℃ and decreasing to 0-40℃ at an average rate of 0.1-5℃ / min.

9. A three-dimensional self-assembled DNA crystal, characterized in that, The three-dimensional self-assembled DNA crystal is prepared by the method described in any one of claims 1-9. The three-dimensional self-assembled DNA crystal has a size of 100 nm-1 mm, a coefficient of variation of <22%, and a three-dimensional periodic ordered structure with regular morphology and uniform size distribution.

10. The application of the three-dimensional self-assembled DNA crystal of claim 9 in the preparation of nanophotonic devices, biosensors, biomimetic catalytic carriers, drug delivery or information storage media.

Images