Repressor fusion protein system
By developing a fusion protein system containing DNA-binding proteins and repressor domain proteins, and combining it with gRNA, the off-target effects and incomplete knockdown problems of gene regulation in existing technologies have been solved. This enables highly efficient transcriptional repression and epigenetic modification of targeted genes, making it suitable for disease treatment and research.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SCRIBE THERAPEUTICS INC
- Filing Date
- 2024-03-28
- Publication Date
- 2026-06-02
AI Technical Summary
Existing gene regulation methods, such as RNAi and CRISPR/Cas systems, suffer from off-target effects and incomplete knockdown in gene silencing and transcriptional repression. Furthermore, traditional repressor systems require the design of new proteins for each target gene, which limits their application.
A fusion protein system comprising a modified DNA-binding protein and a repressor domain protein was developed, which binds to guide nucleic acid (gRNA) for targeted transcriptional repression and epigenetic modification of genes, and is delivered to cells via vectors and particulate formulations to achieve gene silencing.
It achieves efficient and specific transcriptional repression and heritable epigenetic modification of target genes, and provides a variety of gene silencing methods suitable for disease treatment and research applications.
Smart Images

Figure CN122139033A_ABST
Abstract
Description
[0001] Cross-references to related applications
[0002] This application claims priority and benefit to U.S. Provisional Application No. 63 / 492,845, filed March 29, 2023, and U.S. Provisional Application No. 63 / 505,906, filed June 2, 2023, the contents of each of which are incorporated herein by reference in their entirety.
[0003] Reference to the electronic sequence list
[0004] The contents of the electronic sequence list (SCRB_054_02WO_SeqList_ST26.xml; size: 141,358,486 bytes; and creation date: March 26, 2024) are incorporated herein by reference in their entirety. Background Technology
[0005] The methods for regulating target gene expression in cells differ. In mammalian systems, cells utilize a system of chromatin regulatory factors (CRs) along with associated histones and DNA modifications to regulate gene expression and establish long-term epigenetic memory. This system is crucial for development, aging, and disease and provides fundamental regulatory capabilities in synthetic biology. In experimental systems, methods such as RNA interference (RNAi) can be used for targeted gene knockdown and have been widely used for large-scale library screening. However, RNAi has several limitations. Specifically, RNAi-based knockdown exhibits off-target effects and incomplete knockdown of the target (Jackson AL et al., Expression profiling reveals off-target gene regulation by RNAi. *Nature Biotechnol.* 21:635 (2003); Sigoillot FD et al., A bioinformatics method identifies prominent off-target transcripts in RNAi screens. *Nature Methods* 19:9(4):363 (2012)). Customized DNA-binding proteins linked to transcriptional repressor domains, such as zinc finger proteins or transcription activator-like effector (TALE) proteins, while capable of regulating selective gene repression, are limited by the fact that a new protein needs to be generated for each desired target gene.
[0006] The emergence of DNA editing systems and their programmable nature has facilitated their use as a general technology for genome manipulation and engineering. Specifically, CRISPR proteins are well-suited for such manipulation. For example, the small size of certain class 2 CRISPR / Cas systems provides ease of delivery, and the relatively short nucleotide sequences encoding the proteins are an advantage for incorporation into viral vectors for cellular delivery. However, in certain disease indications, gene silencing or transcriptional repression is preferred over gene editing. The ability to render CRISPR nucleases such as Cas9 and CasX catalytically inactive has been demonstrated (WO2020247882A1 and US20200087641A1, incorporated herein by reference), making these systems attractive platforms for generating fusion proteins with repressor domains capable of gene silencing. While some repressor systems have been described, other gene repressor systems, optimized and / or offering improvements over earlier systems such as Cas9-based systems, remain needed for a variety of therapeutic, diagnostic, and research applications.
[0007] This article provides systems and methods for targeting and repressing genes in cells through epigenetic modification, as well as delivery vectors and formulations to meet this need. Summary of the Invention
[0008] Various aspects of this disclosure relate to systems and methods for regulating the expression of target nucleic acids in cells.
[0009] This disclosure provides systems comprising or encoding fusion proteins, said fusion proteins comprising a modified DNA-binding protein in a defined conformation and an attached repressor domain protein, used in some cases in conjunction with guide RNA (gRNA) for transcriptional repression and / or epigenetic modification of target nucleic acid sequences. Components of said systems can be modified for use as formulations passively entering target cells and can be used in various methods of gene silencing or transcriptional repression in diseases, wherein repression of gene products can be used to reverse the underlying cause of a disease or improve signs or symptoms of a disease, and said methods are also provided. The systems of this disclosure can induce heritable epigenetic modifications or silencing of genes targeted by said systems. This disclosure provides methods for repressing gene transcription in a population of cells, said methods comprising introducing a system comprising or encoding a repressor fusion protein and, in some cases, gRNA, into cells in said population, said repressor fusion protein comprising a modified DNA-binding protein and an attached repressor domain protein, wherein transcription of said gene is repressed by said repressor fusion protein. This disclosure also provides carriers and particulate formulations (e.g., lipid nanoparticles, or LNPs, and synthetic nanoparticles) that encode or encapsulate system components for delivery to cells to silence or transcriptionally repress target nucleic acids in the cells.
[0010] On the other hand, this document provides compositions comprising the system or a carrier encoding the system, the compositions being used to prepare a medicament for treating a disease in a subject in need.
[0011] Further features and advantages of certain embodiments of this disclosure will become clearer from the following description of the embodiments and their accompanying drawings, as well as from the claims.
[0012] By incorporating via reference
[0013] All publications, patents, and patent applications mentioned in this specification are incorporated herein by reference to the same extent, as if specifically and individually indicated that each individual publication, patent, or patent application is incorporated by reference. WO2020 / 247882, WO 2020 / 247883, WO 2021 / 113772, WO 2022 / 120095, WO 2022 / 125843, WO2022 / 261150, WO 2022 / 261149, WO 2023 / 049872, WO 2023 / 235818, and WO2023 / 049742 and WO2023 / 240162 disclose CasX variants and gRNA variants and methods for their delivery, the contents of which are hereby incorporated in their entirety by reference. Attached Figure Description
[0014] The novel features of this disclosure are specifically set forth in the appended claims. A better understanding of the features and advantages of this disclosure will be obtained by referring to the following detailed description of illustrative embodiments, which utilize the principles of this disclosure, and the accompanying drawings:
[0015] Figure 1A This is a time-course graph showing the percentage of intracellular PCSK9-negative mouse Hepa1-6 cells at 4, 12, 18, 24, 41, and 53 days post-delivery, as described in Example 1. Hepa1-6 cells were treated with LTRP5-ZIM3 or LTRP5-ADD-ZIM3 mRNA paired with a PCSK9-targeting gRNA having a spacer of 27.88. Non-targeting (NT) spacers were used as experimental controls.
[0016] Figure 1BThis is a time-course graph showing the percentage of intracellular PCSK9-negative mouse Hepa1-6 cells at 4, 12, 18, 24, 41, and 53 days post-delivery, as described in Example 1. Hepa1-6 cells were treated with LTRP5-ZIM3 or LTRP5-ADD-ZIM3 mRNA paired with a PCSK9-targeting gRNA having a spacer size of 27.94. Non-targeting (NT) spacers were used as experimental controls.
[0017] Figure 2A This is a bar graph showing the quantification of secreted PCSK9 levels in HepG2 cells transfected with dCasX or LTRP5-ADD-ZIM3 mRNA fused with ZIM3-KRAB (dXR1) when paired with the indicated target gRNA, 4 days post-transfection, as described in Example 2. Secreted PCSK9 levels were normalized relative to the total cell count. Untreated cells were used as experimental controls.
[0018] Figure 2B This is a bar graph showing the quantification of secreted PCSK9 levels in Huh7 cells transfected with lipid-transfected mRNA encoding CasX 676, dXR1, or LTRP5-ADD-ZIM3 when paired with the indicated target gRNA, as described in Example 2, 4 days post-transfection. Secreted PCSK9 levels were normalized relative to the total cell count. Untreated, pristine cells were used as experimental controls.
[0019] Figure 2C This is a bar graph showing the quantification of secreted PCSK9 levels in Hep3B cells lipid-transfected with mRNA encoding CasX 676, dXR1, or LTRP5-ADD-ZIM3 when paired with the indicated target gRNA, as described in Example 2, 4 days post-transfection. Secreted PCSK9 levels were normalized relative to the total cell count. Untreated, pristine cells were used as experimental controls.
[0020] Figure 3 This is a bar graph showing the quantification of secreted PCSK9 levels in Huh7 cells lipid-transfected with mRNA encoding CasX 676, dXR1, or LTRP5-ADD-ZIM3 when paired with the indicated target gRNA at days 4, 14, and 27 post-transfection, as described in Example 2. The quantification of secreted PCSK9 levels is shown relative to the secretion levels detected in untreated cells at day 4.
[0021] Figure 4A schematic diagram of the LTRP5 molecule without the ADD domain of DNMT3A, as described in Example 5, is shown. "D3A CD" and "D3L ID" represent the catalytic domain of DNMT3A and the interacting domain of DNMT3L, respectively. "L1", "L2", "L3A", and "L3B" are linkers. "NLS" is the nuclear localization signal. "RD1" represents the repressor domain.
[0022] Figure 5 This is a bar graph showing the results of a time-series experiment comparing B2M repression levels (expressed as the mean percentage of HLA-negative cells) in HEK293T cells transfected with plasmids containing adapter groups 1–11, as described in Example 5. Data from each time point (day 8, day 15, and day 45) are stacked and expressed as mean versus standard deviation, N = 3. Non-targeting spacers (NTs) are included as experimental controls.
[0023] Figure 6 This is a bar graph showing the results of a time-course experiment comparing the repression level of target 1 containing the LTRP5 variants of adaptor group 1-11 (expressed as the percentage of total cells knocked down target 1) measured in HEK293T cells, as described in Example 5. Data from each time point (day 8, day 15, and day 45) are stacked and expressed as mean versus standard deviation, N = 3.
[0024] Figure 7 This is a bar graph showing the results of a time-series experiment comparing the repression levels of target 2 (expressed as the percentage of total cells knocked down by target 2) of LTRP5 variants containing adapter groups 1–11. Repression levels were measured in HEK293T cells as described in Example 5. Data from each time point (day 8, day 15, and day 45) are stacked and expressed as mean versus standard deviation, N = 3. Non-target spacers (NTs) are included as experimental controls.
[0025] Figure 8 This is a bar graph showing the results of a time-series experiment comparing B2M repression levels (expressed as the mean percentage of HLA-negative cells) in HEK293T cells transfected with plasmids containing the LTRP5 variant containing adapter group 12–28, as described in Example 5. Data from each time point (day 7 and day 17) are stacked and expressed as mean versus standard deviation, N = 3. Non-targeting spacers (NTs) are included as experimental controls.
[0026] Figure 9This is a bar graph showing the results of a time-series experiment comparing the level of inhibition of target 1 by the LTRP5 variant containing adaptor group 12-28 in HEK293T cells (expressed as the percentage of total cells knocked down target 1), as described in Example 5. Data from each time point (day 7 and day 17) are stacked and expressed as mean versus standard deviation, N = 3. Non-target spacers (NTs) are included as experimental controls.
[0027] Figure 10 This is a bar graph showing the results of a time-course experiment comparing the level of inhibition of target 2 by the LTRP5 variant containing adaptor group 12–28 in HEK293T cells (expressed as the percentage of total cells knocked down target 2), as described in Example 5. Data from each time point (day 7 and day 17) are stacked and expressed as mean versus standard deviation, N = 3. Non-target spacers (NTs) are included as experimental controls.
[0028] Figure 11 This is a bar graph showing the percentage of mouse Hepa1-6 cells treated with dXR1 or LTRP1-ZIM3 mRNA paired with the indicated PCSK9-targeting gRNA on day 6 that were negative for intracellular PCSK9 staining, as described in Example 7. Spacer 6.7, which targets the human PCSK9 locus, served as a non-targeting control.
[0029] Figure 12 This is a time-series graph showing the percentage of mouse Hepa1-6 cells treated with dXR1 mRNA paired with the indicated PCSK9-targeting gRNA at days 6, 13, and 25 post-delivery, as described in Example 7. Spacer 6.7, targeting the human PCSK9 locus, served as a non-targeting control, and water treatment served as a negative control.
[0030] Figure 13 This is a time-series graph showing the percentage of mouse Hepa1-6 cells treated with LTRP1-ZIM3 mRNA paired with the indicated PCSK9-targeting gRNA at days 6, 13, and 25 post-delivery, as described in Example 7. Spacer 6.7, targeting the human PCSK9 locus, served as a non-targeting control, and water treatment served as a negative control.
[0031] Figure 14This is a time-course graph showing the percentage of intracellular PCSK9-negative days at the indicated time points after delivery of mouse Hepa1-6 cells treated with LTRP1-ZIM3 and LTRP5-ZIM3 mRNA generated by internal in vitro transcription (IVT) paired with the indicated PCSK9-targeting gRNA, as described in Example 7.
[0032] Figure 15 This is a time-course graph showing the percentage of mouse Hepa1-6 cells treated with LTRP1-ZIM3 and dCas9-ZNF10-DNMT3A / 3L mRNA paired with the indicated PCSK9-targeting gRNA at the indicated time points after delivery, as described in Example 7.
[0033] Figure 16 This is a graph showing the percentage of HEK293T cells transfected with plasmids encoding the CasX or LTRP:gRNA constructs indicated by the encoding, which expressed B2M six days after treatment with different concentrations of the DNMT1 inhibitor 5-aza dC, as described in Example 7.
[0034] Figure 17 This is a graph juxtaposed with the quantification of B2M repression in HEK293T cells transfected with plasmids encoding the indicated CasX or LTRP:gRNA construct and cultured for 58 days, and the quantification of B2M reactivation when transfected cells are treated with 5-aza-dC, as described in Example 7.
[0035] Figure 18 This is a bar graph showing the quantification of secreted PCSK9 levels in Huh7 cells lipid-transfected with mRNA encoding CasX 676, dXR1, or LTRP5-ADD-ZIM3 when paired with the indicated target gRNA at 6, 18, and 36 days post-transfection, as described in Example 8. Secreted PCSK9 levels were normalized relative to the total cell count. Untreated, pristine cells were used as experimental controls.
[0036] Figure 19 A schematic diagram of various conformations of the LTRP molecule with the DNMT3A ADD addition domain is shown. “D3AADD,” “D3A CD,” and “D3L ID” represent the ADD domain of DNMT3A, the catalytic domain of DNMT3A, and the interaction domain of DNMT3L, respectively. “DBP” indicates a DNA-binding protein. “L1,” “L2,” “L3A,” “L3B,” and “L4” are linkers. “NLS” is the nuclear localization signal. “RD1” represents the repressor domain, and “RD1a” and “RD1b” represent repressor domain variants.
[0037] Figure 20A This is a schematic diagram illustrating versions 1-3 of the chemical modifications made to gRNA scaffold variant 235, as described in Example 11. Structural motifs are highlighted. Standard ribonucleotides are depicted as hollow circles, and 2'OMe-modified ribonucleotides are depicted as black circles. Phosphothioester bonds are indicated with an asterisk (*) below or next to the bonds. For the v2 spectrum, the three added 3' uracils (3'UUU) are marked with a "U" in the relevant circles.
[0038] Figure 20B This is a schematic diagram illustrating versions 4-6 of the chemical modifications made to gRNA scaffold variant 235, as described in Example 11. Structural motifs are highlighted. Standard ribonucleotides are depicted as hollow circles, and 2'OMe-modified ribonucleotides are depicted as black circles. Phosphothioester bonds are indicated with an asterisk (*) below or next to the bonds.
[0039] Figure 21 The percentage of B2M knockout in HepG2 cells co-transfected with 100 ng CasX 491 mRNA and an indicated dose of B2M-targeting gRNA with a spacer 7.37-terminated end (v1) or unmodified (v0) is shown as described in Example 11. The level of editing was determined by flow cytometry based on cell populations that lost HLA complex surface presentation due to successful editing at the B2M locus.
[0040] Figure 22 This is a schematic diagram illustrating versions 7-9 of the chemical modifications made to gRNA scaffold variant 316, as described in Example 11. Structural motifs are highlighted. Standard ribonucleotides are depicted as hollow circles, and 2'OMe-modified ribonucleotides are depicted as black circles. Phosphothioester bonds are indicated with an asterisk (*) below or next to the bonds.
[0041] Figure 23A This is a schematic diagram of gRNA scaffold variant 174 (SEQ ID NO: 1744), as described in Example 11. The structural motif is highlighted.
[0042] Figure 23B This is a schematic diagram of gRNA scaffold variant 235 (SEQ ID NO: 1745), as described in Example 11. The highlighted structural motifs are related to... Figure 20A The same as in the previous one. The difference between gRNA variant 174 and variant 235 lies in the extended stem motif and several single nucleotide changes (indicated by asterisks). Variant 316 maintains the shorter extended stem from variant 174, but includes the four substitutions found in scaffold 235.
[0043] Figure 23C This is a schematic diagram of gRNA scaffold variant 316 (SEQ ID NO: 1746), as described in Example 11. The highlighted structural motifs are related to... Figure 20A The same as in the previous one. Variant 316 maintains the shorter, elongated stem from gRNA variant 174 ( Figure 23A ), but includes the four substitutions found in stent 235 ( Figure 23B ).
[0044] Figure 24 This is a graph showing the correlation between the insertion / deletion rate at the PCSK9 locus (plotted as edit fraction) (x-axis) as measured by NGS and the secreted PCSK9 level (ng / mL) (y-axis) as detected by ELISA in HepG2 cells lipid-transfected with CasX 491 mRNA containing the indicated scaffold variant and spacer combination and PCSK9-targeting gRNA, as described in Example 11.
[0045] Figure 25A This is a graph depicting the results of an editing assay, as described in Example 11, showing the results of an NGS-detected measurement of the insertion / deletion rate at the human B2M locus in HepG2 cells treated with LNPs formulated with the indicated dose of CasX 491 mRNA and the indicated gRNA targeting B2M.
[0046] Figure 25B This is a graph illustrating the quantitative percentage of B2M knockout in HepG2 cells treated with a specified dose of LNP formulated with CasX 491 mRNA and a specified gRNA targeting B2M, as described in Example 11. The editing level was determined by flow cytometry as a cell population lacking surface presentation of the HLA complex due to successful editing at the B2M locus.
[0047] Figure 26A This is a graph depicting the results of an NGS-detected measurement of the insertion / deletion rate at the mouse ROSA26 locus in Hepa1-6 cells treated with a specified dose of LNPs modulated with CasX 676 mRNA #2 and a specified gRNA targeting ROSA26 with a v1 or v5 modification profile, as described in Example 11.
[0048] Figure 26B This is a graph showing a quantitative representation of the percentage of editing as measured by NGS at the ROSA26 locus in mice treated with LNPs modulated with CasX 676 mRNA #2 and the indicated chemically modified gRNA targeting ROSA26, as described in Example 11.
[0049] Figure 27 This is a bar graph showing the results of an editing assay for the insertion / deletion rate at the mouse PCSK9 locus, measured by NGS in mice treated with LNPs modulated with CasX 676 mRNA #1 and a specified chemically modified gRNA targeting PCSK9, as described in Example 11. Untreated mice were used as experimental controls.
[0050] Figure 28A This is a schematic diagram illustrating versions 1-3 of the chemical modifications made to gRNA scaffold variant 316, as described in Example 11. Structural motifs are highlighted. Standard ribonucleotides are depicted as hollow circles, and 2'OMe-modified ribonucleotides are depicted as black circles. Phosphothioester bonds are indicated with an asterisk (*) below or next to the bonds. For the v2 spectrum, the three added 3' uracils (3'UUU) are marked with a "U" in the relevant circles.
[0051] Figure 28B This is a schematic diagram illustrating versions 4-6 of the chemical modifications made to gRNA scaffold variant 316, as described in Example 11. Structural motifs are highlighted. Standard ribonucleotides are depicted as hollow circles, and 2'OMe-modified ribonucleotides are depicted as black circles. Phosphothioester bonds are indicated with an asterisk (*) below or next to the bonds.
[0052] Figure 29 This is a violin plot, where each dot represents the average methylation % at a single CpG motif. Median methylation is indicated by a dashed line, with the upper and lower quartiles also indicated by dashed lines. As described in Example 12, DNA methylation proximal to the transcription start site (TSS) was measured from gDNA extracted from homogenized livers (from N = 3 mice sacrificed on days 7, 14, and 42 post-treatment) by amplicon enzymatic methylation sequencing (EM-seq).
[0053] Figure 30 This is a violin plot, where each point represents the average methylation % at a single CpG. Median methylation is indicated by a dashed line, with the upper and lower quartiles also indicated by dashed lines. As described in Example 13, DNA methylation proximal to the transcription start site (TSS) was measured from gDNA extracted from homogenized livers (from N = 3 mice sacrificed on day 7 post-treatment) by amplicon enzymatic methylation sequencing (EM-seq). Detailed Implementation
[0054] Although exemplary embodiments have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Many variations, modifications, and substitutions will now occur to those skilled in the art without departing from the invention claimed herein. It should be understood that different alternatives to the embodiments described herein can be used to practice embodiments of this disclosure. The claims are intended to define the scope of the invention and thereby cover the methods and structures within the scope of these claims and their equivalents.
[0055] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While methods and materials similar to or equivalent to those described herein may be used to practice or test these embodiments, suitable methods and materials are described below. In case of conflict, this specification, including the definitions, shall prevail. Furthermore, materials, methods, and examples are merely illustrative and not intended to be limiting. Many variations, modifications, and substitutions will now be apparent to those skilled in the art without departing from the invention.
[0056] definition
[0057] As used in this specification and the appended claims, unless the context clearly specifies otherwise, the singular forms “a / an” and “described” include multiple references. Thus, for example, a reference to “host cell” includes two or more such host cells, a reference to “engineered CasX protein” includes one or more engineered CasX proteins, a reference to “nucleic acid sequence” includes one or more nucleic acid sequences, and so on.
[0058] As used herein, the term "about" is understood by those skilled in the art and may vary to some extent depending on the context in which it is used. Where there is a use of a term that is not readily apparent to those skilled in the art, "about" will, in light of the context in which the term "about" is used, mean at most positive or negative 10% of the particular term.
[0059] As those skilled in the art will understand, for any and all purposes, all scopes disclosed herein also include any and all possible subscopes and combinations thereof. Furthermore, as those skilled in the art will understand, the scope includes each individual member. Thus, for example, a group having 1-3 members means a group having 1, 2, or 3 members. Similarly, a group having 1-5 members means a group having 1, 2, 3, 4, or 5 members, etc.
[0060] The term "combinations thereof" includes every possible combination of the elements referred to by the term.
[0061] As used herein, the term “exemplary” refers to an instance or illustration and does not imply any preference or value.
[0062] The terms “polynucleotide” and “nucleic acid”, used interchangeably in this document, refer to polymeric forms of nucleotides of any length, namely ribonucleotides or deoxyribonucleotides. Therefore, the terms “polynucleotide” and “nucleic acid” encompass single-stranded DNA; double-stranded DNA; multi-stranded DNA; single-stranded RNA; double-stranded RNA; multi-stranded RNA; genomic DNA; cDNA; DNA-RNA hybrids; and polymers containing purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural or derived nucleotide bases.
[0063] The terms "hybridizable" and "complementary" are used interchangeably to mean that a nucleic acid (e.g., RNA, DNA) contains a nucleotide sequence that enables it to non-covalently bind to another nucleic acid in a sequence-specific, antiparallel manner (i.e., the nucleic acid specifically binds to the complementary nucleic acid) under appropriate temperature and solution ionic strength conditions in vitro and / or in vivo, forming Watson-Crick base pairs and / or G / U base pairs, "annealing," or "hybridizing." It should be understood that the sequence of a polynucleotide does not need to be 100% complementary to the sequence of its target nucleic acid for specific hybridization; it can have at least about 70%, at least about 80%, or at least about 90%, or at least about 95% sequence identity and still hybridize with the target nucleic acid. Furthermore, polynucleotides can hybridize on one or more segments such that intermediate or adjacent segments do not participate in the hybridization event (e.g., loop structures or hairpin structures, 'bulges,' 'bubbles,' etc.). Therefore, those skilled in the art will understand that although individual bases within a sequence may not be complementary to another sequence, the sequence as a whole is still considered complementary.
[0064] For the purposes of this disclosure, "gene" includes the DNA region encoding a gene product (e.g., protein, RNA) and all DNA regions regulating the production of the gene product, regardless of whether such regulatory sequences are adjacent to the coding and / or transcribed sequences. Therefore, a gene may include accessory element sequences, including but not limited to: promoter sequences, terminators, translation regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, origins of replication, matrix attachment sites, and locus control regions. The coding sequence encodes the gene product during transcription or transcription and translation; the coding sequences of this disclosure may comprise fragments and do not necessarily contain full-length open reading frames. A gene may include a transcribed strand and a complementary strand containing anticodons.
[0065] The term "downstream" refers to the nucleotide sequence located at the 3' of the reference nucleotide sequence. In some embodiments, the downstream nucleotide sequence is associated with a sequence that follows the transcription start site. For example, the translation start codon of a gene is located downstream of the transcription start site.
[0066] The term "downstream" refers to the nucleotide sequence located at the 5' end of the reference nucleotide sequence. In some embodiments, the upstream nucleotide sequence is associated with a sequence located 5' to the side of the coding region or the transcription start site. For example, most promoters are located upstream of the transcription start site.
[0067] The term "adjacent to" in relation to polynucleotide or amino acid sequences refers to sequences that are adjacent or neighboring to each other in a polynucleotide or polypeptide. Those skilled in the art will understand that two sequences can be considered to be adjacent to each other, and still encompass a limited number of intermediate sequences, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides or amino acids.
[0068] The term “regulatory element” is used interchangeably with the term “regulatory sequence” in this document and is intended to include promoters, enhancers, and other expression regulatory elements. It should be understood that the selection of an appropriate regulatory element will depend on whether the encoded component (e.g., protein or RNA) or nucleic acid to be expressed contains multiple components that require different polymerases or are not intended to be expressed as a fusion protein.
[0069] The term “accessory element” is used interchangeably with the term “accessory sequence” herein and is intended to include coding and non-coding sequences that enhance the expression, transport, or function of nucleic acids, mRNA, or proteins, and particularly includes poly(A) signals, enhancer elements, introns, post-transcriptional regulatory elements (PTREs), nuclear localization signals (NLS), deaminases, DNA glycosyltransferase inhibitors, additional promoters, factors that stimulate CRISPR-mediated homology-directed repair (e.g., in cis or trans), self-cleaving sequences, and fusion domains, such as fusion domains fused to CRISPR proteins. It should be understood that the selection of one or more appropriate accessory elements will depend on whether the encoded component (e.g., protein or RNA) or nucleic acid to be expressed contains multiple components that require different polymerases or are not intended to be expressed as a fusion protein.
[0070] The term "promoter" refers to a DNA sequence containing a transcription start site and additional sequences that promote polymerase binding and transcription. Exemplary eukaryotic promoters include elements such as TATA boxes and / or B recognition elements (BREs) and assist or promote the transcription and expression of associated transcribed polynucleotide sequences and / or genes (or transgenes). Promoters can be synthetically generated or derived from known or naturally occurring promoter sequences or other promoter sequences. Promoters can be located proximal or distal to the gene to be transcribed. Promoters can also include chimeric promoters, which comprise a combination of two or more heterologous sequences to confer certain properties. Promoters of this disclosure may include variants of promoter sequences that are similar in composition to, but not identical to, other known or provided promoter sequences herein. Promoters can be classified according to criteria associated with the expression pattern of the associated coding or transcribed sequence or the gene operatively linked to the promoter, such as constitutive, developmental, tissue-specific, inducible, etc. Promoters can also be classified according to their strength. As used in the context of promoters, "strength" refers to the transcription rate of the gene controlled by the promoter. A "strong" promoter means a high transcription rate, while a "weak" promoter means a relatively low transcription rate.
[0071] The promoter disclosed herein may be a polymerase II (Pol II) promoter. Polymerase II transcribes all protein-coding and many non-coding genes. A representative Pol II promoter includes a core promoter, which is a sequence of approximately 100 base pairs surrounding the transcription start site and serves as a binding platform for Pol II polymerase and associated general transcription factors. The promoter may contain one or more core promoter elements, such as a TATA box, BRE, initiator (INR), motif ten element (MTE), downstream core promoter element (DPE), and downstream core element (DCE), although core promoters lacking these elements are known in the art. All Pol III promoters are contemplated within the scope of this disclosure.
[0072] The promoter disclosed herein may be a polymerase III (Pol III) promoter. Pol III transcribes DNA to synthesize small ribosomal RNAs, such as 5S rRNA, tRNA, and other small RNAs. Representative Pol III promoters use internal control sequences (sequences within the transcribed portion of a gene) to support transcription, although upstream elements such as TATA boxes are sometimes used as well. All Pol III promoters are envisioned within the scope of this disclosure.
[0073] The term "enhancer" refers to a regulatory DNA sequence that, when bound to a specific protein called a transcription factor, regulates the expression of an associated gene. Enhancers can be located within introns of a gene or at the 5' or 3' end of the gene's coding sequence. Enhancers can be located proximal to the gene (i.e., within tens or hundreds of base pairs (bp) of the promoter) or distal to the gene (i.e., thousands, hundreds of thousands, or even millions of bps away from the promoter). A single gene can be regulated by more than one enhancer, all of which are envisioned within the scope of this disclosure.
[0074] As used in this article, "posttranscriptional regulatory elements (PTREs)," such as hepatitis PTREs, refer to tertiary DNA sequences that, when transcribed, can exhibit posttranscriptional activity to enhance or promote the expression of related genes operatively linked to them.
[0075] "Operably connected" means juxtaposing two or more components (such as sequence elements) such that both components are arranged to function properly, and allowing for the possibility that at least one of the components can mediate the function of at least one of the other components (e.g., promoters and coding sequences). Those skilled in the art will understand that two components can be operably connected without a physical connection.
[0076] In the context of this disclosure and relating to genes, the terms "repress," "repression," "transcriptional repression," "repressing," "inhibition of gene expression," "downregulation," and "silencing" are used interchangeably herein to refer to the repression or blockage of transcription of a gene or a portion thereof. Thus, transcriptional repression of a gene can reduce the production of the gene product. Examples of gene repression processes that reduce transcription include, but are not limited to: gene repression processes that inhibit the formation of the transcription initiation complex, gene repression processes that reduce the rate of transcription initiation, gene repression processes that reduce the rate of transcriptional elongation, gene repression processes that reduce the sustained synthetic capacity of transcription, and gene repression processes that antagonize transcriptional activation (e.g., by blocking the binding of transcriptional activators). For example, gene repression can constitute prevention of activation and suppression of expression below existing levels. Transcriptional repression includes both reversible and irreversible inactivation of gene transcription; the latter may be caused by epigenetic modifications of the gene.
[0077] The terms "repressor" or "repressor domain" are used interchangeably herein to refer to polypeptide factors that act as regulatory elements on DNA to inhibit, repress, or block DNA transcription, thereby repressing gene expression. In the context of this disclosure, the repressor domain, when linked to a DNA-binding protein, can prevent promoter transcription or otherwise suppress gene expression when it binds to a target nucleic acid. Without wishing to be bound by theory, transcriptional repressors are believed to function through a variety of mechanisms, including: physically blocking RNA polymerase channels through steric hindrance; altering the post-translational modification state of polymerase; modifying the epigenetic state of nascent RNA; altering the epigenetic state of DNA through methylation; altering the epigenetic state of DNA through histone deacetylation or regulation of nucleosome remodeling; or preventing enhancer-promoter interactions, thereby silencing genes or reducing gene expression levels.
[0078] The terms "long-term repressor fusion protein" or "LTRP" are used interchangeably with "repressor fusion protein" herein, and refer to a fusion protein comprising a DNA-binding protein (or a protein's DNA-binding domain) fused to one or more domains capable of repressing transcription of a target nucleic acid sequence. Optionally, the repressor fusion protein of this disclosure may contain additional elements, such as linkers between any domains of the fusion protein, nuclear localization signals, nuclear export signals, and additional protein domains that confer additional activity to the repressor fusion protein.
[0079] As used herein, the “LTRP:gRNA system” is a system for transcriptional repression and comprises a long-term repressor fusion protein and a guide nucleic acid (gRNA), wherein the long-term repressor fusion protein comprises a catalytically dead CRISPR protein and one or more linked repressor domains, and the guide nucleic acid binds to the catalytically dead CRISPR protein. For clarity, the system also includes any encoding DNA, RNA, or vector, etc., which can be used to generate the repressor fusion protein and gRNA components of the system.
[0080] As used herein, a DNA-binding protein refers to a protein or protein domain capable of binding to DNA. Exemplary DNA-binding proteins include zinc finger (ZF) proteins, transcription activator-like effectors (TALEs), and clustered regularly spaced short palindromic repeats (CRISPR) proteins. Those skilled in the art will understand that in multifunctional proteins capable of both binding to DNA and performing another activity such as DNA cleavage, such as CRISPR proteins, the DNA-binding function can be dissociated from the other functions of the protein, resulting in a catalytically dead DNA-binding protein.
[0081] As used herein, "catalytically dead DNA-binding protein" refers to a protein that can bind to DNA but cannot cleave or cut DNA. As used herein, "catalytically dead CRISPR protein" refers to a CRISPR protein lacking endonuclease activity. Those skilled in the art will understand that CRISPR proteins can be catalytically dead and still perform other protein functions, such as DNA binding. Similarly, "catalytically dead CasX" refers to a CasX protein lacking endonuclease activity but still performing other protein functions, such as DNA binding.
[0082] As used herein, “recombination” means that a particular nucleic acid (DNA or RNA) is the product of various combinations of cloning, restriction, and / or ligation steps, producing a construct with a structural coding or non-coding sequence different from that found in endogenous nucleic acids in natural systems. Typically, the DNA sequence encoding the structural coding sequence can be assembled from cDNA fragments and short oligonucleotide linkers, or from a series of synthetic oligonucleotides, to provide a synthetic nucleic acid capable of being expressed by a recombinant transcription unit contained in a cellular or cell-free transcription and translation system. Such sequences can be provided in the form of open reading frames interrupted by internal untranslated sequences or introns, which are typically present in eukaryotic genes. Genomic DNA containing the relevant sequences can also be used to form recombinant genes or transcription units. Untranslated DNA sequences may appear at the 5' or 3' of the open reading frame, where these sequences do not interfere with the operation or expression of the coding region and can indeed regulate the production of the desired product through various mechanisms (see “enhancers” and “promoters” above).
[0083] The term "recombinant polynucleotide" or "recombinant nucleic acid" refers to nucleic acids that are not naturally occurring, for example, created by artificially combining two otherwise separated sequence segments. This artificial combination is typically achieved through chemical synthesis, or more importantly, through the manipulation of the separated nucleic acid segments, such as through genetic engineering. This is usually done by replacing codons with redundant codons encoding the same or conserved amino acids, while typically introducing or removing sequence recognition sites. Alternatively, nucleic acid segments with desired functions are linked together to generate the desired functional combination. This artificial combination is typically achieved through chemical synthesis, or more importantly, through the manipulation of the separated nucleic acid segments, such as through genetic engineering.
[0084] Similarly, the terms "recombinant polypeptide" or "recombinant protein" refer to polypeptides or proteins that are not naturally occurring, for example, created by artificially combining two amino acid sequence segments that are otherwise separated. Therefore, proteins containing heterologous amino acid sequences are recombinant, for example.
[0085] As used herein, “lipid nanoparticle” or “LNP” refers to a particle with at least one nanometer-scale dimension (e.g., 1-1,000 nm) comprising one or more lipids (e.g., cationic lipids, non-cationic lipids, cofactor phospholipids, and PEG-modified lipids) and cholesterol. Specific components of LNPs are described more fully below. Lipid nanoparticles can be included in formulations for the delivery of active agents or therapeutic agents, such as nucleic acids (e.g., mRNA), to target sites of interest (e.g., cells, tissues, organs, tumors, etc.). The lipid nanoparticles of this disclosure may contain nucleic acids. Such lipid nanoparticles typically comprise neutral lipids, charged lipids, steroids, and polymer-conjugated lipids. Active agents or therapeutic agents such as nucleic acids may be encapsulated in the lipid portion of the lipid nanoparticle or in an aqueous space encapsulated by some or all of the lipid portion of the lipid nanoparticle, thereby protecting it from enzymatic degradation or other undesirable effects induced by mechanisms of the host organism or cell, such as adverse immune responses.
[0086] As used herein, the term "contact" refers to establishing a physical connection between two or more entities. For example, contacting a target nucleic acid with a guide nucleic acid means that the target nucleic acid and the guide nucleic acid share a physical connection; for example, hybridization is possible if the sequences share sequence similarity.
[0087] "Dissociation constant" or "K" d "Can be used interchangeably and refers to the affinity between the ligand "L" and the protein "P"; that is, the degree to which the ligand binds tightly to a specific protein. Formula K can be used. d =[L] [P] / [LP] is calculated, where [P], [L] and [LP] represent the molar concentrations of the protein, ligand and complex, respectively.
[0088] A polynucleotide or polypeptide has a certain percentage of “sequence similarity” or “sequence identity” with another polynucleotide or polypeptide, meaning that when aligned, the percentages of bases or amino acids are the same and in the same relative positions. Sequence similarity (sometimes referred to as similarity percentage, identity percentage, or homology) can be determined in a variety of different ways. To determine sequence similarity, sequences can be aligned using methods and computer programs known in the art, including BLAST, which is available from the World Wide Web (ncbi.nlm.nih.gov / BLAST / ). The percentage of complementarity between specific segments of nucleic acid sequences within a nucleic acid can be determined using any convenient method. Exemplary methods include the BLAST program (Basic Local Alignment Search Tool) and the PowerBLAST program (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656) or by using the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wisconsin), for example, using the default settings, which use the Smith and Waterman algorithm (Advances in Appl. Math., 1981, 2, 482-489).
[0089] The terms “peptide” and “protein” are used interchangeably herein and refer to a polymeric form of amino acids of any length, which may include encoded and non-encoded amino acids, chemically or biochemically modified or derived amino acids, and polypeptides having a modified peptide backbone. The term includes fusion proteins, including but not limited to fusion proteins having heterologous amino acid sequences.
[0090] A "vector" or "expression vector" is a replicon, such as a plasmid, bacteriophage, virus, or kinase, which may include another DNA segment, i.e., an expression cassette, to induce the replication or expression of other DNA segments in the cell.
[0091] As used in this article, the terms “naturally occurring,” “unmodified,” or “wild-type” for nucleic acids, peptides, cells, or organisms refer to nucleic acids, peptides, cells, or organisms found in nature.
[0092] As used herein, “mutation” means an insertion, deletion, substitution, duplication, or inversion of one or more amino acids or nucleotides compared to a wild-type or reference amino acid sequence or a wild-type or reference nucleotide sequence.
[0093] As used herein, the term "isolated" is intended to describe a polynucleotide, peptide, or cell in an environment different from the environment in which the polynucleotide, peptide, or cell naturally occurs. Isolated genetically modified host cells can exist within a mixed population of genetically modified host cells.
[0094] As used herein, “host cell” refers to a eukaryotic cell, prokaryotic cell, or cell from a multicellular organism (e.g., a cell line) cultured as a single-celled entity, which serves as a recipient of nucleic acids (e.g., an AAV vector), and includes the progeny of the original cell that has been genetically modified with a nucleic acid. It should be understood that the progeny of a single cell may not necessarily be identical to the original parent in morphology, genome, or total DNA complementarity due to natural, accidental, or intentional mutations. A “recombinant host cell” (also referred to as a “genetically modified host cell”) is a host cell into which a heterologous nucleic acid, such as an AAV vector, has been introduced.
[0095] The term "conservative amino acid substitution" refers to the interchangeability of amino acid residues with similar side chains in proteins. For example, a group of amino acids with aliphatic side chains consists of glycine, alanine, valine, leucine, and isoleucine; a group of amino acids with aliphatic-hydroxy side chains consists of serine and threonine; a group of amino acids with amide-containing side chains consists of asparagine and glutamine; a group of amino acids with aromatic side chains consists of phenylalanine, tyrosine, and tryptophan; a group of amino acids with basic side chains consists of lysine, arginine, and histidine; and a group of amino acids with sulfur-containing side chains consists of cysteine and methionine. Exemplary conserved amino acid substituents are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine.
[0096] As used herein, the terms “treatment” or “treating” are used interchangeably and refer to a method of achieving a beneficial or desired outcome, including but not limited to therapeutic and / or preventative benefits. A “therapeutic benefit” means the eradication or improvement of the underlying condition or disease being treated. A therapeutic benefit may also be achieved by eradicating or improving one or more symptoms or improving one or more clinical parameters associated with the underlying disease, resulting in an observed improvement in the subject, although the subject may still have the underlying condition.
[0097] As used herein, the terms "therapeutic effective amount" and "therapeutic effective dose" refer to an amount of a drug or biologic, alone or as part of a composition, that, when administered in a single or repeated dose to a subject such as a human or laboratory animal, is capable of having any detectable beneficial effect on any symptom, aspect, measured parameter, or characteristic of a disease state or condition. Such effects are not necessarily absolutely beneficial.
[0098] As used herein, “administration” means the method of giving a subject a dose of a compound (e.g., a composition of this disclosure) or a composition (e.g., a pharmaceutical composition).
[0099] "Subjects" are mammals. Mammals include, but are not limited to, domesticated animals, non-human primates, humans, dogs, rabbits, mice, rats, and other rodents.
[0100] All publications, patents and patent applications mentioned in this specification are incorporated herein by reference to the same extent, as if specifically and individually indicated that each individual publication, patent or patent application is incorporated by reference.
[0101] I. General Methods
[0102] Unless otherwise stated, the practice of this invention employs conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, and recombinant DNA, which can be found in the following standard textbooks: *Molecular Cloning: A Laboratory Manual*, 3rd edition (Sambrook et al., Harbor Laboratory Press, 2001); *Short Protocols in Molecular Biology*, 4th edition (edited by Ausubel et al., John Wiley & Sons, 1999); *Protein Methods* (Bollag et al., John Wiley & Sons, 1996); *Nonviral Vectors for Gene Therapy* (edited by Wagner et al., Academic Press, 1999); *Viral Vectors* (edited by Kaplift and Loewy, ...). Academic Press, 1995; *Immunology Methods Manual* (edited by I. Lefkovits, Academic Press, 1997); and *Cell and Tissue Culture: Laboratory Procedures in Biotechnology* (Doyle and Griffiths, John Willie & Son Publishing, 1998), the contents of which are publicly available in the aforementioned standard textbooks are incorporated herein by reference.
[0103] Where a range of values is provided, it should be understood that the endpoints and every intermediate value between the upper and lower limits of the range (to one-tenth of the lower limit unit, unless the context clearly indicates otherwise), as well as any other stated values or intermediate values within the stated range, are covered within this invention. The upper and lower limits of these smaller ranges may be independently included in and also covered within the smaller range, subject to any specifically excluded limits within the range. Where the stated range includes one or both limits, it also includes ranges excluding any one or both of those included limits.
[0104] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. All publications referenced herein are incorporated by way of citation to disclose and describe the methods and / or materials in connection with the cited publications.
[0105] It should be understood that, for clarity, certain features of this disclosure described in the context of individual embodiments may also be provided in combination in a single embodiment. In other instances, for brevity, various features of this disclosure described in the context of a single embodiment may also be provided individually or in any suitable sub-combination. All combinations of embodiments contemplated in relation to this disclosure are specifically covered by this disclosure and disclosed herein, as if each and every combination were individually and explicitly disclosed herein. Furthermore, all sub-combinations of various embodiments and their elements are also specifically covered by this disclosure and disclosed herein, as if each and every such sub-combination were individually and explicitly disclosed herein.
[0106] II. Systems for epigenetic modification and repression of genes
[0107] This disclosure provides systems with specific configurations useful in the transcriptional repression and / or epigenetic modification of genes in cells. As used herein, the terms "system" and "composition" are used interchangeably. In some cases, the system is designed to repress gene transcription in eukaryotic cells with mutations. In other cases, the system is designed to repress or silence the transcription of wild-type genes in eukaryotic cells, while the wild-type genes still cause disease or symptoms. Generally, any part of a gene can be targeted using the programmable systems and methods of this disclosure, which are described more fully herein.
[0108] This disclosure provides components of a long-term repressor fusion protein system comprising or encoding various conformations of a DNA-binding protein and an attached repressor domain capable of binding to a target nucleic acid sequence of a gene targeting transcriptional repression and / or epigenetic modification. Such fusion proteins, referred herein as long-term repressor fusion proteins (“LTRPs”), allow for long-term repression or silencing of target genes. This disclosure also provides nucleic acids encoding the system. Furthermore, this disclosure provides methods for preparing the system and methods for using the system, including methods for gene repression and / or epigenetic modification, and methods for treating diseases or conditions seeking gene repression or silencing.
[0109] In some embodiments, DNA-binding proteins comprise zinc finger (ZF) or TALE (transcription activator-like effector) proteins that bind to but do not cleave target nucleic acids. The DNA-binding domain of a TALE comprises a tandem array of customizable monomers 33-34 amino acids (aa) long, which can theoretically be assembled to recognize any genetic sequence that follows a repeat sequence binding a one-base-pair recognition code (Jain, S. et al., TALE outperforms Cas9 in editing heterochromatin target sites. *Nature Communications* 12:606 (2021)). TALE's specificity for binding DNA stems from two polymorphic amino acids, namely the so-called repeat variable double residues (RVD) located at positions 12 and 13 of the repeat unit. The DNA-binding specificity of a TALE can be arbitrarily altered by rearranging the repeat sequence. Zinc finger proteins are transcription factors, where each finger recognizes 3-4 bases. By mixing and matching these finger modules, ZF proteins can be customized to target specific sequences.
[0110] In some embodiments, the DNA-binding protein comprises a catalytically dead type I or type II CRISPR protein. Catalytically dead CRISPR proteins are also referred to in the art as “catalytically inactivated” CRISPR proteins. In some embodiments, type II proteins are catalytically dead Cas9. In another embodiment, type II CRISPR proteins are selected from the group consisting of type II, type V, or type VI proteins. In some embodiments, type V proteins are selected from the group consisting of Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f, Cas12g, Cas12h, Cas12i, Cas12j, Cas12k, Cas14, and / or CasΦ, each resulting in catalytic death through a specific mutation as described herein. CRISPR-based systems further include guide RNA (gRNA) having a target sequence complementary to the target sequence of the gene to be bound to and repressed by the complex of the fusion protein (CRISPR protein and the linked repressor domain) and the gRNA.
[0111] In some embodiments, this disclosure provides a system comprising or encoding a long-term repressor fusion protein and guide ribonucleic acid (gRNA), the long-term repressor fusion protein comprising a catalytically dead CasX nuclease protein and a linked repressor domain, the gRNA comprising a target sequence complementary to a target nucleic acid sequence of a gene targeting transcriptional repression, silencing, or epigenetic modification. In some embodiments, the system comprises the long-term repressor fusion protein and gRNA of this disclosure as a gene repressor pair (“LTRP:gRNA system”) capable of forming a ribonucleoprotein (RNP) complex and binding to a target nucleic acid. In some embodiments, the target nucleic acid is in a eukaryotic cell. In other embodiments, this disclosure provides a nucleic acid system encoding a long-term repressor fusion protein and gRNA. In still other embodiments, this disclosure provides a system for using gRNA and mRNA encoding a long-term repressor fusion protein in certain particulate formulations (e.g., LNP) described herein.
[0112] This article also provides methods for preparing long-term repressor fusion proteins and gRNAs, as well as methods for using the LTRP:gRNA system, including methods and therapeutic approaches for gene repression and / or epigenetic modification. Catalytically dead CRISPR proteins (e.g., dCasX proteins) and their linked repressor domains, as well as the gRNA components and characteristics of the LTRP:gRNA system, delivery methods, and methods for using said system to perform transcriptional repression, epigenetic modification, or silencing of genes, will be described more fully below.
[0113] III. Catalytically dead CRISPR proteins for long-term repressor fusion protein systems
[0114] In some embodiments, the DNA-binding protein used in the systems of this disclosure is a catalytically dead type 1 or type 2 CRISPR protein. In some embodiments, the type 2 CRISPR protein is a type II protein; for example, catalytically dead Cas9. In other embodiments, the catalytically dead type 2 CRISPR protein is selected from the group consisting of type II, type V, or type VI proteins. In one embodiment, the type V type 2 CRISPR protein is selected from the group consisting of Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f, Cas12g, Cas12h, Cas12i, Cas12j, Cas12k, Cas14, and / or CasΦ, each resulting in catalytic death through a specific mutation, as described herein. In another embodiment, the type V type 2 CRISPR protein is a catalytically dead CasX (dCasX) protein.
[0115] As used herein, the term "CasX protein" refers to a family of proteins and encompasses all naturally occurring CasX proteins ("reference CasX"), as well as engineered CasX proteins with multiple sequence modifications (CasX variants), except for those that induce catalytic death of CasX (dCasX), which possess one or more improved properties relative to the catalytically dead reference CasX protein, as described more fully below. The CasX proteins disclosed herein comprise the following domains: a non-target chain binding (NTSB) domain, a target chain loading (TSL) domain, a helical I domain, a helical II domain, an oligonucleotide binding domain (OBD), and a RuvC domain, and in some cases, the domains can be further subdivided into subdomains, as listed in Table 1.
[0116] In the context of this disclosure, the CasX used in the system is catalytically dead (dCasX); this is achieved by introducing a mutation at a selected position in the RuvC sequence, as described below.
[0117] a. Referencing the CaSX protein
[0118] This disclosure provides a naturally occurring CasX protein (referred to herein as the "reference CasX protein") which is subsequently modified to produce the engineered dCasX of this disclosure. For example, the reference CasX protein can be isolated from naturally occurring prokaryotes such as species of the class Delta Proteobacteria, phylum Planctomycetes, or provisionally phylum Morulatum. The reference CasX protein (which may be interchangeably referred to herein as the reference CasX polypeptide) is a class 2 type V CRISPR / Cas endonuclease belonging to the CasX protein family (which may be interchangeably referred to herein as Cas12e), which interacts with guide RNA to form a ribonucleoprotein (RNP) complex.
[0119] In some cases, the reference CasX protein is isolated from or derived from the genus *Deltaproteus* and contains the sequence of SEQ ID NO: 1.
[0120] In some cases, the reference CasX protein is isolated from or derived from the genus *Planctomyces* and contains the sequence of SEQ ID NO: 2.
[0121] In some cases, the reference CAX protein is isolated from or derived from the provisional genus *Morus* and contains the sequence of SEQ ID NO:3.
[0122] b. Class 1 or 2 CRISPR proteins that undergo catalytic death
[0123] In the long-term repressor protein system of this disclosure, the catalytically dead class 1 or class 2 CRISPR protein is catalytically dead because it cannot cleave DNA, but retains the ability to bind target nucleic acids when complexed with guide RNA (gRNA). This disclosure provides catalytically dead variants of class 1 or class 2 CRISPR proteins, wherein the catalytically dead variants include multiple modifications in the selection domain. In some embodiments, this disclosure provides catalytically dead CasX variants (which are interchangeably referred to herein as “dCasX variants” or “dCasX variant proteins”), wherein the catalytically dead CasX variants include multiple modifications in the RuvC domain relative to the sequences of SEQ ID NO: 1-3 (as described above). In some embodiments, the catalytically dead reference CasX protein includes substitutions at residues 672, 769, and / or 935 of SEQ ID NO: 1. In one embodiment, the catalytically dead reference CasX protein includes substitutions at D672A, E769A, and / or D935A of SEQ ID NO: 1. In other embodiments, the catalytically dead reference CasX protein comprises substitutions at amino acids 659, 756, and / or 922 of SEQ ID NO: 2. In some embodiments, the catalytically dead reference CasX protein comprises substitutions at D659A, E756A, and / or D922A of SEQ ID NO: 2. Exemplary RuvC domains of dCasX variants of this disclosure comprise amino acids 661-824 and 935-986 of SEQ ID NO: 1 or amino acids 648-812 and 922-978 of SEQ ID NO: 2, having one or more amino acid modifications relative to the RuvC cleavage domain sequence, wherein the dCasX variants exhibit one or more improved properties compared to the reference dCasX. In further embodiments, the catalytically dead CasX variant protein comprises all or part of the deletion of the RuvC domain of the reference CasX protein. It should be understood that the same aforementioned substitutions or omissions can be similarly introduced into CasX variants known in the art, thereby producing dCasX variants (see, for example, exemplary sequences in WO2022120095A1 and US 11,560,555, which are incorporated herein by reference).
[0124] In some embodiments, a long-term repressor fusion protein comprising a dCasX variant having a linked repressor domain exhibits at least one improved property compared to a long-term repressor fusion protein comprising a reference dCasX protein having a comparable linked repressor domain. All dCasX variants that improve one or more functions or properties of a long-term repressor fusion protein comprising a dCasX variant protein are considered to be within the scope of this disclosure compared to comparable long-term repressor fusion proteins comprising a reference dCasX protein. In some embodiments, the modification is a mutation of one or more amino acids of the reference dCasX, rather than those mutations that cause catalytic death of dCasX. For example, the dCasX variant may comprise one or more amino acid substitution, insertion, deletion, or exchange domains, or any combination thereof, relative to the reference dCasX protein sequence. In the substitutions described herein, any amino acid may be substituted with any other amino acid. Substitutions may be conserved substitutions (e.g., a basic amino acid is substituted with another basic amino acid). Substitutions may be non-conserved substitutions (e.g., a basic amino acid is substituted with an acidic amino acid, or vice versa). For example, proline in the reference dCasX protein can be replaced by any one of arginine, histidine, lysine, aspartic acid, glutamic acid, serine, threonine, asparagine, glutamine, cysteine, glycine, alanine, isoleucine, leucine, methionine, phenylalanine, tryptophan, tyrosine, or valine to produce the disclosed dCasX variant protein. Exemplary improved properties of dCasX variant embodiments include, but are not limited to, improved variant folding, increased binding affinity to target nucleic acids, improved ability to utilize broader PAM sequences in transcriptional repression and / or binding of target nucleic acids, improved target DNA unwinding, increased target strand loading, increased binding of non-target DNA strands, improved protein stability, increased ability to complex with gRNA, increased binding affinity to gRNA, improved protein:gRNA (RNP) complex stability, and, in the presence of the linked repressor domain and when complexed as an RNP, increased repressor activity, improved repressor specificity to target nucleic acids, reduced off-target repression, and an increased percentage of eukaryotic genome that can be effectively repressed and / or epigenetically modified. In some embodiments, the improved properties of the dCasX variant are improved by at least about 1.1 to about 100,000 times relative to the properties of a reference dCasX protein.In some embodiments, the improved properties of the dCasX variant are improved relative to the properties of the reference dCasX protein by at least about 1.1 to about 10,000 times, at least about 1.1 to about 1,000 times, at least about 1.1 to about 500 times, at least about 1.1 to about 400 times, at least about 1.1 to about 300 times, at least about 1.1 to about 200 times, at least about 1.1 to about 100 times, at least about 1.1 to about 50 times, at least about 1.1 to about 40 times, at least about 1.1 to about 30 times, at least about 1.1 to about 20 times, at least about 1.1 to about 10 times, and at least about 1.1 times. The improvements are as follows: approximately 9 times, at least about 1.1 to about 8 times, at least about 1.1 to about 7 times, at least about 1.1 to about 6 times, at least about 1.1 to about 5 times, at least about 1.1 to about 4 times, at least about 1.1 to about 3 times, at least about 1.1 to about 2 times, at least about 1.1 to about 1.5 times, at least about 1.5 to about 3 times, at least about 1.5 to about 4 times, at least about 1.5 to about 5 times, at least about 1.5 to about 10 times, at least about 5 to about 10 times, at least about 10 to about 20 times, at least 10 to about 30 times, at least 10 to about 50 times, or at least 10 to about 100 times. In some embodiments, the improved properties of the dCasX variant are at least about 10 to about 1000 times better than the properties of the reference dCasX protein. Further disclosures regarding the improved properties are described below.
[0125] In other embodiments, modification is the substitution of one or more domains of a reference dCasX with one or more domains from a different CasX. In some embodiments, insertion includes inserting a portion or all of a domain from a different CasX protein. Mutations can occur in any one or more domains of the dCasX variant and can include, for example, partial or complete deletion of one or more domains, or substitution, deletion, or insertion of one or more amino acids in any domain. Domains of the dCasX protein include non-target strand binding (NTSB) domains, target strand loading (TSL) domains, helical I domains, helical II domains, oligonucleotide binding domains (OBD), and RuvC DNA domains, which may further include subdomains described below.
[0126] In some embodiments, the dCasX variant protein comprises 800 to 1100 amino acids or 900 to 1000 amino acids.
[0127] Compared to RNPs in comparable assay systems that include a reference dCasX protein and comparable fusion proteins containing a linked repressor domain and gRNA, the long-term repressor fusion protein of this disclosure, containing dCasX and a linked repressor domain, utilizes and binds to a PAM TC motif, including a PAM sequence selected from TTC, ATC, GTC, or CTC, when complexed with gRNA to form an RNP, thereby exhibiting enhanced and efficient binding capacity to target nucleic acids. In the foregoing, the PAM sequence is located at at least one nucleotide at the 5' position of the non-target strand of a protospacer that is identical to the target sequence of the gRNA.
[0128] In some embodiments, RNPs containing a long-term repressor fusion protein and gRNA comprising a dCasX variant protein having a linked repressor domain, at a concentration of 20 pM or less, are capable of binding to double-stranded DNA targets with an efficiency of at least 70%, at least 80%, at least 85%, at least 90%, or at least 95%. In one embodiment, compared to RNPs in comparable assay systems containing a repressor fusion protein and gRNA comprising a reference dCasX protein having a linked repressor domain, the RNP containing a long-term repressor fusion protein and gRNA variant having a linked repressor domain exhibits greater binding affinity to the target sequence in the target nucleic acid, wherein the PAM sequence of the target nucleic acid is TTC. In another embodiment, compared to RNPs in comparable assay systems that comprise a long-term repressor fusion protein including a reference dCasX protein with a linked repressor domain and a reference gRNA, an RNP comprising a long-term repressor fusion protein and a gRNA variant with a linked repressor domain exhibits greater binding affinity for the target sequence in the target nucleic acid, wherein the PAM sequence of the target nucleic acid is ATC. In another embodiment, compared to RNPs in comparable assay systems that comprise a long-term repressor fusion protein including a reference dCasX protein with a linked repressor domain and a reference gRNA, an RNP comprising a long-term repressor fusion protein and a gRNA variant with a linked repressor domain exhibits greater binding affinity for the target sequence in the target nucleic acid, wherein the PAM sequence of the target nucleic acid is CTC. In another embodiment, compared to RNPs in comparable assay systems that comprise a long-term repressor fusion protein and a reference gRNA including a reference dCasX protein with a linked repressor domain, an RNP comprising a long-term repressor fusion protein and a reference gRNA exhibits greater binding affinity for the target sequence in the target nucleic acid, wherein the PAM sequence of the target nucleic acid is GTC. In other embodiments, compared to RNPs in comparable assay systems that comprise a reference dCasX protein with a linked repressor domain and a reference repressor fusion protein and gRNA, a long-term repressor fusion protein and a gRNA comprising a dCasX variant with a linked repressor domain exhibits greater binding affinity for the target sequence in the target nucleic acid, wherein the PAM sequence of the target nucleic acid is GTC, TTC, ATC, or CTC. In the foregoing embodiments, the increased binding affinity to one or more PAM sequences is at least 1.5 times greater than the binding affinity of the RNP of any of the reference dCasX proteins (modified by SEQ ID NO: 1-3) having the linked repressor domain and the gRNAs in Table 8 to the PAM sequences.
[0129] c. dCasX variant proteins with domains derived from proteins from multiple sources
[0130] In some embodiments, this disclosure provides chimeric dCasX variant proteins for repressor fusion proteins.
[0131] As used herein, a “chimeric dCasX” protein refers to both a dCasX protein containing at least two domains from different sources and a dCasX protein containing at least one domain that is itself chimeric. Therefore, in some embodiments, a chimeric dCasX protein is a protein comprising at least two domains isolated from or derived from different sources, such as from two different naturally occurring CasX proteins (e.g., from two different CasX reference proteins). In other embodiments, a chimeric dCasX protein is a protein containing at least one domain that is a chimeric domain; for example, in some embodiments, a portion of the domain contains a substitution from a different CasX protein (from a reference CasX protein or another CasX variant).
[0132] In some embodiments, at least one chimeric domain may be any of the NTSB, TSL, helix I, helix II, OBD, or RuvC domains as described herein. In the case of split or discontinuous domains such as helix I, RuvC, and OBD, a portion of the discontinuous domain may be replaced with a corresponding portion from any other source. In some embodiments, the helix I-II domain of the dCasX variant derived from SEQ ID NO: 2 is replaced with the corresponding helix I-II sequence from SEQ ID NO: 1, thereby producing a chimeric dCasX protein. In some embodiments, the helix I-II domain and the NTSB domain of the dCasX variant derived from SEQ ID NO: 2 are replaced with the corresponding helix I-II sequence and the NTSB sequence from SEQ ID NO: 1, thereby producing a chimeric dCasX protein.
[0133] Chimeric dCasX variant proteins may comprise the NTSB, TSL, helix II, helix I-II, helix II, OBD-I, and OBD-II domains from the CasX protein of SEQ ID NO: 2, and the RuvC-I and / or RuvC-II domains from the CasX protein of SEQ ID NO: 1, or vice versa, wherein mutations or other sequence alterations are introduced to produce catalytically dead variants that have improved variant properties relative to the reference dCasX protein. As an example of the foregoing, the chimeric RuvC domain comprises amino acids 660 to 823 of SEQ ID NO: 1 and amino acids 921 to 978 of SEQ ID NO: 2. As an alternative example of the foregoing, the chimeric RuvC domain comprises amino acids 647 to 810 of SEQ ID NO: 2 and amino acids 934 to 986 of SEQ ID NO: 1. In a particular embodiment, the dCasX for the long-term repressor fusion protein comprises an NTSB domain and a helical I-II domain from SEQ ID NO: 1 and a helical II domain from SEQ ID NO: 2; the latter is a chimeric domain. It should be understood that the dCasX variant has additional amino acid changes at selected positions (relative to the reference sequence), and the resulting chimeric dCasX protein has improved properties relative to the reference dCasX protein. The sequences in Table 2 containing the NTSB domain and helical I-II domains from SEQ ID NO: 1 and the helical II domain from SEQ ID NO: 2 include dCasX 491 (SEQ ID NO: 4), 515 (SEQ ID NO: 6), 516 (SEQ ID NO: 7), 518-520 (SEQ ID NO: 9-11), 522-527 (SEQ ID NO: 12-17), 532 (SEQ ID NO: 22), 593 (SEQ ID NO: 25), 676 (with an L169K substitution in the NTSB domain, SEQ ID NO: 28), and 812 (SEQ ID NO: 29). Table 1 below provides the coordinates of the CasX domains in the reference CasX proteins of SEQ ID NO: 1 and SEQ ID NO: 2. Those skilled in the art will understand that the domain boundaries indicated in Table 1 below are approximate, and protein fragments whose boundaries differ from those given in the table by one, two, or three amino acids may have the same activity as the domains described below.
[0134] Table 1: Domain coordinates in the reference CAX protein
[0135]
[0136] In some embodiments, the dCasX variant protein for the long-term repressor fusion protein of this disclosure comprises a sequence selected from the group consisting of SEQ ID NO: 4-29 as shown in Table 2, wherein the long-term repressor fusion protein containing dCasX retains the ability to form an RNP with gRNA. In other embodiments, the dCasX variant protein used for the repressor fusion protein of this disclosure contains a sequence that is at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 86%, at least 87%, at least 88%, at least 89%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to the sequence selected from the group consisting of SEQ ID NO: 4-29 as shown in Table 2. The long-term repressor fusion protein containing dCasX retains the ability to form an RNP with gRNA. In some embodiments, the dCasX variant protein used in the repressor fusion protein of the present disclosure comprises a sequence selected from the group consisting of SEQ ID NO: 4-29, and the long-term repressor fusion protein containing dCasX retains the ability to form an RNP with gRNA. In a particular embodiment, the dCasX variant protein used in the long-term repressor fusion protein of the gene repressor system of the present disclosure comprises the sequence of SEQ ID NO: 4 (dCasX 491). In another particular embodiment, the dCasX variant protein used in the long-term repressor fusion protein of the gene repressor system of the present disclosure comprises the sequence of SEQ ID NO: 6 (dCasX 515). In another particular embodiment, the dCasX variant protein used in the long-term repressor fusion protein of the gene repressor system of the present disclosure comprises the sequence of SEQ ID NO: 28 (dCasX 676). In another particular embodiment, the dCasX variant protein used in the long-term repressor fusion protein of the gene repressor system of the present disclosure comprises the sequence of SEQ ID NO: 29 (dCasX 812).
[0137] Table 2: dCasX variant sequences
[0138]
[0139] d. Affinity to gRNA
[0140] In some embodiments, a long-term repressor fusion protein comprising a dCasX with a linked repressor domain has improved affinity for gRNA relative to a long-term repressor fusion protein comprising a reference dCasX protein with a corresponding linked repressor domain, thereby forming a ribonucleoprotein complex (RNP). For example, the increased affinity of the long-term repressor fusion protein for gRNA can be used to generate the RNP complex K. d Lower Kelvin levels, which in some cases can lead to the formation of more stable ribonucleoprotein complexes. In some embodiments, the long-term repressor fusion protein exhibits a lower Kelvin response to gRNA relative to the reference dCasX protein and the linked repressor domain. d The binding affinity of the long-term repressor fusion protein containing the dCasX variant and the linked repressor domain is increased by at least about 1.1 to about 10 times compared to the corresponding repressor fusion protein containing the catalytically dead variant of the reference CasX protein of SEQ ID NO: 2. In some embodiments, the binding affinity of the long-term repressor fusion protein containing the dCasX variant and the linked repressor domain to gRNA is increased by about 1.1 to about 10 times.
[0141] In some embodiments, the increased affinity of the long-term repressor fusion protein for gRNA results in increased stability of the ribonucleoprotein complex during delivery to mammalian cells, including delivery to a subject. This increased stability can affect the function and utility of the complex in the subject's cells and improve pharmacokinetic properties in the blood upon delivery to the subject. In some embodiments, the increased affinity of the repressor fusion protein and, consequently, the increased stability of the ribonucleoprotein complex allow for delivery of lower doses of the long-term repressor fusion protein to the subject or cells while still retaining the desired activity; for example, in vivo or in vitro gene repression and / or epigenetic modifications. The increased ability to form RNPs and maintain their stable form can be assessed using in vitro assays known in the art.
[0142] In some embodiments, when both the long-term repressor fusion protein and the gRNA are contained within the RNP complex, the higher affinity (tighter binding) of the long-term repressor fusion protein containing the dCasX variant and the linked repressor domain to the gRNA allows for a greater number of transcriptional repression and / or epigenetic modification events. The increased transcriptional repression events can be assessed using the assays described herein.
[0143] Methods for measuring the binding affinity of long-term repressor fusion proteins to gRNAs include in vitro methods using purified long-term repressor fusion proteins and gRNAs. If the gRNA or long-term repressor fusion protein is labeled with a fluorophore, the binding affinity of the repressor fusion protein can be measured by fluorescence polarization. Alternatively or additionally, binding affinity can be measured by biomembrane interferometry, electrophoretic mobility shift assay (EMSA), or filter binding. Other standard techniques for quantifying the absolute binding affinity of the repressor fusion proteins of this disclosure to specific gRNAs include, but are not limited to, isothermal calorimetry (ITC) and surface plasmon resonance (SPR).
[0144] e. Improved specificity for target nucleic acid sequences
[0145] In some embodiments, a long-term repressor fusion protein comprising a dCasX variant with a linked repressor domain exhibits improved specificity to a target nucleic acid sequence complementary to the target sequence of the gRNA, relative to the specificity of a reference dCasX protein with a linked repressor domain to the target nucleic acid sequence. As used herein, “specificity,” sometimes referred to as “target specificity,” refers to the degree to which the RNP complex binds to off-target sequences that are similar to but not identical to the target nucleic acid sequence; for example, a long-term repressor fusion protein RNP with a higher degree of specificity than a reference dCasX with a linked repressor domain would exhibit reduced off-target methylation of the sequence. The specificity of the long-term repressor fusion protein and the reduction of potentially harmful off-target effects may be important for achieving an acceptable therapeutic index for use in mammalian subjects. Without being bound by theory, amino acid variations in the helical I and II domains that increase the specificity of dCasX to the target nucleic acid chain may be possible, thereby increasing the overall specificity of the long-term repressor fusion protein to the target nucleic acid. In some embodiments, amino acid alterations that increase the specificity of the repressor fusion protein to the target nucleic acid may also reduce the affinity of the repressor fusion protein for DNA, but the overall benefit and safety of the composition are enhanced.
[0146] f. Repressor fusion proteins containing heterologous proteins
[0147] Within the scope of this disclosure, repressor fusion proteins comprising a heterologous protein fused to a long-term repressor fusion protein are also considered for use in systems of this disclosure. This includes repressor fusion proteins comprising an N-terminal and / or C-terminal fusion variant with a heterologous protein or its domains. In some embodiments, the long-term repressor fusion protein is fused to one or more proteins or their domains having the activities of interest.
[0148] In some cases, heteropeptides (fusion couplers) used with long-term repressor fusion proteins provide subcellular localization, i.e., the heteropeptides contain subcellular localization sequences (e.g., nuclear localization signals (NLS) for targeting the nucleus, sequences that decouple the fusion protein from the nucleus, nuclear export sequences (NES), sequences that retain the fusion protein in the cytoplasm, mitochondrial localization signals for targeting mitochondria, chloroplast localization signals for targeting chloroplasts, ER retention signals, etc.).
[0149] In some cases, the long-term repressor fusion protein includes a nuclear localization signal (NLS) (fused to it). In some cases, the long-term repressor fusion protein is fused with 2 or more, 3 or more, 4 or more, or 5 or more, 6 or more, 7 or more, or 8 or more NLS. In some cases, one or more NLS (2 or more, 3 or more, 4 or more, or 5 or more NLS) are localized at or near the N-terminus and / or C-terminus of the repressor fusion protein (e.g., within its 20 amino acids). In some cases, one or more NLS (2 or more, 3 or more, 4 or more, or 5 or more NLS) are localized at or near the N-terminus of the repressor fusion protein (e.g., within its 20 amino acids). In some cases, one or more NLS (2 or more, 3 or more, 4 or more, or 5 or more NLS) are localized at or near the C-terminus of the repressor fusion protein (e.g., within its 20 amino acids). In some cases, one or more NLSs (three or more, four or more, or five or more NLSs) are located at or near both the N-terminus and C-terminus of the repressor fusion protein (e.g., within 20 amino acids). In some cases, a single NLS is located at the N-terminus and a single NLS is located at the C-terminus of the repressor fusion protein. Those skilled in the art will understand that NLSs at or near the N-terminus or C-terminus of a protein can be located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids of the N-terminus or C-terminus. In some embodiments, the NLS attached to the N-terminus of the long-term repressor fusion protein and the NLS attached to the C-terminus are the same. In other embodiments, the NLS attached to the N-terminus of the long-term repressor fusion protein and the NLS attached to the C-terminus are different. Representative conformations of repressor fusion proteins with NLSs are as follows: Figure 19As shown in the diagram. In some embodiments, the NLS suitable for use with the long-term repressor fusion protein in the system of this disclosure comprises a sequence having at least about 85%, at least about 90%, or at least about 95% identity with, or the same as, a sequence derived from: an NLS of the simian virus 40 (SV40) large T antigen having the amino acid sequence PKKKRKV (SEQ ID NO: 30); an NLS derived from a nucleoplasmic protein (e.g., a nucleoplasmic protein bipartite NLS having the sequence KRPAATKKAGQAKKKK (SEQ ID NO: 31); or a c-MYC NLS having the amino acid sequences PAAKRVKLD (SEQ ID NO: 32) or RQRRNELKRSP (SEQ ID NO: 33). In some embodiments, the NLS and short peptide linker attached to the N-terminus of the long-term repressor fusion protein are sequences PKKKRKVSR (SEQ ID NO: 34). In some embodiments, the NLS and short peptide linker attached to the N-terminus of the long-term repressor fusion protein are sequences PKKKRKVSRVNGSGSGGG (SEQ ID NO: 21840). In some embodiments, the NLS and short peptide linker attached to the C-terminus of the long-term repressor fusion protein are sequences TSPKKKRKV (SEQ ID NO: 21841). In some embodiments, the NLS attached to or adjacent to the N-terminus of the long-term repressor fusion protein is selected from the group consisting of SEQ ID NO: 34-67. In some embodiments, the NLS attached to or adjacent to the C-terminus of the long-term repressor fusion protein is selected from the group consisting of SEQ ID NO: 68-97. In some embodiments, NLS suitable for use with the long-term repressor fusion protein in the system of this disclosure comprises sequences having at least about 80%, at least about 90%, or at least about 95% identity with one or more sequences in Table 3 or Table 4, or sequences identical thereto. Those skilled in the art will understand that any NLS sequence shown in Tables 3 and 4 may be fused to or adjacent to the N-terminus or C-terminus of the repressor fusion protein described herein.
[0150] Table 3: N-terminal NLS amino acid sequence
[0151]
[0152] Table 4: C-terminal NLS amino acid sequences
[0153]
[0154] In some embodiments, the one or more NLSs are linked to a long-term repressor fusion protein or an adjacent NLS using a connector peptide. In some embodiments, the adapter peptide is selected from the group consisting of: SR, GS, GP, TS, VGS, GGS, (G)n (SEQ ID NO: 98), (GS)n (SEQ ID NO: 99), (GSGGS)n (SEQ ID NO: 100), (GGSGGS)n (SEQ ID NO: 101), (GGGS)n (SEQ ID NO: 102), GGSG (SEQ ID NO: 103), GGSGG (SEQ ID NO: 104), GGSSG (SEQ ID NO: 105), GGSGG (SEQ ID NO: 106), GGGSG (SEQ ID NO: 107), GSSSG (SEQ ID NO: 108), GPGP (SEQ ID NO: 109), GGP, PPP, VPPP, PPAPPA (SEQ ID NO: 110), PPPG (SEQ ID NO: 111), PPPGPPP (SEQ ID NO: 110), and PPPGPPP (SEQ ID NO: 111). 112), PPP(GGGS)n (SEQ ID NO: 113), (GGGS)nPPP (SEQ ID NO: 114), AEAAAKEAAAKEAAAKA (SEQ ID NO: 115), VPPPGGGSGGGSGGGS (SEQ ID NO: 116), TGGGPGGGAAAGSGS (SEQ ID NO: 117), GGGSGGGSGGGGSPPP (SEQ ID NO: 118), TPPKTKRKVEFE (SEQ ID NO: 119), GGSGGGS (SEQ ID NO: 120), GGSGSGG (SEQ ID NO: 121), SSGNSNANSRGPSFSSG LVPLSLRGSH (SEQ ID NO: 122), GGPSSGAPPPSGGSPAGSPTSTE EGTSESATPESGPGTSTEPSEGSAPGSPAGSPTSTEEGTSTEPSEGSAPGTSTEPSE (SEQ ID NO: 123), GGSGGG (SEQ ID NO: 124), GSGS (SEQ ID NO: 1988), GGSGSGSG (SEQ ID NO: 2130), GGSGGGSA (SEQ ID NO: 2131), where n is 1 to 5.
[0155] Generally, NLS (or multiple NLS) possess sufficient strength to drive the accumulation of long-term repressor fusion proteins in the nucleus of eukaryotic cells. Accumulation in the nucleus can be detected using any suitable technique known in the art. For example, detectable markers can be fused with long-term repressor fusion proteins, allowing visualization of their intracellular location. The nucleus can also be isolated from the cell, and its contents can then be analyzed using any suitable method for protein detection, such as immunohistochemistry, Western blotting, or enzyme activity assays. Accumulation in the nucleus can also be determined indirectly.
[0156] IV. Long-term repressor domain fusion protein
[0157] This disclosure provides a system comprising a long-term repressor fusion protein (LTRP) in a designed configuration, the LTRP comprising a DNA-binding protein linked to a plurality of repressor domains, wherein the system is capable of binding to and repressing transcription, including through epigenetic modifications of the target nucleic acid. Exemplary DNA-binding proteins for fusion proteins include zinc finger proteins (ZF), TALE (transcription activator-like effector) proteins, and catalytically dead CRISPR proteins.
[0158] In some embodiments, this disclosure provides a repressor fusion protein system comprising a catalytically dead CasX variant protein (dCasX) linked to a plurality of repressor domains, capable of binding to the target nucleic acid and repressing or silencing transcription and / or influencing epigenetic modifications of the target nucleic acid when the repressor fusion protein is complexed with a guide ribonucleic acid (gRNA) containing a target sequence complementary to the target nucleic acid sequence of a gene. Examples of gene repression processes that reduce transcription include, but are not limited to: gene repression processes that inhibit the formation of the transcription initiation complex, gene repression processes that reduce the rate of transcription initiation, gene repression processes that reduce the rate of transcriptional elongation, gene repression processes that reduce the sustained synthetic capacity of transcription, and gene repression processes that antagonize transcriptional activation (e.g., by blocking the binding of transcriptional activators). For example, gene repression can constitute prevention of activation and suppression of expression below existing levels. Transcriptional repression includes both reversible and irreversible inactivation of gene transcription; the latter may be caused by epigenetic modifications of the target nucleic acid.
[0159] Among repressor domains capable of repressing or silencing genes, the Krüppel-associated box (KRAB) repressor domain is the most powerful in the human genome system (Alerasool, N. et al., An efficient KRAB domain for CRISPRi applications. Nature Methods 17:1093 (2020)). KRAB-like domains are present in approximately 400 human zinc finger-based transcription factors that, upon binding of their linked dCasX to target nucleic acids, recruit additional repressor domains, such as, but not limited to, Trim28 (also known as Kap1 or Tif1-β). These repressor domains then assemble into protein complexes with chromatin regulators such as CBX5 / HP1α and SETDB1, inducing transcriptional repression of genes, but in a finite-time manner, involving modifications of DNA-associated histones rather than DNA itself. By reducing histone H3 acetylation and increasing H3 lysine 9 trimethylation at the cellular level, KRAB / KAP1 mediates reversible and long-range transcriptional repression via heterochromatin diffusion. Representative non-limiting examples of the KRAB domain include ZIM3 (SEQ ID NO: 129 and 1892) and ZNF10 (SEQ ID NO: 128 and 1891). This disclosure provides repressor domains derived from humans, as well as repressor domains derived from non-humans with significantly different sequences (referred to herein as “RD1”), which have been found to enhance transcriptional repression compared to ZIM3 and ZNF10 when integrated into long-term repressor fusion protein constructs, as described more fully below.
[0160] In some embodiments, this disclosure provides a system in which modifications to genes made using the LTRP:gRNA system are epigenetic, and therefore gene silencing can be inherited through mechanisms other than DNA editing replication. As used herein, “epigenetic modification” means modification of DNA or DNA-associated histones, rather than alteration of the DNA sequence itself (e.g., substitution, deletion, or rearrangement), wherein the modification is performed by direct modification of system components or indirectly by recruiting one or more additional cellular components, but wherein the DNA target nucleic acid sequence itself is not edited to change the sequence. For example, DNA methyltransferase 3A (DNMT3A) (or its catalytic domain) directly modifies DNA by methylation, while KRAB recruits the KAP-1 / TIF1β co-repressor complex, which acts as an effective transcriptional repressor, and can further recruit factors associated with DNA methylation and the formation of repressive chromatin, such as heterochromatin protein 1 (HP1), histone deacetylase, and histone methyltransferase (Ying, Y. et al. The Krüppel-associated box repressor domain induces reversible and irreversible regulation of endogenous mouse genes by mediating different chromatin states. Nucleic Acids Res. 43(3):1549 (2015)). Furthermore, catalytically inactivated DNMT3-like (DNMT3L) cofactors, together with the cell's endogenous DNMT1, contribute to the establishment of a heritable methylation pattern after DNA replication.The ATRX-DNMT3-DNMT3L (ADD) domain of DNMT3A is known to have two key functions: 1) it allosterically regulates the catalytic activity of DNMT3A by acting as a self-inhibitory domain of methyltransferases; and 2) it specifically interacts with the unmethylated histone H3 tail at lysine (K)4 (H3K4me0), resulting in preferential methylation of DNA bound to the unmethylated chromatin H3 tail at K4 (Zhang, Y. et al., Chromatin methylation activity of Dnmt3a and Dnmt3a / 3L is guided by interaction of the ADD domain with the histone H3 tail. Nucleic Acid Research 38:4246(2010)). In some embodiments, the inclusion of the ADD domain enhances transcriptional repression of the target gene when incorporated into an LTRP design, compared to other aspects of an LTRP lacking the ADD domain. In other embodiments, the inclusion of the ADD domain enhances the specificity of transcriptional repression of the target gene when incorporated into an LTRP design, compared to other aspects of an LTRP lacking the ADD domain. Supporting data for the foregoing are provided in examples and in WO2023049742A2 (incorporated herein by reference).
[0161] In some embodiments, the long-term repressor fusion protein comprises a DNA-binding protein linked to a first repressor domain, a second repressor domain, and a third repressor domain, wherein each repressor domain is distinct. In some embodiments, the long-term repressor fusion protein comprises a DNA-binding protein linked to a first repressor domain, a second repressor domain, a third repressor domain, and a fourth repressor domain, wherein each repressor domain is distinct. In any of the foregoing embodiments, the long-term fusion protein is capable of forming an RNP with the system's gRNA that binds to the target nucleic acid.
[0162] In some embodiments, the DNA-binding protein is a TALE that can bind to but not cleave target nucleic acids. In some embodiments, the DNA-binding protein is a zinc finger protein modified to bind to but not cleave target nucleic acids. In some embodiments, the DNA-binding protein is a catalytically dead CRISPR protein that can bind to but not cleave target nucleic acids. In some embodiments, the long-term repressor fusion protein comprises a catalytically dead CRISPR protein sequence, a first repressor domain (hereinafter referred to as "RD1"), a DNMT3A catalytic domain (hereinafter referred to as "DNMT3A") from the DNMT3A protein as a second domain, and a DNMT3L interaction domain (hereinafter referred to as "DNMT3L") from the DNMT3L protein as a third domain. In some embodiments, the long-term repressor fusion protein comprises a catalytically dead CRISPR protein sequence, RD1, DNMT3A as a second domain, DNMT3L as a third domain, and an ATRX-DNMT3-DNMT3L domain (hereinafter referred to as "ADD") from the DNMT3A protein as a fourth domain. In some embodiments, the long-term repressor fusion protein further comprises first and second NLS and one or more adaptor peptides described herein. In some embodiments, the long-term repressor fusion protein is capable of forming an RNP with gRNA that binds to the target nucleic acid. It has been found that when the aforementioned domains are selectively oriented relative to DNA-binding proteins in the long-term repressor fusion protein, binding to the defined region of the gene to be silenced can induce significant epigenetic modifications of the target nucleic acid, and the combination of repressor domains acts synchronously, thereby causing an additive or synergistic effect of transcriptional silencing of the target gene, depending on the conformation.
[0163] This document provides representative amino acid sequences of components used in the construction of a long-term repressor fusion protein. In some embodiments, the DNA-binding protein of the long-term repressor fusion protein is dCasX, which comprises a sequence selected from the group consisting of SEQ ID NO: 4-29 or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments, the DNA-binding protein of the long-term repressor fusion protein is dCasX, which comprises a sequence of SEQ ID NO: 4 or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments, the DNA-binding protein of the long-term repressor fusion protein is dCasX, which comprises the sequence of SEQ ID NO: 4. In some embodiments, the DNA-binding protein of the long-term repressor fusion protein is dCasX, which comprises the sequence of SEQ ID NO: 5 or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments, the DNA-binding protein of the long-term repressor fusion protein is dCasX, which comprises the sequence of SEQ ID NO: 28 or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments, the DNA-binding protein of the long-term repressor fusion protein is dCasX, which comprises the sequence of SEQ ID NO: 29 or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it.
[0164] In some embodiments, the RD1 of the long-term repressor fusion protein comprises a sequence selected from the group consisting of SEQ ID NO: 1891 and SEQ ID NO: 1892, or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments, the RD1 of the long-term repressor fusion protein comprises a sequence selected from the group consisting of SEQ ID NO: 1891 and SEQ ID NO: 1892. In another embodiment, the RD1 of the long-term repressor fusion protein comprises a sequence selected from the group consisting of SEQ ID NO: 130-1726, or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In another embodiment, RD1 of the long-term repressor fusion protein comprises a sequence selected from the group consisting of SEQ ID NO: 130-1726. In another embodiment, RD1 of the long-term repressor fusion protein comprises a sequence selected from the group consisting of SEQ ID NO: 130-224, or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In another embodiment, RD1 of the long-term repressor fusion protein comprises a sequence selected from the group consisting of SEQ ID NO: 130-224. In another embodiment, the RD1 of the long-term repressor fusion protein comprises a sequence selected from the group consisting of SEQ ID NO: 130-138, or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In another embodiment, the RD1 of the long-term repressor fusion protein comprises a sequence selected from the group consisting of SEQ ID NO: 130-138. In another embodiment, the RD1 of the long-term repressor fusion protein comprises the sequence of SEQ ID NO: 135, or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it.In another embodiment, RD1 of the long-term repressor fusion protein comprises the sequence of SEQ ID NO: 131 or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In another embodiment, RD1 of the long-term repressor fusion protein comprises the sequence of SEQ ID NO: 130 or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In another embodiment, RD1 of the long-term repressor fusion protein comprises a sequence selected from the group consisting of SEQ ID NOs: 130, 131, and 135.
[0165] In some embodiments, the second repressor domain of the long-term repressor fusion protein is DNMT3A, which comprises the sequence of SEQ ID NO: 126 or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments, the second repressor domain of the long-term repressor fusion protein comprises the sequence of SEQ ID NO: 126.
[0166] In some embodiments, the third repressor domain of the long-term repressor fusion protein is DNMT3L, which comprises the sequence of SEQ ID NO: 127 or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments, the third repressor domain of the long-term repressor fusion protein comprises the sequence of SEQ ID NO: 127.
[0167] In some embodiments, the fourth repressor domain of the long-term repressor fusion protein is an ADD comprising the sequence of SEQ ID NO: 125 or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments, the fourth repressor domain of the long-term repressor fusion protein comprises the sequence of SEQ ID NO: 125. In some embodiments, the C-terminus of the ADD is linked to the N-terminus of DNMT3A. In a surprising finding, it has been discovered that the addition of the ADD to constructs containing DNA-binding proteins, RD1, DNMT3A, and DNMT3L significantly enhances or increases the long-term repression and / or epigenetic modification of the target nucleic acids, as well as the specificity of the repression, compared to constructs lacking the ADD. Exemplary data on transcriptional repression and specificity improvement of constructs containing ADD are presented in the examples and described in WO2023049742A2 (incorporated herein by reference).
[0168] This disclosure provides a system comprising a long-term repressor fusion protein, the long-term repressor fusion protein comprising a first repressor domain, a second repressor domain, a third repressor domain, and optionally a fourth repressor domain operably linked to a DNA-binding protein, wherein the DNA-binding protein is a dCasX containing the sequence of SEQ ID NO: 4 or having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it, and the second repressor domain is a dCasX containing the sequence of SEQ ID NO: 4. The third repressor is a DNMT3A domain comprising the sequence of SEQ ID NO: 126 or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it; and the fourth repressor is a DNMT3L domain comprising the sequence of SEQ ID NO: 127 or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it; and the fourth repressor is a DNMT3L domain comprising SEQ ID NO: 127. The ADD domain is an A sequence of NO:125 or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments, the long-term repressor fusion protein comprises a first repressor domain, a second repressor domain, a third repressor domain, and optionally a fourth repressor domain operatively linked to a DNA-binding protein, wherein the DNA-binding protein is a dCasX comprising a sequence selected from the group consisting of SEQ ID NO: 4-29, the second repressor domain is a DNMT3A domain comprising the sequence of SEQ ID NO: 126, the third repressor is a DNMT3L domain comprising the sequence of SEQ ID NO: 127, and the fourth repressor is an ADD domain comprising the sequence of SEQ ID NO: 125. In some embodiments, the long-term repressor fusion protein comprises one or more adaptor peptides selected from the group consisting of: SEQ ID NO: 98-124, 1823-1874, 1988 and 2130-2131 (Table 5).In some embodiments, the long-term repressor fusion protein comprises one or more NLSs, said NLS comprising sequences selected from the group consisting of SEQ ID NOs: 30, 32, 34, and 21841. In some embodiments, the first RD1 comprises a sequence selected from the group consisting of SEQ ID NOs: 130-1726 or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments, the first RD1 comprises a sequence selected from the group consisting of SEQ ID NOs: 130-1726. In other embodiments of the long-term repressor protein, the first RD1 comprises a sequence selected from the group consisting of SEQ ID NO: 130-224 or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In other embodiments of the long-term repressor protein, the first RD1 comprises a sequence selected from the group consisting of SEQ ID NO: 130-224. In other embodiments of the long-term repressor protein, the first RD1 comprises a sequence selected from the group consisting of SEQ ID NO: 130-138 or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In other embodiments of the long-term repressor protein, the first RD1 comprises a sequence selected from the group consisting of SEQ ID NO: 130-138. In other embodiments of the long-term repressor protein, the first RD1 comprises the sequence of SEQ ID NO: 135 or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In other embodiments of the long-term repressor protein, the first RD1 comprises the sequence of SEQ ID NO: 135. In other embodiments of the long-term repressor protein, the first RD1 comprises the sequence of SEQ ID NO: 131 or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it.In other embodiments of the long-term repressor protein, the first RD1 comprises the sequence of SEQ ID NO: 131. In other embodiments of the long-term repressor protein, the first RD1 comprises the sequence of SEQ ID NO: 130 or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In other embodiments of the long-term repressor protein, the first RD1 comprises the sequence of SEQ ID NO: 130. In other embodiments of the long-term repressor protein, the first RD1 comprises a sequence selected from the group consisting of SEQ ID NO: 130, 131, and 135. In some embodiments, the long-term repressor protein embodiments of this paragraph are capable of forming an RNP with the gRNA of this disclosure, said gRNA binding to a target gene and repressing or silencing the expression of the target gene.
[0169] In some embodiments, the long-term repressor fusion protein comprises DNMT3A, DNMT3L, a DNA-binding protein, and RD1 from its N-terminus to its C-terminus. In some embodiments, the long-term repressor fusion protein comprises ADD, DNMT3A, DNMT3L, a DNA-binding protein, and RD1 from its N-terminus to its C-terminus. In some embodiments, the DNA-binding protein may be a zinc finger, TALE, or a catalytically dead CRISPR protein. In some embodiments, the long-term repressor fusion protein comprises NLS at its N-terminus, C-terminus, or both. In some embodiments, the long-term repressor fusion protein comprises one or more linkers between DNMT3A and DNMT3L, between DNMT3L and the DNA-binding protein, and / or between the DNA-binding protein and RD1.
[0170] In some embodiments, the long-term repressor fusion protein comprises a DNA-binding protein, RD1, DNMT3A, and DNMT3L from its N-terminus to its C-terminus. In some embodiments, the long-term repressor fusion protein comprises a DNA-binding protein, RD1, ADD, DNMT3A, and DNMT3L from its N-terminus to its C-terminus. In some embodiments, the DNA-binding protein may be a zinc finger, TALE, or a catalytically dead CRISPR protein. In some embodiments, the long-term repressor fusion protein comprises an NLS at its N-terminus. In some embodiments, the long-term repressor fusion protein comprises an NLS between RD1 and DNMT3A. In some embodiments, the long-term repressor fusion protein comprises an NLS at its N-terminus, C-terminus, or both. In some embodiments, the long-term repressor fusion protein comprises one or more linkers between the N-terminal NLS and the DNA-binding protein, between the DNA-binding protein and RD1, between RD1 and DNMT3A or optionally ADD, and / or between DNMT3A and DNMT3A.
[0171] In some embodiments, the long-term repressor fusion protein comprises a DNA-binding protein, DNMT3A, DNMT3L, and RD1 from its N-terminus to its C-terminus. In some embodiments, the long-term repressor fusion protein comprises a DNA-binding protein, ADD, DNMT3A, DNMT3L, and RD1 from its N-terminus to its C-terminus. In some embodiments, the DNA-binding protein may be a zinc finger, TALE, or a catalytically dead CRISPR protein. In some embodiments, the long-term repressor fusion protein comprises an NLS at its N-terminus, C-terminus, or both. In some embodiments, the long-term repressor fusion protein comprises one or more linkers between the N-terminal NLS and the DNA-binding protein, between the DNA-binding protein and DNMT3A or optionally ADD, between DNT3A and DNMT3L, and / or between DNMT3L and RD1.
[0172] In some embodiments, the long-term repressor fusion protein comprises RD1, DNMT3A, DNMT3L, and a DNA-binding protein from the N-terminus to the C-terminus. In some embodiments, the long-term repressor fusion protein comprises RD1, ADD, DNMT3A, DNMT3L, and a DNA-binding protein from the N-terminus to the C-terminus. In some embodiments, the DNA-binding protein may be a zinc finger, TALE, or a catalytically dead CRISPR protein. In some embodiments, the long-term repressor fusion protein comprises NLS at the N-terminus, C-terminus, or both. In some embodiments, the long-term repressor fusion protein comprises one or more linkers between RD1 and DNMT3A or optionally ADD, between DNMT3A and DNMT3L, between DNMT3L and the DNA-binding protein, and / or between the DNA-binding protein and the C-terminal NLS.
[0173] In some embodiments, the long-term repressor fusion protein comprises DNMT3A, DNMT3L, RD1, and a DNA-binding protein from the N-terminus to the C-terminus. In some embodiments, the long-term repressor fusion protein comprises ADD, DNMT3A, DNMT3L, RD1, and a DNA-binding protein from the N-terminus to the C-terminus. In some embodiments, the DNA-binding protein may be a zinc finger, TALE, or a catalytically dead CRISPR protein. In some embodiments, the long-term repressor fusion protein comprises NLS at the N-terminus, C-terminus, or both. In some embodiments, the long-term repressor fusion protein comprises one or more linkers between DNMT3A and DNMT3L, between DNMT3L and RD1, between RD1 and the DNA-binding protein, and / or between the DNA-binding protein and the C-terminal NLS.
[0174] In some embodiments, the long-term repressor fusion protein comprises DNMT3A, DNMT3L, RD1, a DNA-binding protein, and a second RD1 from the N-terminus to the C-terminus. In some embodiments, the long-term repressor fusion protein comprises ADD, DNMT3A, DNMT3L, RD1, a DNA-binding protein, and a second RD1 from the N-terminus to the C-terminus. In one of the foregoing embodiments, the second RD1 may be sequence-identical to the first RD1. In another of the foregoing embodiments, the second RD1 may be sequence-different from the first RD1. In some embodiments, the DNA-binding protein may be a zinc finger, TALE, or a catalytically dead CRISPR protein. In some embodiments, the long-term repressor fusion protein comprises NLS at the N-terminus, C-terminus, or both. In some embodiments, the long-term repressor fusion protein comprises one or more linkers between DNMT3A and DNMT3L, between DNMT3L and RD1, between RD1 and the DNA-binding protein, between the DNA-binding protein and the second RD1, and / or between the second RD1 and the C-terminal NLS.
[0175] In some cases, the long-term repressor fusion protein further comprises one or more NLS. In some embodiments, the long-term repressor fusion protein comprises NLS-ADD-DNMT3A-DNMT3L-DNA-binding protein-RD1-NLS, NLS-DNA-binding protein-RD1-NLS-ADD-DNMT3A-DNMT3L, NLS-DNA-binding protein-ADD-DNMT3A-DNMT3L-RD1-NLS, NLS-RD1-ADD-DNMT3A-DNMT3L-DNA-binding protein-NLS, NLS-ADD-DNMT3A-DNMT3L-RD1-DNA-binding protein-NLS, or NLS-ADD-DNMT3A-DNMT3L-RD1-DNA-binding protein-RD1-NLS. In some embodiments, the DNA-binding protein may be a zinc finger, TALE, or a catalytically dead CRISPR protein. In some embodiments, the long-term repressor fusion protein can form an RNP with the gRNA embodiments of this disclosure and can bind to the target nucleic acid of a gene, thereby repressing or silencing the target nucleic acid of the gene.
[0176] In some embodiments, the long-term repressor fusion protein, one or more adaptor peptides may be inserted between any two adjacent domains of the long-term repressor fusion protein. In some embodiments, the long-term repressor fusion protein comprises an N-terminal to C-terminal NLS-ADD-DNMT3A-adaptor 2-DNMT3L-adaptor 1-adaptor 3A-DNA binding protein-adaptor 3B-RD1-NLS (configuration 1). In some embodiments, the long-term repressor fusion protein comprises an N-terminal to C-terminal NLS-adaptor 3A-DNA binding protein-adaptor 3B-RD1-NLS-adaptor 1-ADD-DNMT3A-adaptor 2-DNMT3L (configuration 2). In some embodiments, the long-term repressor fusion protein comprises an N-terminal to C-terminal NLS-adaptor 3A-DNA binding protein-adaptor 1-ADD-DNMT3A-adaptor 2-DNMT3L-adaptor 3B-RD1-NLS (configuration 3). In some embodiments, the long-term repressor fusion protein comprises an N-terminal to C-terminal NLS-RD1-connector 3A-ADD-DNMT3A-connector 2-DNMT3L-connector 1-DNA binding protein-connector 3B-NLS configuration (configuration 4). In some embodiments, the long-term repressor fusion protein comprises an N-terminal to C-terminal NLS-ADD-DNMT3A-connector 2-DNMT3L-connector 3A-RD1-connector 1-DNA binding protein-connector 3B-NLS configuration (configuration 5). In some embodiments, the DNA binding protein of the aforementioned configurations may be a zinc finger, TALE, or a catalytically dead CRISPR protein. Figure 19A schematic diagram of the configurations depicted is shown. In some embodiments of the LTRP in configurations 1-5, the NLS may comprise sequences selected from the group consisting of SEQ ID NO: 30-97 (Tables 3 and 4), and the connector sequences may comprise sequences independently selected from the group consisting of SEQ ID NO: 98-124, 1823-1874, 1988, and 2130-2131 (representative connectors shown in Table 5). In some embodiments of the LTRP, one or more NLS may comprise a sequence of SEQ ID NO: 30, and the one or more connector sequences may independently comprise sequences selected from the group consisting of SEQ ID NO: 120 and 122-124. In some embodiments of the LTRP, the DNA-binding protein may be a dCasX sequence selected from the group consisting of SEQ ID NO: 4-29, or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments of the LTRP with configurations 1-5, the second repressor domain is a DNMT3A domain comprising the sequence of SEQ ID NO: 126, or a sequence variant having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments of LTRP, the third repressor is a DNMT3L domain comprising the sequence of SEQ ID NO: 127 or a sequence variant having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments of LTRP, the fourth repressor is an ADD domain comprising the sequence of SEQ ID NO: 125 or a sequence variant having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments, the long-term repressor fusion protein is in one of configurations 1-5, such as... Figure 19 As shown in the illustration. In some embodiments, LTRP can form an RNP with the gRNA of this disclosure, and the RNP can bind to the target nucleic acid of a gene and repress or silence the target nucleic acid of the gene.
[0177] In some embodiments, this disclosure provides a system comprising a long-term repressor fusion protein comprising two copies of a first repressor domain (RD1), a second repressor domain, a third repressor domain, and a fourth repressor domain operatively linked to a DNA-binding protein; such as a zinc finger protein, a TALE protein, or a catalytically dead CRISPR protein. In some embodiments, the DNA-binding protein may be a catalytically dead CasX selected from the group consisting of SEQ ID NO: 4-29, or a sequence having at least 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with it. In some embodiments, the DNA-binding protein may be the catalytically dead CasX sequence of SEQ ID NO: 4. In some embodiments, the two copies of RD1 have identical sequences. In other embodiments, the two RD1s have different sequences. In some embodiments, the two copies of RD1 are located at the N-terminus of the DNA-binding protein. In some embodiments, two copies of RD1 are located at the C-terminus of the DNA-binding protein. In some embodiments, one copy of RD1 is located at the N-terminus of the DNA-binding protein, and another copy of RD1 is located at the C-terminus of the DNA-binding protein.
[0178] In some embodiments, the long-term repressor fusion protein comprises two RD1s. In some embodiments, the long-term repressor fusion protein comprises an N-terminal to C-terminal NLS-ADD-DNMT3A-connector 2-DNMT3L-connector 3A-RD1a-connector 1-DNA binding protein-connector 3B-RD1a-connector 4-NLS conformation (conformation 6a), wherein the RD1a sequence is identical (see [link to documentation]). Figure 19 (Schematic diagram of the fusion protein). In some embodiments, the long-term repressor fusion protein comprises the N-terminal to C-terminal NLS-ADD-DNMT3A-linker 2-DNMT3L-linker 3A-RD1a-linker 1-DNA binding protein-linker 3B-RD1b-linker 4-NLS conformation (conformation 6b), wherein the RD1a and RD1b sequences are distinct (see [reference]). Figure 19 (Illustrative diagram of a fusion protein). In some embodiments, the DNA-binding protein may be a zinc finger, TALE, or a catalytically dead CRISPR protein. In some embodiments, the long-term repressor protein examples of this paragraph are capable of forming an RNP with the gRNA of this disclosure, which binds to a target gene and represses or silences the expression of the target nucleic acid.
[0179] In some embodiments, this disclosure provides a long-term repressor fusion protein of configuration 6a, wherein the two RD1 sequences are identical. In some embodiments of the long-term repressor fusion protein of configuration 6a, wherein the two copies of RD1 are identical, the DNA-binding protein comprises dCasX of the sequence of SEQ ID NO: 4 or a sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it, the first and second copies of the first repressor domain (RD1a) comprise a sequence selected from the group consisting of SEQ ID NO: 130-1726 or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, or at least about 95% identity with it, and the second repressor domain is DNMT3A, which comprises SEQ ID NO: The third repressor is DNMT3L, which contains the sequence of SEQ ID NO: 127 or a sequence variant thereof having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. The fourth repressor is ADD, which contains SEQ ID NO: 127. The sequence NO:125 or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it, the NLS contains sequences independently selected from the group consisting of SEQ ID NO: 30-97 (Tables 3 and 4), the L1 connector contains the sequence of SEQ ID NO: 123, the L2 connector contains the sequence of SEQ ID NO: 122, the L3A connector contains the sequence of SEQ ID NO: 124, the L3B connector contains the sequence of SEQ ID NO: 120, and the L4 connector contains the sequence of SEQ ID NO: 1988 or SEQ ID NO: 2130.In some embodiments of the long-term repressor fusion protein of configuration 6a, the adapter sequence is independently selected from the group consisting of: SEQ ID NO: 98-124, 1823-1874, 1988, and 2130-2131 (exemplary adapters shown in Table 5). In some embodiments of the long-term repressor fusion protein of configuration 6a, wherein the two copies of RD1 are identical, each RD1 comprising a sequence independently selected from the group consisting of SEQ ID NO: 130, 131, and 135, or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, or at least about 95% identity with it. In some embodiments, the DNA-binding protein may be the catalytically dead CasX sequence of SEQ ID NO: 4. A schematic diagram of configuration 6a is shown in [reference needed]. Figure 19 As shown in the figure. In some embodiments, the long-term repressor fusion protein of configuration 6a can form an RNP with the gRNA of this disclosure and can bind to the gene target nucleic acid, thereby repressing or silencing the gene target nucleic acid.
[0180] In some embodiments of the long-term repressor fusion protein of configuration 6b, wherein the two copies of RD1 are distinct, the DNA-binding protein comprises dCasX of the sequence of SEQ ID NO: 4 or a sequence having at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it, the first copy of the first repressor domain (RD1a) comprises a sequence selected from the group consisting of SEQ ID NO: 130-1726 or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, or at least about 95% identity with it, and the second copy of the first repressor domain (RD1b) comprises a sequence selected from the group consisting of SEQ ID NO: 4. The sequence comprising group 130-1726 or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, or at least about 95% identity with it; the second repressor domain is DNMT3A, which contains the sequence of SEQ ID NO: 126 or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it; the third repressor is DNMT3L, which contains SEQ ID NO: The fourth repressor is an ADD comprising the sequence of SEQ ID NO: 127 or a sequence variant thereof having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. The NLS comprises a sequence independently selected from the group consisting of SEQ ID NO: 30-97 in Tables 3 and 4. The L1 connector comprises the sequence of SEQ ID NO: 123, the L2 connector comprises the sequence of SEQ ID NO: 122, and the L3A connector comprises the sequence of SEQ ID NO: 123. The sequence 124, the L3B connector contains the sequence of SEQ ID NO: 120,Furthermore, the L4 adapter contains the sequence of SEQ ID NO: 1988 or SEQ ID NO: 2130. In some embodiments of the long-term repressor fusion protein of configuration 6b, the adapter sequence is independently selected from the group consisting of: SEQ ID NO: 98-124, 1823-1874, 1988 and 2130-2131 (exemplary sequences shown in Table 5). In some embodiments of the long-term repressor fusion protein of configuration 6b, the two copies of RD1 are distinct, wherein RD1a contains the sequence of SEQ ID NO: 130 or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, or at least about 95% identity with it, and RD1b contains the sequence of SEQ ID NO: 131 or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, or at least about 95% identity with it. In some embodiments of the long-term repressor fusion protein of configuration 6b, the two copies of RD1 are distinct, with RD1a containing the sequence of SEQ ID NO: 130 or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, or at least about 95% identity with it, and RD1b containing the sequence of SEQ ID NO: 135 or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, or at least about 95% identity with it. In some embodiments of the conformation 6b long-term repressor fusion protein, the two copies of RD1 are distinct, with RD1a comprising the sequence of SEQ ID NO: 131 or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, or at least about 95% identity with it, and RD1b comprising the sequence of SEQ ID NO: 130 or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, or at least about 95% identity with it. In some embodiments of the conformation 6b long-term repressor fusion protein, the two copies of RD1 are distinct, with RD1a comprising the sequence of SEQ ID NO: 131 or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, or at least about 95% identity with it.Furthermore, RD1b contains the sequence of SEQ ID NO: 135 or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, or at least about 95% identity with it. In some embodiments of the conformation 6b long-term repressor fusion protein, wherein the two copies of RD1 are distinct, RD1a contains the sequence of SEQ ID NO: 135 or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, or at least about 95% identity with it, and RD1b contains the sequence of SEQ ID NO: 130 or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, or at least about 95% identity with it. In some embodiments of the conformation 6b long-term repressor fusion protein, the two copies of RD1 are distinct, RD1a comprising the sequence of SEQ ID NO: 135 or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, or at least about 95% identity with it, and RD1b comprising the sequence of SEQ ID NO: 131 or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, or at least about 95% identity with it. In some embodiments of the conformation 6b long-term repressor fusion protein, the two copies of RD1 are distinct, and RD1a and RD1b are independently selected from the group consisting of sequences of SEQ ID NO: 132-134 and 136-138. In some embodiments of the long-term repressor fusion protein of configuration 6b, the two copies of RD1 are distinct, with RD1a and Rd1b independently selected from the group consisting of sequences SEQ ID NO: 130, 131, and 135. A schematic diagram of configuration 6b is shown below. Figure 19 As shown in the diagram. In some embodiments of the long-term repressor fusion protein of configuration 6b, the DNA-binding protein may be the catalytically dead CasX sequence of SEQ ID NO: 4. In some embodiments, the long-term repressor fusion protein is capable of forming an RNP with the gRNA of this disclosure and is capable of binding to the gene target nucleic acid and repressing or silencing the gene target nucleic acid.
[0181] Table 5: Exemplary combinations of linker amino acid sequences for repressor fusion proteins
[0182]
[0183] In some embodiments, the long-term repressor fusion protein comprises dCasX and optionally ADD, and is configured as configuration 1. In some embodiments, the long-term repressor protein comprises a sequence selected from the group consisting of SEQ ID NO: 21903-21922, or a sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least 99% identity with it. In some embodiments of the long-term repressor fusion protein, the long-term repressor fusion protein comprises dCasX and optionally ADD, and is configured as configuration 1, the long-term repressor protein comprising a sequence selected from the group consisting of SEQ ID NO: 21903-21922. In some embodiments of the long-term repressor fusion protein, the long-term repressor fusion protein comprises dCasX and optionally ADD, and is configured as configuration 1, the long-term repressor protein comprising a sequence selected from the group consisting of SEQ ID NO: 21905 and 21914. In some embodiments of the long-term repressor fusion protein, the long-term repressor fusion protein comprises dCasX and optionally ADD, and is configured as conformation 1, wherein the long-term repressor protein comprises a sequence selected from the group consisting of SEQ ID NO: 21906 and 21915. In some embodiments of the long-term repressor fusion protein, the long-term repressor fusion protein comprises dCasX and optionally ADD, and is configured as conformation 1, wherein the long-term repressor protein comprises a sequence selected from the group consisting of SEQ ID NO: 21907 and 21916.
[0184] like Figure 19As shown and described above, this disclosure provides long-term repressor fusion proteins of configurations 1, 2, 3, 4, 5, 6a, and 6b, wherein the long-term repressor fusion protein is capable of complexing with a gRNA having a target sequence complementary to a target nucleic acid of a gene in the cell to form an RNP. When the RNP binds to the target nucleic acid of a target gene in the cell, the nucleic acid of the gene is epigenetically modified, and transcription of the gene is repressed. In some embodiments, transcription of the gene is repressed by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least 99%. In some embodiments, transcription of a gene is repressed in at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, or more of the cells in the cell population. Most preferably, gene repression completely suppresses gene expression, making the gene product undetectable. However, those skilled in the art will understand that incomplete suppression remains useful and desirable for various applications. In some embodiments, when measured in an in vitro assay including a cell-based assay, the repression of gene transcription lasts for at least about 8 hours, at least about 1 day, at least about 7 days, at least 2 weeks, at least about 3 weeks, at least about 1 month, or at least about 2 months. In some embodiments, the repression of gene transcription lasts for at least about 7 days, at least 2 weeks, at least about 3 weeks, at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, or at least about 6 months or longer in the target cells. In some embodiments, when used in the LTRP:gRNA system of the embodiments, the use of long-term repressor fusion protein conformations 1, 4, 5, 6a, and 6b results in off-target methylation or off-target activity in cells of less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, less than about 1%, less than 0.5%, or less than 0.1%. In some embodiments, transcriptional repression in cells treated with the LTRP:gRNA system of the embodiments is heritable and stable in one or more cell divisions. In some embodiments, transcriptional repression is stable in 1, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 cell divisions or more. In some embodiments, transcriptional repression is determined in vitro (including cell-based assays), and transcriptional repression is compared with untreated cells or cells treated with a comparable system in which the gRNA contains a non-targeting spacer.In some embodiments, transcriptional repression is measured in vivo in cells obtained from a subject, wherein a long-term repressor fusion protein and a gRNA having a target sequence complementary to a target nucleic acid of a gene in the cell are administered, as a protein and gRNA or as a nucleic acid (e.g., gRNA and mRNA encoding the long-term repressor fusion protein), wherein the subject is selected from the group consisting of mice, rats, pigs, non-human primates, and humans.
[0185] V. mRNA composition encoding long-term repressor fusion protein
[0186] On the other hand, this disclosure relates to messenger RNA (mRNA) compositions comprising the sequences of individual components of the long-term repressor domain fusion protein construct of this disclosure, as well as the full-length mRNA sequence. When used to express the long-term repressor fusion protein, the mRNA composition can be used for transcriptional repression and epigenetic modification of a gene. In some cases, the mRNA composition is designed for use in certain delivery formulations; for example, nanoparticles, such as synthetic nanoparticles or lipid nanoparticles (LNPs). This disclosure also provides methods for designing mRNA sequences of mRNAs used in compositions and formulations for delivery of the compositions. In some cases, the mRNA encoding the long-term repressor fusion protein can be co-regulated in nanoparticles with gRNA containing a targeting sequence complementary to a target nucleic acid sequence of a gene to be transcriptionally repressed or silenced, wherein, after delivery of the nanoparticles to target cells, the long-term repressor domain fusion protein is expressed from the mRNA and can be complexed with the gRNA as an RNP capable of binding to the target nucleic acid. In other cases, the mRNA and gRNA encoding the long-term repressor domain fusion protein can be regulated in separate nanoparticles and delivered individually or as a mixture.
[0187] In some embodiments, the mRNA composition has been modified relative to unmodified mRNA encoding the same long-term repressor protein to improve one or more properties, and thus can have a significant impact on the efficacy of mRNA-based delivery. Exemplary improved properties of the mRNAs described herein compared to unmodified mRNA include, but are not limited to, improved expression upon delivery to cells, reduced immunogenicity, increased stability, and enhanced manufacturability. In some cases, the modification of the mRNA results in a property improvement of at least about 1.1-fold to about 100,000-fold relative to unmodified mRNA. In some embodiments, the improved properties of the modified mRNA are improved by at least about 1.1 times to about 10,000 times, at least about 1.1 times to about 1,000 times, at least about 1.1 times to about 500 times, at least about 1.1 times to about 400 times, at least about 1.1 times to about 300 times, at least about 1.1 times to about 200 times, at least about 1.1 times to about 100 times, at least about 1.1 times to about 50 times, at least about 1.1 times to about 40 times, at least about 1.1 times to about 30 times, at least about 1.1 times to about 20 times, at least about 1.1 times to about 10 times, and at least about 1.1 times to about 9 times compared to the unmodified mRNA. The improvements are described as follows: at least about 1.1 times to about 8 times, at least about 1.1 times to about 7 times, at least about 1.1 times to about 6 times, at least about 1.1 times to about 5 times, at least about 1.1 times to about 4 times, at least about 1.1 times to about 3 times, at least about 1.1 times to about 2 times, at least about 1.1 times to about 1.5 times, at least about 1.5 times to about 3 times, at least about 1.5 times to about 4 times, at least about 1.5 times to about 5 times, at least about 1.5 times to about 10 times, at least about 5 times to about 10 times, at least about 10 times to about 20 times, at least 10 times to about 30 times, at least 10 times to about 50 times, or at least 10 times to about 100 times. In some embodiments, the improved properties of the modified mRNA are at least about 10 times to about 1000 times better than those of the unmodified mRNA.
[0188] When delivering mRNA encoding the protein of interest, optimization of the coding sequence and untranslated region (UTR) can be useful compared to the DNA template to be transcribed into mRNA. DNA templates have a long lifespan, can replicate, and can produce numerous RNA transcripts within their lifetime. For DNA templates, transcription efficiency and pre-mRNA processing are major determinants of protein expression levels. In contrast, mRNAs typically have a much shorter half-life, approximately a few hours, because they are readily degraded in the cytoplasm and cannot produce many more copies of themselves. Therefore, mRNA stability and translation efficiency can be key determinants of protein expression levels in DNA-based mRNA delivery, and thus, specific sequences of the UTR and coding sequence that determine mRNA stability and translation efficiency can be enhanced to improve the efficacy of mRNA-based delivery.
[0189] a. 5' cap
[0190] In some embodiments of the mRNA encoding the LTRP disclosed herein, the mRNA includes a 5' cap connected to the 5' UTR of the mRNA sequence of any of the embodiments described herein. In some embodiments, the 5' cap is a 7-methylguanylate cap. In some embodiments, the 5' cap contains m7G(5')ppp(5')mAG. In other embodiments, the 5' cap contains m7G(5')ppp(5'(A,G(5')ppp(5')A or G(5')ppp(5')G. Exemplary caps are known in the art and are described, for example, in WO 2017 / 053297, the contents of which are incorporated herein by reference.
[0191] b. 5' Untranslated Region (UTR)
[0192] The 5' UTR of an mRNA molecule can determine mRNA stability and the efficiency of its translation into protein. Specifically, the 5' UTR binds to the 5' cap structure, acting as a binding site and recruitment platform for pretranslational initiation complexes and other regulatory proteins that may have a positive or negative impact on translation. Structures within the 5' UTR can enhance translation by recruiting initiation factors or other proteins or RNA factors, reduce translation by physically blocking ribosome binding and scanning, and promote mRNA stability by influencing hydrolysis and nuclease digestion.
[0193] Table 6A provides exemplary 5' UTR sequences for the mRNAs used in this disclosure. Table 6A lists the RNA sequence, the RNA sequence with uridine replaced by N1-methylpseudouridine, and the DNA sequence of the 5' UTR.
[0194] Table 6A: 5' UTR Sequence
[0195]
[0196] In some embodiments, the 5' UTR comprises the sequence of SEQ ID NO: 21831 or a sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95% identity with it. In some embodiments, the 5' UTR comprises the sequence of SEQ ID NO: 21831. In some embodiments, the 5' UTR consists of the sequence of SEQ ID NO: 21831. In some embodiments, the 5' UTR comprises the sequence of SEQ ID NO: 21842 or a sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95% identity with it. In some embodiments, the 5' UTR comprises the sequence of SEQ ID NO: 21842. In some embodiments, the 5' UTR consists of the sequence of SEQ ID NO: 21842.
[0197] c. 3' UTR
[0198] The 3' UTR sequence can significantly influence mRNA stability and translation efficiency, and can determine subcellular localization and tissue-specific expression. Factors influencing these properties include microRNA binding sites, AU-rich elements recruiting a range of RNA-binding proteins, short binding elements, and other binding sites for RNA-binding proteins. While many of these interactions with the 3' UTR are known to negatively impact stability or expression, some can enhance translation. Due to the differential expression of microRNAs and RNA-binding proteins, the effects of the 3' UTR sequence can be highly cell-type specific, providing an opportunity to engineer tissue-specific expression into therapeutic mRNAs. In some embodiments, the 3' UTR used for the mRNA of this disclosure is a mouse 3' UTR. In some embodiments, the 3' UTR is the mouse HBA gene 3' UTR from Table 6B.
[0199] Exemplary 3' UTR sequences of this disclosure are provided in Table 6B. Table 6B lists RNA sequences and RNA sequences in which uridine is replaced with N1-methylpseudouridine.
[0200] Table 6B: 3' UTR Sequence
[0201]
[0202] In some embodiments, the 3' UTR comprises the sequence of SEQ ID NO: 21844 or a sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95% identity with it. In some embodiments, the 3' UTR comprises the sequence of SEQ ID NO: 21844. In some embodiments, the 3' UTR consists of the sequence of SEQ ID NO: 21844. In some embodiments, the 3' UTR comprises the sequence of SEQ ID NO: 21845 or a sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95% identity with it. In some embodiments, the 3' UTR comprises the sequence of SEQ ID NO: 21845. In some embodiments, the 3' UTR consists of the sequence of SEQ ID NO: 21845.
[0203] d. Poly(A) sequence
[0204] The inclusion of a 3' poly(A) tail in the mRNA sequence can contribute to mRNA stability and translation efficiency. Generally, longer poly(A) tails are associated with increased mRNA stability, thereby allowing them to be translated and promoting high protein expression.
[0205] In some embodiments, the mRNA of this disclosure comprises a poly(A) sequence having at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 185, or at least about 190 adenine nucleotides. In some embodiments, the poly(A) sequence of the mRNA of this disclosure comprises 80 adenine nucleotides. In some embodiments, the poly(A) sequence comprises a nucleic acid sequence of AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 1961). In some embodiments, the poly(A) sequence comprises the nucleic acid sequence AAA ...
[0206] e. Sequence modifications of mRNA
[0207] In some embodiments, the mRNA sequences of this disclosure are modified by codon optimization of the sequence encoding a long-term repressor protein using one or more parameters to enhance expression in target cells. Non-limiting examples of these parameters include codon usage in human host cells (e.g., using a codon fitness index (CAI)), a codon usage table derived from a biologic intended for use as a therapeutic agent, an mRNA stability index, or GC content. Methods of codon optimization and codon usage in various organisms are known in the art. See, for example, www.genscript.com / tools / codon-frequency-table. In some embodiments, this document provides mRNA sequences of long-term repressor protein constructs codon-optimized for expression in human cells. In other instances, various naturally occurring or modified nucleosides can be used to generate modified mRNAs according to this disclosure.
[0208] In some embodiments, the mRNA is or comprises a natural nucleoside (e.g., adenosine, guanosine, cytidine, uridine); a nucleoside analogue (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5-methylcytidine, C-5-propynylcytidine, C-5-propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyluridine, C5-propynylcytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazolamidine). The mRNA contains glycosides, 7-denitroguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, pseudouridine (e.g., N-1-methyl-pseuuridine), 2-thiouridine, and 2-thiocytidine); chemically modified bases; biologically modified bases (e.g., methylated bases); inserted bases; modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose); and / or modified phosphate groups (e.g., thiophosphate esters and 5'-N-phosphoramide bonds). In some embodiments, the mRNA comprises one or more non-standard nucleotide residues. Non-standard nucleotide residues may include, for example, 5-methylcytidine (“5 mC”), N1-methyl-pseuuridine (“ψU”), and / or 2-thiouridine (“2sU”). In certain embodiments, one or more or all of the uridine residues of the mRNA disclosed herein are replaced with N1-methyl-pseuuridine. In some embodiments, all uridine residues of the mRNA disclosed herein are replaced with 1-methyl-pseudouridine. See, for example, U.S. Patent No. 8,278,036 or WO2011012316 (incorporated herein by reference) for a discussion of such residues and their integration into the mRNA. In some embodiments, the modification of the mRNA results in a property improvement of at least about 1.1-fold to about 100,000-fold relative to unmodified mRNA.In some embodiments, the improved properties of the modified mRNA are improved by at least about 1.1 times to about 10,000 times, at least about 1.1 times to about 1,000 times, at least about 1.1 times to about 500 times, at least about 1.1 times to about 400 times, at least about 1.1 times to about 300 times, at least about 1.1 times to about 200 times, at least about 1.1 times to about 100 times, at least about 1.1 times to about 50 times, at least about 1.1 times to about 40 times, at least about 1.1 times to about 30 times, at least about 1.1 times to about 20 times, at least about 1.1 times to about 10 times, and at least about 1.1 times to about 9 times compared to the unmodified mRNA. The improvements are described as follows: at least about 1.1 times to about 8 times, at least about 1.1 times to about 7 times, at least about 1.1 times to about 6 times, at least about 1.1 times to about 5 times, at least about 1.1 times to about 4 times, at least about 1.1 times to about 3 times, at least about 1.1 times to about 2 times, at least about 1.1 times to about 1.5 times, at least about 1.5 times to about 3 times, at least about 1.5 times to about 4 times, at least about 1.5 times to about 5 times, at least about 1.5 times to about 10 times, at least about 5 times to about 10 times, at least about 10 times to about 20 times, at least 10 times to about 30 times, at least 10 times to about 50 times, or at least 10 times to about 100 times. In some embodiments, the improved properties of the modified mRNA are at least about 10 times to about 1000 times better than those of the unmodified mRNA.
[0209] f. LTRP mRNA component sequence
[0210] This disclosure provides mRNA comprising a sequence encoding a component used in the long-term repressor fusion protein described herein. In some embodiments, the mRNA comprises a sequence encoding a DNA-binding protein, including TALE, ZF, and catalytically dead CRISPR proteins. In some embodiments, the mRNA comprises a sequence encoding SEQ ID NO: 2211 of dCasX 515 (SEQ ID NO: 6) or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity therewith. In some embodiments, the mRNA comprises a sequence encoding SEQ ID NO: 2213 or SEQ ID NO: 2214 of dCasX 812 (SEQ ID NO: 29) or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity therewith. In some embodiments, the mRNA comprises a sequence encoding dCasX 491 (SEQ ID NO: 4) of SEQ ID NO: 1948 or SEQ ID NO: 2405, or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity therewith. In some embodiments, the mRNA comprises a DNA-binding protein encoded by a sequence consisting substantially of the sequence encoding dCasX 491 (SEQ ID NO: 4) of SEQ ID NO: 2405. In some embodiments, the mRNA comprises a sequence encoding dCasX 676 (SEQ ID NO: 28) of SEQ ID NO: 2407 or SEQ ID NO: 2408, or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity therewith. As described above, the sequence encoding dCasX is integrated into the mRNA sequence encoding the long-term repressor fusion protein.
[0211] In some embodiments, the mRNA sequence encoding dCasX 491 (SEQ ID NO: 4) contains a pseudouridine nucleoside, with one or more or all of the uridines in its substitution sequence (SEQ ID NO: 2406). In some embodiments, the mRNA sequence encoding dCasX 515 (SEQ ID NO: 6) contains a pseudouridine nucleoside, with one or more or all of the uridines in its substitution sequence. In some embodiments, the mRNA sequence encoding dCasX 676 (SEQ ID NO: 28) contains a pseudouridine nucleoside, with one or more or all of the uridines in its substitution sequence. In some embodiments, the mRNA sequence encoding dCasX 812 (SEQ ID NO: 29) contains a pseudouridine nucleoside, with one or more or all of the uridines in its substitution sequence.
[0212] In some embodiments, the sequence of the mRNA encoding dCasX is selected from the group consisting of: SEQ ID NO: 1948, 2211, 2213-2214, 2405-2408. In some embodiments, the sequence of the mRNA encoding dCasX has a pseudouridine nucleotide replacing one or more uridines. In some embodiments, the sequence of the mRNA encoding dCasX has a pseudouridine nucleotide replacing all uridines.
[0213] This disclosure provides an mRNA sequence encoding the RD1 domain. In some embodiments, the sequence encoding RD1 comprises a sequence selected from the group consisting of SEQ ID NOs: 1946, 21846, and 18637-20233, or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, or at least about 95% identity with it. In another embodiment, the sequence encoding RD1 comprises a sequence selected from the group consisting of SEQ ID NOs: 18637-18731, or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In another embodiment, the sequence encoding RD1 comprises a sequence selected from the group consisting of SEQ ID NO: 18637-18645, or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In another embodiment, the sequence encoding RD1 comprises the sequence of SEQ ID NO: 18642, or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In another embodiment, the sequence encoding RD1 comprises the sequence of SEQ ID NO: 18638 or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In another embodiment, the sequence encoding RD1 comprises the sequence of SEQ ID NO: 18637 or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments, the sequence encoding RD1 comprises SEQ ID NO: 18637, 18638, or 18642.
[0214] In some embodiments, the mRNA comprises a sequence encoding a second repressor domain. In some embodiments, the second repressor domain comprises DNMT3A. In some embodiments, the sequence encoding DNMT3A comprises the sequence of SEQ ID NO: 1923 or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments, the sequence encoding DNMT3A comprises the sequence of SEQ ID NO: 1923.
[0215] In some embodiments, the mRNA comprises a sequence encoding a third repressor domain. In some embodiments, the third repressor domain comprises DNMT3L. In some embodiments, the sequence encoding DNMT3L comprises the sequence SEQ ID NO: 1945 or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments, the sequence encoding DNMT3L comprises the sequence SEQ ID NO: 1945.
[0216] In some embodiments, the mRNA comprises a sequence encoding a fourth repressor domain. In some embodiments, the fourth repressor domain comprises an ADD. In some embodiments, the sequence encoding the ADD comprises the sequence of SEQ ID NO: 1954 or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments, the fourth repressor domain comprises an ADD. In some embodiments, the sequence encoding the ADD comprises the sequence of SEQ ID NO: 1954.
[0217] In some embodiments, the mRNA disclosed herein comprises a Kozak sequence. In some embodiments, the Kozak sequence comprises GCCACCAUGG (SEQ ID NO: 21848). In some embodiments, the mRNA disclosed herein comprises a Kozak sequence and two bases upstream of the NLS (to generate methionine and alanine upstream of the NLS). In some embodiments, the mRNA comprises the sequence GCCACCAUGGCC (SEQ ID NO: 21832) between the 5' UTR and the sequence encoding the NLS.
[0218] In another embodiment, the mRNA comprises an NLS. In some embodiments, the sequence encoding the NLS comprises a sequence selected from the group consisting of SEQ ID NO: 21833 and SEQ ID NO: 21849, or a sequence having at least about 70%, at least about 80%, or at least about 90% identity with it. In another embodiment, the mRNA comprises a sequence selected from the group consisting of SEQ ID NO: 21833 and SEQ ID NO: 21849. In another embodiment, such as those in which the long-term repressor protein comprises more than one NLS, the mRNA comprises two or more sequences independently selected from the group consisting of SEQ ID NO: 21833 and SEQ ID NO: 21849.
[0219] In some embodiments, the mRNA comprises a sequence encoding a linker for a long-term repressor fusion protein. In some embodiments, the sequence encoding the linker comprises a sequence selected from the group consisting of SEQ ID NO: 21857-21873 or a sequence having at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, or at least about 95% identity with it. In some embodiments, the sequence encoding the linker comprises a sequence selected from the group consisting of SEQ ID NO: 21857-21873. In some embodiments, such as those where the long-term repressor fusion protein comprises more than one linker, the sequence encoding the linker is independently selected from the group consisting of SEQ ID NO: 21857-21873 or a sequence having at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, or at least about 95% identity with it.
[0220] In some embodiments, the mRNA comprises a sequence encoding a long-term repressor fusion protein of the conformation provided herein. In some embodiments, the mRNA encodes a long-term repressor fusion protein of conformation 1, and the mRNA comprises a sequence selected from the group consisting of SEQ ID NO: 2521-7311 or a sequence having at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments, the mRNA comprises a sequence selected from the group consisting of SEQ ID NO: 2521-7311.
[0221] In some embodiments, the mRNA comprises a sequence encoding a long-term repressor fusion protein of configuration 1 and a sequence encoding RD1, wherein RD1 comprises the sequence of SEQ ID NO: 130. In some embodiments, the mRNA comprises a sequence of SEQ ID NO: 18637 or 20234 or a sequence having at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments, the mRNA comprises sequences of SEQ ID NO: 18637 and 20234. In some embodiments, the mRNA comprises a sequence encoding a long-term repressor fusion protein of configuration 1 and a sequence encoding RD1, wherein RD1 comprises the sequence of SEQ ID NO: 131. In some embodiments, the mRNA comprises the sequence of SEQ ID NO: 18638 or 20235, or a sequence having at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments, the mRNA comprises the sequences of SEQ ID NO: 18638 and 20235. In some embodiments, the mRNA comprises the sequence encoding a long-term repressor fusion protein of conformation 1, and comprises the sequence encoding RD1, which comprises the sequence of SEQ ID NO: 132. In some embodiments, the mRNA comprises the sequence of SEQ ID NO: 18639 or 20236, or a sequence having at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments, the mRNA comprises a sequence encoding a long-term repressor fusion protein of configuration 1 and a sequence encoding RD1, wherein RD1 comprises the sequence of SEQ ID NO: 133. In some embodiments, the mRNA comprises a sequence of SEQ ID NO: 18640 or 20237 or a sequence having at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments, the mRNA comprises a sequence of SEQ ID NO: 18640 or 20237. In some embodiments, the mRNA comprises a sequence encoding a long-term repressor fusion protein of configuration 1 and a sequence encoding RD1, wherein RD1 comprises the sequence of SEQ ID NO: 134.In some embodiments, the mRNA comprises the sequence of SEQ ID NO: 18641 or 20238 or a sequence having at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments, the mRNA comprises the sequence of SEQ ID NO: 18641 or 20238. In some embodiments, the mRNA comprises the sequence encoding a long-term repressor fusion protein of conformation 1 and comprises the sequence encoding RD1, which comprises the sequence of SEQ ID NO: 135. In some embodiments, the mRNA comprises the sequence of SEQ ID NO: 18642 or 20239 or a sequence having at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments, the mRNA comprises the sequence of SEQ ID NO: 18642 or 20239. In some embodiments, the mRNA comprises a sequence encoding a long-term repressor fusion protein of configuration 1 and a sequence encoding RD1, wherein RD1 comprises the sequence of SEQ ID NO: 136. In some embodiments, the mRNA comprises the sequence of SEQ ID NO: 18643 or 20240 or a sequence having at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments, the mRNA comprises the sequence of SEQ ID NO: 18643 or 20240. In some embodiments, the mRNA comprises a sequence encoding a long-term repressor fusion protein of configuration 1 and a sequence encoding RD1, wherein RD1 comprises the sequence of SEQ ID NO: 137. In some embodiments, the mRNA comprises a sequence of SEQ ID NO: 18644 or 20241 or a sequence having at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments, the mRNA comprises a sequence encoding a long-term repressor fusion protein of conformation 1, and comprises a sequence encoding RD1, which comprises the sequence of SEQ ID NO: 138.In some embodiments, the mRNA comprises a sequence of SEQ ID NO: 18645 or 20242 or a sequence having at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments, the mRNA comprises a sequence of SEQ ID NO: 18645 or 20242.
[0222] This disclosure provides mRNA encoding a long-term repressor fusion protein of configuration 5. In some embodiments, the mRNA comprises a sequence selected from the group consisting of SEQ ID NO: 8909-12102 or a sequence having at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments, the mRNA comprises a sequence selected from the group consisting of SEQ ID NO: 8909-12102.
[0223] This disclosure provides mRNA encoding a long-term repressor fusion protein of configuration 6a. In some embodiments, the mRNA comprises a sequence selected from the group consisting of SEQ ID NO: 15297-16893 or a sequence having at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments, the mRNA comprises a sequence selected from the group consisting of SEQ ID NO: 15297-16893.
[0224] This disclosure provides mRNA encoding a long-term repressor fusion protein of configuration 6b. In some embodiments, the mRNA comprises a sequence selected from the group consisting of SEQ ID NO: 18491-18563 or a sequence having at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with it. In some embodiments, the mRNA comprises a sequence selected from the group consisting of SEQ ID NO: 18491-18563.
[0225] In some embodiments of the LTRP:gRNA system of this disclosure that encodes a long-term repressor fusion protein mRNA, after systemic delivery and expression in cells, the long-term repressor fusion protein is able to complex with the gRNA and bind to the target DNA of the cell's target gene, thereby repressing or silencing gene transcription in the cell.
[0226] VI. Systematic Guided Nucleic Acids
[0227] On the other hand, this disclosure relates to specially designed guide RNAs (gRNAs) comprising a scaffold and a linked target sequence complementary to (and thus capable of hybridizing with) a target nucleic acid sequence of a gene. The gRNAs described herein can be used with long-term repressor proteins and systems comprising long-term repressor proteins to repress the transcription of target nucleic acids in eukaryotic cells. As used herein, the term "gRNA" encompasses naturally occurring molecules and gRNA variants, including chimeric gRNA variants comprising domains from different gRNAs. The gRNAs of this disclosure comprise a scaffold and a target sequence complementary to a target nucleic acid of the cell, linked to the 3' end of the scaffold.
[0228] In some embodiments, when a system comprising mRNA encoding a long-term repressor fusion protein containing a dCasX protein and one or more gRNAs expresses the long-term repressor fusion protein in a cell, it forms a ribonucleoprotein (RNP) complex comprising LTRP and gRNA that can target and bind to a specific location in the target nucleic acid sequence of a gene to be repressed or silenced in the cell. The gRNA provides target specificity to the complex by including a targeting sequence (or “spacer”) having a nucleotide sequence complementary to the target nucleic acid sequence, while the long-term repressor fusion protein of the system provides site-specific activity, such as binding to and transcriptional repression of the target gene, which is guided to a target site within the target nucleic acid sequence (e.g., stabilized at the target site) due to its association with the gRNA.
[0229] Examples of gRNAs and formulations of mRNAs and gRNAs for transcriptional repression and / or epigenetic modification of target nucleic acids are described below.
[0230] a. Reference gRNA and gRNA variants
[0231] As used herein, “reference gRNA” refers to a CRISPR guide ribonucleic acid containing the wild-type sequence of a naturally occurring gRNA. In some embodiments, the gRNA scaffold of this disclosure may be subjected to one or more mutagenesis methods, such as those described in WO2023235818A2, WO2022120095A1, and WO2020247882A1 (incorporated herein by reference), which may include deep mutation evolution (DME), deep mutation scanning (DMS), error-prone PCR, cassette mutagenesis, random mutagenesis, staggered extension PCR, gene shuffling, domain exchange, or chemical modification to produce one or more gRNA variants that have enhanced or altered properties relative to the modified gRNA scaffold. The activity of the gRNA scaffold from which the gRNA variants are derived can be used as a benchmark for comparing the activity of the gRNA variants, thereby measuring improvements in the function or other properties of the gRNA scaffold.
[0232] Table 7 provides the sequences of the reference gRNA tracer and scaffold sequence. In some embodiments, this disclosure provides gRNA variants having a scaffold comprising a sequence having one or more nucleotide modifications relative to the reference gRNA sequence of any of SEQ ID NO: 1731-1743 in Table 7.
[0233] Table 7: Reference gRNA tracr and scaffold sequences
[0234]
[0235] b. gRNA domains and their functions
[0236] The gRNA of this disclosure comprises two segments: a targeting sequence and a protein-binding segment. The targeting segment of the gRNA comprises a nucleotide sequence (interchangeably referred to as a spacer, target, or targeting sequence) that is complementary (and thus hybridizes with) a specific sequence (target site) within a target nucleic acid sequence (e.g., a double-stranded target DNA strand, target ssRNA, target ssDNA, etc.), which will be described more fully below. The targeting sequence of the gRNA is capable of binding to the target nucleic acid sequence, which, in the context of this disclosure, includes coding sequences, complementary sequences of coding sequences, non-coding sequences, and accessory elements. The protein-binding segment of the gRNA (or “activator” or “protein-binding sequence”) interacts (e.g., binds) with a CasX protein as a complex, forming an RNP (described more fully below). As used herein, “scaffold” refers to all parts of the guide other than the targeting sequence, which comprises several regions, described more fully below. The properties and characteristics of wild-type and variant CasX gRNAs are described in WO2020247882A1, US20220220508A1, WO2022120095A1 and WO2023235818A2 (incorporated hereby by application).
[0237] In the case of reference gRNA, gRNA naturally exists as a dual guide RNA (dgRNA), wherein the target and activator portions each have a double-strand-forming segment that is complementary to each other and hybridizes with each other to form a double-stranded double (dsRNA double-stranded gRNA). The terms “target” or “target RNA” are used herein to refer to a crRNA-like molecule (crRNA: “CRISPR RNA”) of CasX dual guide RNA (and therefore CasX single guide RNA when the “activator” and “target” are linked together; for example, linked together by an intermediate nucleotide). crRNA has a 5' region that allows the target sequence to be tracrRNA followed by nucleotide recombination. In the case of gRNA used in the systems of this disclosure, the scaffold is designed such that the activator and target portions are covalently linked to each other (rather than hybridizing with each other) and comprises a single molecule, and may be referred to as “single-molecule gRNA,” “single guide RNA,” “single-molecule guide RNA,” or “sgRNA.” The gRNA variants of this disclosure used in said systems are all single-molecule versions.
[0238] In summary, the assembled gRNA of this disclosure comprises different structured regions or domains: an RNA triplet, a scaffold stem loop, an extended stem loop, a pseudoknot, and a targeting sequence, which are specific to the target nucleic acid and located at the 3' end of the gRNA in embodiments of this disclosure. The RNA triplet, scaffold stem loop, pseudoknot, and extended stem loop, as well as the unstructured triplet loop bridging portions of the triplet together, are referred to as the "scaffold" of the gRNA. In some cases, the scaffold stem further comprises a vesicle. In other cases, the scaffold further comprises a triplet loop region. In still other cases, the scaffold further comprises a 5' unstructured region. In some embodiments, the gRNA scaffold of this disclosure for use in the LTRP:gRNA system comprises a scaffold stem loop having the sequence CCAGCGACUAUGUCGU AGUGG (SEQ ID NO: 1822) or having at least one, two, three, four, or five mismatched sequences therewith.
[0239] Each of the structured domains contributes to establishing the overall RNA fold of the guide and preserving its functionality, specifically its ability to properly complex with the dCasX protein. For example, the guide scaffold stem interacts with the helical I domain of the dCasX protein, while residues within the triplet, triplet loop, and pseudoknot stem interact with the OBD of the dCasX protein. In summary, these interactions confer the guide's ability to bind to dCasX and form a stable RNP, while the spacer (or target sequence) guides and defines the specificity of the RNP's binding to a particular sequence of DNA.
[0240] Site-specific binding of a target nucleic acid sequence (e.g., genomic DNA) via the dCasX protein can occur at one or more locations (e.g., the sequence of the target nucleic acid) determined by the base pairing complementarity between the target sequence of the gRNA and the target nucleic acid sequence. Thus, for example, the gRNA of this disclosure has a sequence complementary to the target nucleic acid and can therefore hybridize with the target nucleic acid, said sequence being adjacent to a TC protospacer adjacent motif (PAM) motif or a PAM sequence such as ATC, CTC, GTC, or TTC. Because the target sequence of the guide sequence hybridizes with the sequence of the target nucleic acid sequence, the user can modify the target sequence to hybridize with a specific target nucleic acid sequence, taking into account the position of the PAM sequence. In some embodiments, to design the target sequence, the target nucleic acid contains a PAM sequence located at the 5' of the target sequence, wherein at least one nucleotide separates the PAM from the first nucleotide of the target nucleic acid that is complementary to the nucleotide of the target sequence. This feature distinguishes the system described herein from the Cas9 system and allows the system of this disclosure to modify different locations in the DNA sequence compared to the Cas9 system. In some embodiments, the PAM is located on the non-target strand of the target region (i.e., the strand complementary to the target nucleic acid). In some embodiments, the target sequence of the gRNA is complementary to a target nucleic acid sequence that differs from the ATC PAM sequence by one nucleotide. In some embodiments, the target sequence of the gRNA is complementary to a target nucleic acid sequence that differs from the CTC PAM sequence by one nucleotide. In some embodiments, the target sequence of the gRNA is complementary to a target nucleic acid sequence that differs from the GTC PAM sequence by one nucleotide. In some embodiments, the target sequence of the gRNA is complementary to a target nucleic acid sequence that differs from the TTC PAM sequence by one nucleotide. By selecting the target sequence of the gRNA, the LTRP:gRNA system described herein can be used to repress a defined region of the target nucleic acid sequence or a sequence located at a specific position within the target nucleic acid.
[0241] In some embodiments, the target sequence of the gRNA has 15 to 22 consecutive nucleotides. In some embodiments, the target sequence has 15, 16, 17, 18, 19, 20, 21, and 22 consecutive nucleotides. In some embodiments, the target sequence consists of 22 consecutive nucleotides. In some embodiments, the target sequence consists of 21 consecutive nucleotides. In some embodiments, the target sequence consists of 20 consecutive nucleotides. In some embodiments, the target sequence consists of 19 consecutive nucleotides. In some embodiments, the target sequence consists of 18 consecutive nucleotides. In some embodiments, the target sequence consists of 17 consecutive nucleotides. In some embodiments, the target sequence consists of 16 consecutive nucleotides. In some embodiments, the target sequence consists of 15 consecutive nucleotides. By selecting the target sequence of the gRNA, the defined region of the target nucleic acid sequence can be repressed and / or epigenetically modified using the LTRP:gRNA system described herein.
[0242] The gene repressor system disclosed herein can be programmed to target any region of a gene or gene region seeking transcriptional repression, or any region adjacent to said gene or gene region. When the entire gene is to be repressed, this disclosure envisions a guide designed with a targeting sequence complementary to a sequence covering or near the transcription start site (TSS). TSS selection occurs at different locations within the promoter region, depending on the promoter sequence and the initiator-substrate concentration. The core promoter acts as a binding platform for transcriptional mechanisms, containing Pol II and its associated universal transcription factor (GTF) (Haberle, V. et al., Eukaryotic core promoters and the functional basis of transcription initiation (Nature Review of Molecular Cell Biology 19(10):621 (2018)). Variability in TSS selection has been proposed to involve DNA 'splitting' and 'anti-splitting', marked by: (i) forward and reverse movement of the RNA polymerase front relative to the DNA, but not the movement of the trailing edge, and (ii) expansion and contraction of the transcription vesicle. In some embodiments, the target nucleic acid sequence bound by the RNP of the LTRP:gRNA system is within 1.5 kilobases (kb) of the transcription start site (TSS) in the gene. In some embodiments, the target nucleic acid sequence bound by the system's RNP is 20 bp, 50 bp, 100 bp, 150 bp, 200 bp upstream of the TSS of the gene. Within 20 bp, 250 bp, 500 bps, 1 kb, or 1.5 kb of the TSS of the gene. In some embodiments, the target nucleic acid sequence bound by the system's RNP is within 20 bp, 50 bp, 100 bp, 150 bp, 200 bp, 250 bp, 500 bps, 1 kb, or 1.5 kb downstream of the TSS of the gene. In some embodiments, the target nucleic acid sequence bound by the system's RNP is within 500 bp upstream to 500 bp downstream, or 300 bp upstream to 300 bp downstream, or 100 bp upstream to 100 bp downstream of the TSS of the gene. In some embodiments, the target nucleic acid sequence bound by the system's RNP is within 20 bp, 50 bp, 100 bp, 150 bp, 200 bp, 250 bp, 500 bp, or 1 kb of the enhancer of the gene. Within 1 kb. In some embodiments, the target nucleic acid sequence bound by the RNP of the system of this disclosure is within 1 kb of the 3' to 5' untranslated region of the gene. In other embodiments, the target nucleic acid sequence bound by the RNP of the system is within the open reading frame of the gene, including introns (if any). In some embodiments, the target sequence of the gRNA of the system of this disclosure is complementary to the exon of the gene.In certain embodiments, the target sequence of the gRNA of the disclosed system is complementary to exon 1 of a gene. In other embodiments, the target sequence of the gRNA of the disclosed system is complementary to an intron of a gene. In other embodiments, the target sequence of the gRNA of the disclosed system is complementary to an intron-exon junction of a gene. In other embodiments, the target sequence of the gRNA of the disclosed system is complementary to a regulatory element of a gene. In other embodiments, the target sequence of the gRNA of the disclosed system is complementary to a sequence in an intergenic region of a gene. In other embodiments, the target sequence of the gRNA of the disclosed system is specific for the binding of exons, introns, and / or regulatory elements of a gene. In those cases where the target sequence is specific for regulatory elements, such regulatory elements include, but are not limited to, promoter regions, enhancer regions, intergenic regions, 5' untranslated regions (5' UTR), 3' untranslated regions (3' UTR), conserved elements, and regions containing cis-regulatory elements. Promoter regions are intended to encompass nucleotides within 5 kb of the start of the coding sequence, or, in the case of gene enhancer elements or conserved elements, can be thousands, hundreds of thousands, or even millions of bp away from the coding sequence of the gene. In the foregoing, a target is a gene containing a target nucleic acid intended to be repressed so that the gene product is not expressed or is expressed at a low level in the cell. In some embodiments, when the RNP of the system of this disclosure binds to the binding site of the target nucleic acid, the system is capable of repressing transcription of the gene at the 5' of the RNP binding site. In other embodiments, when the RNP of the system binds to the binding site of the target nucleic acid, the system is capable of repressing transcription of the gene at the 3' of the RNP binding site.
[0243] c. gRNA modification
[0244] On the other hand, this disclosure relates to gRNA variants for use in systems of this disclosure, said variants comprising modifications relative to a reference gRNA from which the gRNA is derived. In some embodiments, the gRNA variants for use in systems of this disclosure comprise one or more nucleotide substitution, insertion, deletion, or exchange or substitution domains relative to the gRNA sequence of this disclosure, which improve properties relative to the reference gRNA. Exemplary regions of the modified and exchanged regions or domains include RNA triple strands, pseudoknots, scaffold stem loops, and extended stem loops. In some embodiments, the gRNA variants of this disclosure comprise at least a first exchanged region from a different gRNA, thereby producing a chimeric gRNA. A representative example of such chimeric gRNAs is guide 316 (SEQ ID NO: 1746), in which the extended stem-loop of gRNA scaffold 235 (SEQ ID NO: 1745) is replaced by the extended stem-loop of gRNA scaffold 174 (SEQ ID NO: 1744). The resulting 316 variant retains the ability to form RNPs with dCasX and long-term repressor fusion proteins when evaluated in in vitro or in vivo assays under comparable conditions and exhibits improved properties compared to parent 235.
[0245] All gRNA scaffold variants that, compared to their derived gRNA scaffolds, possess one or more improved functions, properties, or added new functions, while retaining the functional property of complexing with long-term repressor fusion proteins and guiding the ribonucleoprotein whole RNP complex to target nucleic acids, are considered to be within the scope of this disclosure. In some embodiments, the gRNA has improved properties selected from the group consisting of: increased pseudoknot stem stability, increased triplet region stability, increased scaffold stem stability, extended stem stability, reduced off-target folding intermediates, increased binding affinity to repressor fusion proteins, and increased transcriptional repression activity when complexed with repressor fusion proteins, or any combination thereof. In some of the foregoing cases, the improved properties are evaluated in in vitro assays, including the assays described in the examples. In other foregoing cases, the improved properties are evaluated in vivo.
[0246] Table 8 provides exemplary gRNA variant scaffold sequences of this disclosure, which are used as gRNA scaffolds or for the generation of gRNA in the LTRP:gRNA system of this disclosure. In some embodiments, the gRNA variant scaffold for the system comprises any one of the sequences listed in Table 8 as SEQ ID NO: 1744-1746, or a sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with it, wherein the gRNA variant retains the ability to form an RNP with the dCasX of this disclosure. In other embodiments, the gRNA variant scaffold for the LTRP:gRNA system comprises any one of the sequences SEQ ID NO: 1744-1746, wherein the gRNA variant retains the ability to form an RNP with the long-term repressor fusion protein of this disclosure. It should be understood that in those embodiments in which the vector comprises a DNA-coding sequence of gRNA, a thymine (T) base may replace a uracil (U) base in any of the gRNA sequence embodiments described herein. Similarly, any RNA sequence disclosed herein may be encoded by DNA in which a uracil base is replaced by thymine. In some embodiments, this disclosure provides chemically modified gRNA variants as described below. In some embodiments, the gRNA comprises a scaffold including the sequence of SEQ ID NO: 1744-1746 and is chemically modified.
[0247] Table 8: gRNA scaffold sequences
[0248]
[0249] Other gRNA variants for use in the systems of this disclosure are selected from the group consisting of SEQ ID NO: 1747-1821. In some embodiments, the gRNA comprises a scaffold including the sequence of SEQ ID NO: 1747-1821 and is chemically modified.
[0250] Guide scaffolds can be prepared by several methods, including recombinant synthesis or solid-phase RNA synthesis. However, when using solid-phase RNA synthesis, the length of the scaffold can affect manufacturability, with longer lengths leading to increased manufacturing costs, reduced purity and yield, and a higher rate of synthesis failure. For use in particulate formulations such as lipid nanoparticle (LNP) formulations, solid-phase RNA synthesis of the scaffold is preferred to produce the quantities required for commercial development. While previous experiments have identified enhanced properties of gRNA scaffold 235 (SEQ ID NO: 1745) compared to gRNA scaffold 174 (SEQ ID NO: 1744), its increased length (in nucleotides) potentially poses problems for its use in LNP formulations due to synthetic manufacturing limitations. Therefore, alternative sequences have been sought. In some embodiments, this disclosure provides gRNA variant scaffolds with improved manufacturability compared to gRNA scaffolds from which they are derived. In some embodiments, this disclosure provides gRNAs wherein the gRNA scaffold and the linked target sequence have sequences of less than about 115 nucleotides, less than about 110 nucleotides, or less than about 100 nucleotides. In a specific embodiment, the 316 gRNA scaffold (SEQ ID NO: 1746) has a shorter sequence compared to its derived 235 scaffold. A 316 gRNA scaffold was designed where the scaffold 235 sequence was modified by domain exchange, wherein an extended stem-loop of scaffold 174 replaced the extended stem-loop of scaffold 235, resulting in a chimeric gRNA scaffold 316 with the sequence ACUGGCGCUUCUAUCUGAUUACUCUGAGCGCC AUCACCAGCGACUAUGUCGUAGUGGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAGAG (SEQ ID NO: 1746), which has 89 nucleotides compared to the 99 nucleotides of gRNA scaffold 235. The resulting 316 scaffold has an additional advantage because the extended stem-loop does not contain a CpG motif; an enhanced property that confers a reduced likelihood of triggering an immune response. In some embodiments, the shorter sequence length of the 316 scaffold imparts an improved fidelity to the ability to synthesize guides with correct and complete sequences, as well as an enhanced ability to successfully integrate into LNPs. In some embodiments, this disclosure provides chemically modified gRNA 316 variants as described below.
[0251] d. Chemically modified gRNA
[0252] In some embodiments, the gRNA has one or more chemical modifications. In some embodiments, the chemical modification is the addition of a 2'O-methyl group to one or more nucleotides of the sequence. In some embodiments, one or more nucleotides at each end of the gRNA are modified by adding a 2'O-methyl group. In some embodiments, the chemical modification is the substitution of a phosphothiophosphate bond between two or more nucleotides of the sequence. In some embodiments, the chemical modification is the substitution of a phosphothiophosphate bond between two or more nucleotides at each end of the gRNA. In some embodiments, the gRNA comprises the substitution of a phosphothiophosphate bond between two or more nucleotides located at one, two, three, or four nucleotides from the 5' end, 3' end, or both ends of the gRNA. In some embodiments, the gRNA comprises the addition of a 2'O-methyl group to one or more nucleotides of the gRNA. In some embodiments, the modification of one or more nucleotides located at one, two, three, or four nucleotides from the 5' end, 3' end, or both ends of the gRNA is achieved by adding a 2'O-methyl group. In some embodiments, the first 1, 2, or 3 nucleotides of the 5' end of the scaffold are modified by adding a 2'O-methyl group (i.e., A, C, and U in the cases of gRNAs 174, 235, and 316), and each of the modified nucleotides is linked to an adjacent nucleotide via a phosphate thioester bond. Similarly, the last 1, 2, or 3 nucleotides of the 3' end of the target sequence linked to the 3' end of the scaffold are similarly modified. In some embodiments, the gRNA containing one or more chemical modifications comprises a sequence selected from the group consisting of sequences of SEQ ID NO: 2136-2144, 2146-2154, and 2156-2164, or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with it. In some embodiments, the chemically modified gRNA comprises the scaffold of SEQ ID NO: 2136-2144, 2146-2154, and 2156-2164; that is, the sequence of SEQ ID NO: 2136-2144, 2146-2154, and 2156-2164 without the 20-nucleotide spacer at the 3' end, which is represented as an undefined nucleotide in the foregoing sequences. Schematic diagrams of the structures of gRNA variants 174, 235, and 316 are respectively shown in [reference to image / image ... Figures 23A-23C The diagram shown in the figure illustrates, and is a schematic representation of chemically modified gRNA. Figure 22 , 28A As shown in 28B. In some embodiments, chemically modified gRNAs exhibit improved stability compared to unmodified gRNAs.
[0253] e. Formation of complexes with long-term repressor fusion proteins
[0254] When delivering or expressing system components in target cells, the gRNA variant can complex with the long-term repressor fusion protein to form an RNP and bind to the target nucleic acid targeted by the gRNA's target sequence. In some embodiments, the gRNA variant has an enhanced ability to form an RNP complex with the long-term repressor fusion protein compared to a reference gRNA or another gRNA variant derived from it. In some embodiments, improving the formation of the ribonucleoprotein complex can improve the efficiency of assembling functional RNPs. In some embodiments, greater than 90%, greater than 93%, greater than 95%, greater than 96%, greater than 97%, greater than 98%, or greater than 99% of RNPs containing the gRNA variant and its target sequence are capable of gene repression of the target nucleic acid.
[0255] VII. Polynucleotides and Carriers
[0256] This disclosure provides polynucleotides encoding long-term repressor fusion proteins and / or gRNAs. This disclosure also provides polynucleotides encoding mRNAs, such as DNA polynucleotides encoding corresponding mRNAs that encode long-term repressor fusion proteins.
[0257] Long-term repressor fusion proteins or mRNA encoding the long-term repressor fusion proteins disclosed herein can be prepared in vitro using conventional methods known in the art. Various commercial synthetic apparatuses are available, such as automated synthesizers provided by Applied Biosystems, Inc., Beckman Coulter, etc. Using the synthesizer, naturally occurring amino acids or nucleotides (where applicable) can be substituted with non-natural amino acids or nucleotides. Specific sequences and preparation methods will be determined based on convenience, cost-effectiveness, desired purity, etc. gRNA can also be synthesized; for example, using a T7 RNA polymerase system known in the art.
[0258] Long-term repressor fusion proteins and / or gRNAs can also be prepared by recombining polynucleotide sequences encoding any of the embodiments described herein using standard recombination techniques known in the art, and by integrating the encoding gene into an expression vector suitable for host cells. To produce the encoded long-term repressor fusion protein and / or gRNA of any of the embodiments described herein, the method includes transforming suitable host cells with an expression vector containing the encoding polynucleotide, and culturing the host cells under conditions that allow or permit the expression or transcription of the resulting long-term repressor fusion protein or gRNA of any of the embodiments described herein in the transformed host cells, which are then recovered by the methods described herein or standard purification methods known in the art, or as described in the examples. Standard recombination techniques in molecular biology are used to prepare the polynucleotides and expression vectors of this disclosure.
[0259] The long-term repressor fusion protein and / or gRNA of this disclosure can also be isolated and purified according to conventional methods of recombinant synthesis. Lysates can be prepared from the expression host, and the lysates are purified using high-performance liquid chromatography (HPLC), size exclusion chromatography, gel electrophoresis, affinity chromatography, or other purification techniques. For most fractions, the composition used will contain 50% by weight or more of the desired product, more typically 75% by weight or more, preferably 95% by weight or more, and for therapeutic purposes, typically 99.5% by weight or more, depending on contaminants associated with the preparation of the product and its purification methods. Percentages will generally be based on total protein. Thus, in some cases, the long-term repressor fusion protein or gRNA of this disclosure is at least 80% pure, at least 85% pure, at least 90% pure, at least 95% pure, at least 98% pure, or at least 99% pure (e.g., free from contaminants or other macromolecules, etc.).
[0260] Additionally, this disclosure provides vectors containing polynucleotides encoding the repressor fusion protein and gRNA described herein. In some cases, when the LTRP:gRNA system is delivered as a repressor fusion protein and gRNA or RNP, the vector is used for the expression and recovery of the CasX and gRNA components of the system. In other cases, the vector is used to deliver the polynucleotide encoding a target cell for transcriptional repression and / or epigenetic modification of the target nucleic acid, as described more fully below. In some embodiments, the sequences encoding the long-term repressor fusion protein and gRNA are templated on the same vector. In some embodiments, the sequences encoding the long-term repressor fusion protein and gRNA are templated on different vectors. Suitable vectors are described, for example, in WO2023235818A2, WO2022120095A1, and WO2020247882A1 (incorporated herein by reference). As described in WO2023235818A2, WO2022120095A1 and WO2020247882A1, depending on the host / vector system used, any element from a number of suitable transcription and / or translation control elements can be used in the expression vector, including constitutive and inducible promoters, transcription enhancer elements, transcription terminators, etc.
[0261] In some embodiments, this disclosure provides a polynucleotide sequence encoding a long-term repressor fusion protein of any embodiment described herein, the long-term repressor fusion protein comprising a sequence comprising SEQ ID NO: 1883-1903, 1909-1912, or 1915-1924, or a sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with that sequence. In some embodiments, the polynucleotide comprises a sequence encoding a long-term repressor fusion protein comprising SEQ ID NO: 1883-1903, 1909-1912, or 1915-1924. In some embodiments, the polynucleotide comprises an mRNA sequence encoding a long-term repressor fusion protein of any embodiment described herein for use in a particle system for delivery into cells. In some embodiments, the mRNA sequence encoding the long-term repressor fusion protein is used in an LNP particle formulation for delivery to cells. In particular embodiments, this disclosure provides gRNA and mRNA sequences encoding the long-term repressor fusion protein for use in an LNP particle formulation for delivery to cells, which will be described more fully below.
[0262] In some embodiments, this disclosure provides isolated polynucleotide sequences encoding gRNA variants of any of the embodiments described herein. In some embodiments, this disclosure provides polynucleotides encoding gRNAs comprising a scaffold sequence comprising SEQ ID NO: 1744-1746 or a sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with it, wherein the expressed gRNA variant retains the ability to form an RNP with a repressor fusion protein. In the foregoing embodiments, the gRNA further comprises a targeting sequence complementary to the target nucleic acid of the gene to be repressed.
[0263] In some embodiments, this disclosure relates to methods for generating a polynucleotide sequence encoding a long-term repressor fusion protein or gRNA (including variants thereof) of any embodiment described herein, and methods for expressing a protein or RNA transcribed from the polynucleotide sequence. Generally, the methods include generating a polynucleotide sequence encoding a long-term repressor fusion protein or gRNA of any embodiment described herein, and integrating the encoding gene into an expression vector. In some embodiments, the vector is designed to transduce cells to induce transcriptional repression and / or epigenetic modification of a target nucleic acid. Such vectors may include retroviral vectors, lentiviral vectors, adenovirus vectors, adeno-associated virus (AAV) vectors, herpes simplex virus (HSV) vectors, plasmids, microcircles, nanoparticles, DNA vectors, and RNA vectors. In other embodiments, the expression vector is designed to generate a repressor fusion protein and mRNA or gRNA encoding a long-term repressor fusion protein in a cell-free system or host cell. To produce the encoded long-term repressor fusion protein or gRNA of any embodiment described herein in host cells, the method includes transforming suitable host cells with an expression vector containing a encoding polynucleotide, and culturing the host cells under conditions that allow or permit the resulting long-term repressor fusion protein or gRNA of any embodiment described herein to be expressed or transcribed in the transformed host cells, thereby producing the long-term repressor fusion protein or gRNA, which is recovered by the methods described herein (e.g., in examples below) or by standard purification methods known in the art. Standard recombinant techniques in molecular biology are used to prepare the polynucleotides and expression vectors of this disclosure.
[0264] According to this disclosure, nucleic acid sequences encoding long-term repressor fusion proteins or gRNAs of any embodiment described herein are used to generate recombinant nucleic acid molecules that guide expression in appropriate host cells. Several cloning strategies are suitable for carrying out this disclosure, and many of these strategies are used to generate constructs comprising genes encoding long-term repressor fusion proteins or gRNAs of this disclosure, or their complement. In some embodiments, cloning strategies are used to generate genes encoding constructs containing nucleotides encoding long-term repressor fusion proteins or gRNAs. In some embodiments, the gene, for example as part of a vector, is used to transform host cells to express the gene, for example, the long-term repressor fusion protein or gRNA.
[0265] In one method, a construct containing a DNA sequence encoding a long-term repressor fusion protein or gRNA is first prepared. Exemplary methods for preparing such constructs are described in the examples. The construct is then used to generate an expression vector suitable for transforming host cells (such as prokaryotic or eukaryotic host cells) to express and recover the protein construct, in the case of the repressor fusion protein or gRNA. If desired, the host cell is *Escherichia coli*. In other embodiments, the host cell is a eukaryotic cell. The eukaryotic host cell may be selected from young hamster kidney fibroblast (BHK) cells, human embryonic kidney 293 (HEK293), human embryonic kidney 293T (HEK293T), NSO cells, SP2 / 0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER cells, PER.C6 cells, hybridoma cells, NIH3T3 cells, CV-1 (monkey) (COS) from sources with SV40 genetic material, HeLa, Chinese hamster ovary (CHO), yeast cells, or other eukaryotic cells known in the art suitable for producing recombinant products. Exemplary methods for generating expression vectors, transformation of host cells, and expression and recovery of long-term repressor fusion proteins or gRNAs are described in the examples.
[0266] Genes encoding long-term repressor fusion proteins or gRNA constructs can be synthesized entirely in one or more steps or prepared by synthesis in combination with enzymatic processes such as restriction enzyme-mediated cloning, PCR, and overlap extension, including the methods described more fully in the examples. The methods disclosed herein can be used, for example, to ligate polynucleotide sequences encoding various components into genes with desired sequences. Genes encoding polypeptide compositions are assembled from oligonucleotides using standard gene synthesis techniques.
[0267] In some embodiments, the nucleotide sequence encoding the long-term repressor fusion protein is codon-optimized. This type of optimization may require mutations in the encoding nucleotide sequence to mimic the codon preferences of the intended host organism or cell while encoding the same protein, as well as other parameters, including the codon fitness index (CAI), codon usage table derived from the biologic intended for use as a therapeutic agent, mRNA stability index, or GC content. Thus, codons can change, but the encoded protein remains unchanged. For example, if the intended target cell for the long-term repressor fusion protein is a human cell, a nucleotide sequence encoding a human codon-optimized long-term repressor fusion protein can be used. As another non-limiting example, if the intended host cell is a mouse cell, a nucleotide sequence encoding a mouse codon-optimized long-term repressor fusion protein can be generated. Genetic design can be performed using algorithms that optimize codon usage and amino acid compositions suitable for the host cell used in the production of the long-term repressor fusion protein or gRNA. In one method of this disclosure, a library of polynucleotides encoding components of a construct is generated and then assembled, as described above. The resulting gene is then assembled and used to transform host cells and produce and recover long-term repressor fusion proteins or gRNA compositions to evaluate their properties or to modify target nucleic acids, as described herein.
[0268] In some embodiments, the nucleotide sequence encoding a long-term repressor fusion protein or gRNA is operatively linked to a control element (e.g., a transcriptional control element, such as a promoter). In some embodiments, the nucleotide sequence encoding a long-term repressor fusion protein is operatively linked to a control element (e.g., a transcriptional control element, such as a promoter). In some cases, the promoter is a constitutively active promoter. In some cases, the promoter is a regulated promoter. In some cases, the promoter is an inducible promoter. In some cases, the promoter is a tissue-specific promoter. In some cases, the promoter is a cell-type-specific promoter. In some cases, the transcriptional control element (e.g., the promoter) is functional in the target cell type or target cell population. For example, in some cases, the transcriptional control element may function in eukaryotic cells (e.g., hepatocytes or hepatic sinusoidal endothelial cells).
[0269] Non-limiting examples of Pol II promoters operatively linked to polynucleotides encoding the long-term repressor fusion proteins disclosed herein include, but are not limited to: EF-1α, EF-1α core promoter, Jens Tornoe (JeT), promoters from cytomegalovirus (CMV), CMV Immediate Early (CMVIE), CMV enhancers, herpes simplex virus (HSV) thymidine kinase, early and late simian virus 40 (SV40), SV40 enhancers, long terminal repeats (LTRs) from retroviruses, mouse metallothionein-I, adenovirus major late promoter (Ad MLP), full-length CMV promoters, minimal CMV promoters, chicken β-actin promoters (CBA), CBA mixtures (CBh), chicken β-actin promoters with cytomegalovirus enhancers (CB7), chicken β-actin promoters and rabbit β-globulin splice acceptor site fusion (CAG), and other sarcoma viruses. Virus (RSV) promoter, HIV-Ltr promoter, hPGK promoter, HSV TK promoter, 7SK promoter, Mini-TK promoter, human synaptic protein I (SYN) promoter confers neuron-specific expression, β-actin promoter, supercore promoter 1 (SCP1), Mecp2 promoter for selective expression in neurons, minimal IL-2 promoter, Rous sarcoma virus enhancer / promoter (single), splenic focal formation virus long terminal repeat (LTR) promoter, TBG promoter, promoter from the gene for binding human thyroxine (liver-specific), PGK promoter, human ubiquitin C promoter (UBC), UCOE promoter (promoter of HNRPA2B1-CBX3), synthetic CAG promoter, histone H2 promoter, histone H3 promoter, U1a1 small nuclear RNA promoter (226 nt), U1b2 small nuclear RNA promoter (246 nt) The promoters include 26, GUSB promoter, CBh promoter, Rhodopsin (Rho) promoter, Splenic Focal Formation Virus (SFFV) promoter, Human H1 promoter (H1), POL1 promoter, TTR minimal enhancer / promoter, β-kinin promoter, Mouse Mammary Tumor Virus Long Terminal Repeat (LTR) promoter, Human Eukaryotic Initiation Factor 4A (EIF4A1) promoter, ROSA26 promoter, Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) promoter, tRNA promoter, and truncated versions and sequence variants thereof. In a specific embodiment, the Pol II promoter is EF-1α, wherein the promoter enhances the transfection efficiency of CRISPR nucleases in long-term culture, transgene transcription or expression, the proportion of expression-positive clones, and the copy number of free vectors.
[0270] Non-limiting examples of Pol III promoters operatively linked to polynucleotides encoding gRNA variants disclosed herein include, but are not limited to, U6, miniature U6, truncated U6 promoters, 7SK and H1 variants, BiH1 (bidirectional H1 promoter), BiU6, Bi7SK, BiH1 (bidirectional U6, 7SK, and H1 promoters), gorilla U6, rhesus monkey U6, human 7SK, human H1 promoters, and their truncated forms and sequence variants. In the foregoing embodiments, the pol III promoter enhances gRNA transcription. In a specific embodiment, the Pol III promoter is U6, wherein said promoter enhances gRNA expression. Experimental details and data using such promoters are provided in the examples.
[0271] The selection of appropriate vectors and promoters is entirely within the skill of a person skilled in the art, as it involves controlling expression. Expression vectors may also contain ribosome-binding sites for translation initiation and transcription terminators. Expression vectors may also include appropriate sequences for amplifying expression. Expression vectors may also include nucleotide sequences encoding protein tags (e.g., 6xHis tags, hemagglutinin tags, fluorescent proteins, etc.), which can be fused with long-term repressor fusion proteins, thus producing chimeric proteins for purification or detection.
[0272] The recombinant expression vectors of this disclosure may also include elements that promote robust expression of the proteins and gRNAs of this disclosure. For example, the recombinant expression vector may include one or more of poly(A) signals, intron sequences, or post-transcriptional regulatory elements such as the marmot hepatitis post-transcriptional regulatory element (WPRE). Exemplary poly(A) sequences include a short hGH poly(A) signal, an HSV TK poly(A) signal, a synthetic poly(A) signal, an SV40 poly(A) signal, a β-globin poly(A) signal, and a split poly(A) sequence (SEQ ID NO: 21851) having an SphI restriction site between two 60A segments. Those skilled in the art will be able to select suitable elements to include in the recombinant expression vectors described herein.
[0273] Polynucleotides encoding long-term repressor fusion proteins or gRNA sequences can be cloned individually into expression vectors. The selection of appropriate vectors and promoters is entirely within the skill of a person skilled in the art, as it involves controlling expression, for example, for repressing gene expression and / or epigenetic modifications. Expression vectors may also contain ribosome-binding sites for translation initiation and transcription terminators. Expression vectors may also include appropriate sequences for amplifying expression.
[0274] Nucleic acid sequences are inserted into vectors using various methods. Generally, DNA is inserted into appropriate restriction endonuclease sites using techniques known in the art. Vector components typically include, but are not limited to, one or more of the following: signal sequences, origins of replication, one or more marker genes, enhancer elements, promoters, and transcription termination sequences. The construction of suitable vectors containing one or more of these components employs standard ligation techniques known to those skilled in the art. Such techniques are well known in the art and are well described in scientific and patent literature. Various vectors are publicly available. For example, vectors can be in the form of plasmids, granules, viral particles, or bacteriophages that facilitate recombinant DNA manipulation, and the choice of vector generally depends on the host cell into which it will be introduced. Thus, a vector can be a self-replicating vector, i.e., a vector existing as an extrachromosomal entity whose replication is independent of chromosome replication, such as a plasmid. Alternatively, a vector can be one that, when introduced into a host cell, is integrated into the host cell genome and replicates along with the chromosome into which it is integrated. Once introduced into a suitable host cell, the expression of a long-term repressor fusion protein or gRNA can be determined using any nucleic acid or protein assay known in the art. For example, the presence of transtranscribed mRNA of the long-term repressor fusion protein can be detected and / or quantified by conventional hybridization assays (e.g., Northern blot analysis), amplification procedures (e.g., RT-PCR), SAGE (U.S. Patent No. 5,695,937), and array-based techniques (see, for example, U.S. Patent Nos. 5,405,783, 5,412,087, and 5,445,934) using probes complementary to any region of the CasX polynucleotide.
[0275] In some embodiments, vectors are generated for transcription of a long-term repressor fusion protein and for expression and recovery of the resulting encoding mRNA. In some embodiments, mRNA is generated via in vitro transcription (IVT) using a PCR product or a linearized plasmid DNA template and T7 RNA polymerase, wherein the plasmid contains a T7 promoter. If a PCR product is used, the DNA sequence encoding a candidate mRNA is cloned into a plasmid containing a T7 promoter, wherein the plasmid DNA template is linearized and then used for an IVT reaction to express the mRNA. Exemplary methods for generating such vectors and for generating and recovering mRNA are provided in the examples below.
[0276] VIII. Particles used for delivering the LTRP:gRNA system
[0277] On the other hand, this disclosure provides particulate compositions for delivering gene repressor systems (such as the LTRP:gRNA system described herein) to cells or subjects for transcriptional repression or silencing of genes. Parts contemplated within the scope of this disclosure include, but are not limited to, nanoparticles, such as synthetic nanoparticles, polymer nanoparticles, lipid nanoparticles, viral particles, and virus-like particles. As described herein, the particles of this disclosure may optionally encapsulate a payload, such as a gRNA variant, in combination with mRNA encoding a repressor fusion protein of any of the embodiments described herein. Alternatively or additionally, the particles of this disclosure may encapsulate a payload of a gRNA variant and an engineered repressor fusion protein, for example, when associated with a ribonucleoprotein (RNP) complex. In some embodiments, the particles are synthetic nanoparticles encapsulating a payload of a gRNA variant and mRNA encoding a repressor fusion protein of any of the embodiments described herein. In some embodiments, the synthetic nanoparticles comprise biodegradable polymer nanoparticles (PNPs). In some embodiments, materials used to generate biodegradable polymeric nanoparticles (PNPs) include polylactide, poly(lactic-co-glycolic acid) (PLGA), poly(ethyl cyanoacrylate), poly(butyl cyanoacrylate), poly(isobutyl cyanoacrylate), and poly(isohexyl cyanoacrylate), polyglutamic acid (PGA), poly(α-caprolactone) (PCL), cyclodextrin, and natural polymers such as chitosan, albumin, gelatin, and alginate, which are the most commonly used polymers for synthesizing PNPs (Production and clinical development of nanoparticles for gene delivery. Molecular Therapy-Methods & Clinical Development 3:16023; doi:10.1038 (2016)). In other embodiments, the particles are lipid nanoparticles (LNPs) that encapsulate a gRNA variant of any of the embodiments described herein and an mRNA encoding a long-term repressor fusion protein, which will be described more fully below. In other embodiments, the particles are lipid nanoparticles that individually encapsulate a gRNA variant of any of the embodiments described herein and an mRNA encoding a long-term repressor fusion protein in separate particles, which are co-formulated into a mixture for administration, as described more fully below. In other embodiments, the particles are lipid nanoparticles that individually encapsulate a gRNA variant of any of the embodiments and an mRNA encoding a long-term repressor fusion protein, and both types of particles are administered separately.
[0278] a. Lipid nanoparticles (LNP)
[0279] This disclosure provides lipid nanoparticles (LNPs) for delivering the LTRP:gRNA system described herein to cells or subjects. In some embodiments, the LNPs of this disclosure are tissue-specific, exhibit excellent biocompatibility, and can efficiently deliver the LTRP:gRNA system, and therefore can be used for transcriptional repression of target genes.
[0280] This disclosure further provides LNP compositions and pharmaceutical compositions comprising the various LNPs described herein.
[0281] Nucleic acid polymers, in their native form, are generally unstable in biofluids and cannot penetrate into the cytoplasm of target cells, thus necessitating delivery systems. Lipid nanoparticles (LNPs) have been shown to be useful for protecting nucleic acids and delivering them to tissues and cells. Furthermore, compared to DNA vectors, using mRNA to encode long-term repressor fusion proteins in LNPs eliminates the possibility of undesirable genome integration. Moreover, mRNA efficiently transfects both mitotic and non-mitotic cells because it does not need to enter the nucleus, as it functions within the cytoplasmic compartment. Therefore, LNPs, as a delivery platform, offer the additional advantage of being able to co-decode both mRNA and gRNA encoding long-term repressor fusion proteins into a single LNP particle.
[0282] Therefore, in various embodiments, this disclosure covers lipid nanoparticles and compositions that can be used for a variety of purposes, including in vitro and in vivo delivery of encapsulated or associated (e.g., complexed) therapeutic agents such as nucleic acids to cells. In some embodiments, this disclosure covers methods of treating or preventing a disease or condition in a subject of need by contacting the subject with lipid nanoparticles that encapsulate or associate with a suitable therapeutic agent, said therapeutic agent being complexed through various physical, chemical, or electrostatic interactions between one or more lipid components in a composition for preparing LNPs.
[0283] In some embodiments, the LNP comprises the LTRP:gRNA system as described herein for repressing or silencing genes associated with a disease or condition. In some embodiments, this disclosure provides an LNP in which gRNA and mRNA encoding a long-term repressor fusion protein are integrated into a single LNP particle. In some embodiments, the LNP comprises mRNA and gRNA having a linked target sequence complementary to the sequence of a gene targeted to repress or silence, said mRNA comprising a sequence selected from the group consisting of SEQ ID NO: 2409-18636 or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with it, said gRNA comprising a sequence selected from the group consisting of SEQ ID NO: 1744-1746, 2136-2144, 2146-2154, and 2156-2164. In one embodiment, the LNP comprises mRNA and gRNA having a linked target sequence complementary to the sequence of a gene targeted to repress or silence, the mRNA comprising a sequence selected from the group consisting of SEQ ID NO: 2411, 2421, 2467, and 2477, and the gRNA comprising the sequence of SEQ ID NO: 2156. In other embodiments, this disclosure provides LNPs in which gRNA that can be formulated together in different ratios for administration and mRNA encoding a long-term repressor fusion protein are integrated into a separate LNP population.
[0284] The lipid nanoparticles and lipid nanoparticle compositions of this disclosure can be used to repress the expression of desired proteins both in vitro and in vivo by contacting cells with lipid nanoparticles comprising one or more novel ionizable lipids described herein, wherein the lipid nanoparticles encapsulate or associate with nucleic acids expressed to produce the desired protein (e.g., messenger RNA encoding a repressor fusion protein). In some embodiments, the lipid nanoparticles and compositions can be used to repress the expression of target genes both in vitro and in vivo by contacting cells with lipid nanoparticles comprising one or more novel cationic lipids described herein, wherein the lipid nanoparticles encapsulate or associate with one or more nucleic acids of the LTRP:gRNA system of this disclosure. The lipid nanoparticles and compositions of embodiments of this disclosure can also be used, alone or in combination, to co-deliver different nucleic acids (e.g., mRNA and plasmid DNA), such as to provide the effect of co-localizing different nucleic acids (e.g., mRNA and gRNA encoding suitable gene repressors or enzymes for targeting genes).
[0285] In some embodiments, the LNPs and LNP compositions described herein comprise at least one cationic lipid, at least one conjugated lipid, at least one steroid or a derivative thereof, at least one additional lipid, or any combination thereof. Alternatively, the lipid compositions disclosed herein may comprise ionizable lipids, such as ionizable cationic lipids, accessory lipids (typically phospholipids), cholesterol, and polyethylene glycol-lipid conjugates (PEG-lipids), to improve colloidal stability in biological environments by, for example, reducing the specific uptake of plasma proteins and forming a hydration layer on the nanoparticles. Such lipid compositions can be formulated in typical molar ratios of 50:10:37-39:1.5-2.5 or 20-50:8-65:25-40:1-2.5 and can be varied to tailor individual properties.
[0286] The LNPs and LNP compositions disclosed herein are configured to protect the encapsulated payload of the system disclosed herein and deliver the payload to tissues and cells, whether in vitro or in vivo. Various embodiments of the LNPs and LNP compositions disclosed herein are described in more detail herein.
[0287] cationic lipids
[0288] In some aspects, the LNPs and LNP compositions disclosed herein comprise at least one cationic lipid. The term "cationic lipid" refers to a lipid species having a net positive charge. In some embodiments, the cationic lipid is an ionizable cationic lipid having a net positive charge at a selected pH (e.g., physiological pH). In some embodiments, the pKa of the ionizable cationic lipid is less than 7, such that the LNPs and LNP compositions achieve efficient encapsulation of the payload at relatively low pH. In some embodiments, the pKa of the cationic lipid is 5 to 8, 5.5 to 7.5, 6 to 7, or 6.5 to 7. In some embodiments, the cationic lipid can be protonated at pH below the pKa of the cationic lipid, and it can be substantially neutral at pH above the pKa. The LNPs and LNP compositions can be safely delivered in vivo to target organs (e.g., liver, lung, heart, spleen, and to tumors) and / or cells (hepatocytes, LSECs, cardiomyocytes, cancer cells, etc.) and, following endocytosis, exhibit a positive charge to release the encapsulated payload through electrostatic interactions with anionic proteins of the endosome membrane.
[0289] Early formulations of LNPs using permanently charged cationic lipids produced positively charged LNPs that were shown to be toxic in vivo and rapidly cleared by phagocytes. By converting them into ionizable cationic lipids carrying tertiary amines, specifically ionizable cationic lipids with pKa < 7, the LNPs achieved efficient encapsulation of nucleic acid polymers at low pH through electrostatic interactions with the negatively charged phosphate backbone of mRNA. This also made the system primarily neutral at physiological pH, thus mitigating the problems associated with permanently charged cationic lipids.
[0290] As used herein, “ionizable lipid” means an amine-containing lipid that can be readily protonated, and, for example, the lipid may be a lipid whose charge state changes according to the ambient pH. Ionizable lipids can be protonated (positively charged) at pH values below the pKa of cationic lipids, and the ionizable lipids can be substantially neutral at pH values above the pKa. In one example, an LNP may comprise protonated ionizable lipids and / or neutral ionizable lipids. In some embodiments, the pKa of the LNP is 5 to 8, 5.5 to 7.5, 6 to 7, or 6.5 to 7. The pKa of the LNP is important for the in vivo stability and release of the nucleic acid payload of the LNP in target cells or organs. In some embodiments, LNPs having the aforementioned pKa range can be safely delivered in vivo to target organs (e.g., liver, lung, heart, spleen, and to tumors) and / or target cells (hepatocytes, LSECs, cardiomyocytes, cancer cells, etc.) and, following endocytosis, exhibit a positive charge to release the encapsulated payload through electrostatic interactions with anionic proteins of the endosome membrane.
[0291] Ionizable lipids are ionizable compounds that generally have properties similar to lipids and can play a role in efficiently encapsulating nucleic acid payloads within LNPs through electrostatic interactions with nucleic acids (e.g., mRNA of this disclosure).
[0292] Depending on the type of amines and tails contained in the ionizable lipids, (i) nucleic acid encapsulation efficiency; (ii) PDI (dispersion index); and / or (iii) nucleic acid delivery efficiency to tissues and / or cells of the organ constituting the LNP (e.g., hepatocytes or sinusoidal endothelial cells in the liver). In some embodiments, the ionizable lipids are ionizable cationic lipids and comprise approximately 46 mol% to approximately 66 mol% of the total lipids present in the particles.
[0293] LNPs containing ionizable lipids including amines may have one or more of the following properties: (1) the ability to encapsulate nucleic acids with high efficiency; (2) uniformly sized preparation particles (or with low PDI values); and / or (3) excellent nucleic acid delivery efficiency to organs such as liver, lung, heart, spleen, bone marrow, and to tumors and / or cells constituting such organs (e.g., hepatocytes, LSECs, cardiomyocytes, cancer cells, etc.).
[0294] In certain embodiments, the cationic lipid form plays a crucial role in both nucleic acid encapsulation via electrostatic interactions and intracellular release via disruption of the endosome membrane. The nucleic acid payload is encapsulated within the LNP through ionic interactions formed by its interaction with the positively charged cationic lipid. Non-limiting examples of the cationic lipid components used in the LNPs of this disclosure are selected from DLin-MC3-DMA (4-(dimethylamino)butanoic acid heptadecane-6,9,28,31-tetraen-19-yl ester), DLin-KC2-DMA (2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane), TNT (1,3,5-triazine-2,4,6-trione), and TT (N1,N3,N5-tris(2-aminoethyl)benzene-1,3,5-tricarboxamide). Non-limiting examples of accessory lipids used in the LNPs disclosed herein are selected from DSPC (1,2-distearyl-sn-glycerol-3-phosphate choline), POPC (2-oleoyl-1-palmitoyl-sn-glycerol-3-phosphate choline), DOPE (1,2-dioleoyl-sn-glycerol-3-phosphate ethanolamine), 1,2-dioleoyl-sn-glycerol-3-phosphate-(1'-rac-glycerol)DOPG, 1,2-dimyristoyl-sn-glycerol-3-phosphate ethanolamine (DMPE), 1,2-dilauroyl-sn-glycerol-3-phosphate choline (DLPC), sphingolipids, and ceramides. Cholesterol and PEG-DMG ((R)-2,3-bis(octadecoxy)propyl-1-(methoxy polyethylene glycol 2000) carbamate), PEG-DSG (1,2-distearyl-rac-glycerol-3-methylpolyoxyethylene glycol 2000) or DSPE-PEG2k (1,2-distearyl-sn-glycerol-3-phosphate ethanolamine-N-[amino(polyethylene glycol)-2000]) are components in the LNP of this disclosure for the stability, cycling and size of the LNP.
[0295] In some embodiments, the cationic lipids in the LNP of this disclosure comprise a tertiary amine. In some embodiments, the tertiary amine comprises an alkyl chain linked to the N-terminus of the tertiary amine via an ether bond. In some embodiments, the alkyl chain comprises a C12-C30 alkyl chain having 0 to 3 double bonds. In some embodiments, the alkyl chain comprises a C16-C22 alkyl chain. In some embodiments, the alkyl chain comprises a C18 alkyl chain. Numerous cationic lipids and related analogues have been described in U.S. Patent Publications Nos. 20060083780, 20060240554, 20110117125, 20190336608, 20190381180, and 20200121809; U.S. Patents Nos. 5,208,036, 5,264,618, 5,279,833, 5,283,185, 5,753,613, 5,785,992, 9,738,593, 10,106,490, 10,166,298, 10,221,127, and 11,219,634; and PCT Publication No. WO The contents of document No. 96 / 10390 are incorporated herein by reference in their entirety.
[0296] In some embodiments, the cationic lipids in the LNP of this disclosure may comprise, for example, one or more ionizable cationic lipids, wherein the ionizable cationic lipids are dialkyl lipids. In other embodiments, the ionizable cationic lipids are trialkyl lipids.
[0297] In some embodiments, the cationic lipids in the LNP of this disclosure are selected from 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLenDMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-K-C2-DMA), and 2,2-dilinoleyl-4-(3-dimethylaminopropane)-[1,3]-dioxolane (DLin-K-C2-DMA). DLin-K-C3-DMA, DLin-K-C4-DMA, DLin-K-C4-DMA, DLin-K6-DMA, DLin-K-C4-DMA, DLin-K6-DMA, DLin-K-C4-DMA, DLin-K-C4-DMA, DLin-K-C6-DMA, DLin-K-C4-DMA, DLin-K-C4-DMA, DLin-K6-DMA, DLin-K-C4-DMA, DLin-K6-DMA, DLin-K6-DMA, DLin-K6-C4 ...DMA, DLin-K6-C4-DMA, DLin-K6-DMA, DLin-K6-C4-DMA, DLin-K6-DMA, DLin-K6-C4-DMA, DLin-K6-DMA, DLin-K6-C4-DMA, DLin-K6-DMA, DLin-K6-C4-DMA, DLin-K6-DMA, DL PZ), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), 1,2-dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-dilinoleyloxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-dilinoleyloxy-3-morpholinopropane (DLin-MA), 1,2-dioleoyl-3- Dimethylaminopropane (DLinDAP), 1,2-dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-dilinoleyloxy-3-trimethylaminopropane chloride (DLin-TMA.Cl), 1,2-dioleoyl-3-trimethylaminopropane chloride (DLin-TAP).Cl), 1,2-dioleyloxy-3-(N-methylpiperazinyl)propane (DLin-MPZ), 3-(N,N-dioleenylamino)-1,2-propanediol (DLinAP), 3-(N,N-dioleylamino)-1,2-propanediol (DOAP), 1,2-dioleyloxy-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), 1,2-dioleyloxy-N,N-dimethylaminopropane Alkane (DODMA), 1,2-distearyloxy-N,N-dimethylaminopropane (DSDMA), N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), 3-(N-(N',N'-dimethylaminoethane)-carbamoyl)cholesterol (DC-Chol), N- (1,2-Dimyristoyloxypropyl-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide (DMRIE), 2,3-dioleoyloxy-N-[2(spermine-formylamino)ethyl]-N,N-dimethyl-1-propanetrimonium trifluoroacetate (DOSPA), octadecylaminoglycyl spermine (DOGS), 3-dimethylamino-2-(cholest-5-en-3-β-oxybut-4-oxy)-1-(cis,cis-9,12-octadecadienoxy)propane (CLinDMA), 2-[5′-( Cholesterol-5-en-3-β-oxy)-3′-oxaproloxy)-3-dimethyl-1-(cis,cis-9′,1-2′-octadecadienoxy)propane (CpLinDMA), N,N-dimethyl-3,4-dioleoyloxybenzylamine (DMOBA), 1,2-N,N′-dioleoylcarbamoyl-3-dimethylaminopropane (DOcarbDAP), 1,2-N,N′-dioleoylcarbamoyl-3-dimethylaminopropane (DLincarbDAP), and any combination thereof.
[0298] In some embodiments, the cationic lipids in the LNP of this disclosure are selected from heptadecano-6,9,28,31-tetraen-19-yl ester of 4-(dimethylamino)butyrate (DLin-MC3-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), (1,3,5-triazine-2,4,6-trione) (TNT), N1,N3,N5-tris(2-aminoethyl)benzene-1,3,5-tricarboxamide (TT), and any combination thereof.
[0299] In some embodiments, the N / P ratio (nitrogen from cations / ionizable lipids and phosphate from nucleic acids) in the LNP of this disclosure ranges from about 3:1 to 7:1, or about 4:1 to 6:1, or 3:1, or 4:1, or 5:1, or 6:1, or 7:1.
[0300] Conjugated lipids
[0301] In some embodiments, the LNPs and LNP compositions of this disclosure comprise at least one conjugated lipid. In some embodiments, the conjugated lipid may be selected from polyethylene glycol (PEG)-lipid conjugates, polyamide (ATTA)-lipid conjugates, cationic polymer-lipid conjugates (CPL), and any combination thereof. In some cases, the conjugated lipid may inhibit the aggregation of the LNPs of this disclosure.
[0302] In some embodiments, the conjugated lipids of the LNP disclosed herein comprise polyethylene glycol-modified lipids. The terms “polyethylene glycol (PEG)-lipid conjugate,” “polyethylene glycol-modified lipid,” “lipid-PEG conjugate,” “lipid-PEG,” “PEG-lipid,” “PEG-lipid,” or “lipid-PEG” are used interchangeably herein and refer to lipids attached to a hydrophilic polyethylene glycol (PEG) polymer. PEGylated lipids contribute to the stability of the LNP and the LNP composition and reduce LNP aggregation.
[0303] When PEG-lipids can form surface lipids, the size of LNPs can be readily altered by changing the ratio of surface (PEG) lipids to core (ionizable cationic) lipids. In some embodiments, the PEG-lipids of the LNPs of this disclosure can be varied between about 1 to 5 mol% to modify particle properties such as size, stability, and cycling time.
[0304] Lipid-PEG conjugates contribute to the stability of nanoparticles in serum within LNPs and prevent aggregation between nanoparticles. Additionally, lipid-PEG conjugates can protect nucleic acids (such as mRNA encoding the repressor fusion protein of this disclosure or gRNA of this disclosure) from enzyme degradation during in vivo delivery of nucleic acids, and enhance the stability of nucleic acids in vivo and increase the half-life of the delivered nucleic acids encapsulated in nanoparticles. Examples of PEG-lipid conjugates include, but are not limited to, PEG-DAG conjugates, PEG-DAA conjugates, and mixtures thereof. In some embodiments, the PEG-lipid conjugates are selected from the group consisting of PEG-diacylglycerol (PEG-DAG) conjugates, PEG-dialkyloxypropyl (PEG-DAA) conjugates, PEG-phospholipid conjugates, PEG-ceramide (PEG-Cer) conjugates, and mixtures thereof.
[0305] In some embodiments, the polyethylene glycol-modified lipids of the LNP disclosed herein are selected from PEG-ceramide, PEG-diacylglycerol, PEG-dialkoxypropyl, PEG-dialkoxypropyl carbamate, PEG-phosphatidylethanolamine, PEG-phospholipid, PEG-succinate diacylglycerol, and any combination thereof.
[0306] In some embodiments, the polyethylene glycol-modified lipid of the LNP disclosed herein is PEG-dialkoxypropyl. In some embodiments, the polyethylene glycol-modified lipid is selected from PEG-decoxypropyl (C10), PEG-lauroxypropyl (C12), PEG-myristoxypropyl (C14), PEG-palmitoxypropyl (C16), PEG-distearateoxypropyl (C18), and any combination thereof.
[0307] In other embodiments, the lipid-PEG conjugate of the LNP disclosed herein may be a PEG conjugated with phospholipids, such as phospholipid ethanolamine (PEG-PE), a PEG conjugated with ceramides (PEG-CER, ceramide-PEG conjugate, ceramide-PEG, cholesterol or PEG conjugated with its derivatives, PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, PEG-DSPE (DSPE-PEG), and mixtures thereof, and may be, for example, C16-PEG2000 ceramide (N-palmitoyl-sphingosine-1-{succinoyl[methoxy(polyethylene glycol)2000]}), DMG-PEG 2000, 14:0 PEG2000 PE.
[0308] In some embodiments, the polyethylene glycol-modified lipids of the LNP disclosed herein are selected from 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol, 4-O-(2′,3′-di(tetradecanoyloxy)propyl-1-O-(ω-methoxy(polyethoxy)ethyl)succinate (PEG-S-DMG), ω-methoxy(polyethoxy)ethyl-N-(2,3-di(tetradecanoyloxy)propyl)carbamate, 2,3-di(tetradecanoyloxy)propyl-N-(ω-methoxy(polyethoxy)ethyl)carbamate, and any combination thereof.
[0309] In some embodiments, the polyethylene glycol-modified lipids of the LNP disclosed herein are selected from mPEG2000-1,2-di-O-alkyl-sn3-carbonylglycerol (PEG-C-DOMG), 1-[8′-(1,2-dimyristoyl-3-propoxy)-formamido-3′,6′-dioxaoctyl]carbamoyl-w-methyl-poly(ethylene glycol) (2KPEG-DMG), and any combination thereof.
[0310] In some embodiments, PEG is directly linked to the lipids of the polyethylene glycol-modified lipid. In other embodiments, PEG is linked to the lipids of the polyethylene glycol-modified lipid via a connector portion selected from ester-free or ester-containing connector portions. Non-limiting examples of ester-free connector portions include amide (-C(O)NH-), amino (-NR-), carbonyl (-C(O)-), urethane (-NHC(O)O-), urea (-NHC(O)NH-), disulfide (-SS-), ether (-O-), succinyl (-(O)CCH2CH2C(O)-), succinimide (-NHC(O)CH2CH2C(O)NH-), ethers, disulfides, and combinations thereof. For example, the connector may contain both urethane and amide connector portions. Non-limiting examples of ester-containing connector portions include carbonate (-OC(O)O-), succinyl, phosphate (-O-(O)POH-O-), sulfonate, and combinations thereof.
[0311] The average molecular weight of the PEG portion of the LNP of this disclosure can range from about 550 Daltons to about 10,000 Daltons. In some embodiments, the average molecular weight of the PEG portion is about 750 Daltons to about 5,000 Daltons, about 1,000 Daltons to about 4,000 Daltons, about 1,500 Daltons to about 3,000 Daltons, about 750 Daltons to about 3,000 Daltons, or about 1,750 Daltons to about 2,000 Daltons.
[0312] In some embodiments, the conjugated lipids (e.g., polyethylene glycol-modified lipids) comprise about 1 mol% to about 60 mol%, about 2 mol% to about 50 mol%, about 5 mol% to about 40 mol%, or about 5 mol% to about 20 mol% of the total lipids present in the LNP and / or LNP composition. In some embodiments, the conjugated lipids comprise about 0.5 mol% to about 3 mol% of the total lipids present in the particles.
[0313] In another embodiment, the conjugated lipids (e.g., PEGylated lipids) of the LNP of this disclosure account for at least about 1 mol%, 2 mol%, 5 mol%, 10 mol%, 15 mol%, 20 mol%, 25 mol%, 30 mol%, 35 mol%, 40 mol%, 45 mol%, 50 mol%, 55 mol%, or 60 mol%, or any intermediate range of the foregoing, of the total lipids present in the LNP and / or the LNP composition.
[0314] For the lipids in the lipid-PEG conjugates of the LNP of this disclosure, any lipid capable of binding to polyethylene glycol can be used without limitation, and phospholipids and / or cholesterol, which are other elements of the LNP, can also be used. In some embodiments, the lipids in the lipid-PEG conjugates can be ceramides, dimyristoylglycerol (DMG), succinoyl-diacylglycerol (s-DAG), distearate phosphatidylcholine (DSPC), distearate phosphatidylethanolamine (DSPE), or cholesterol, but are not limited thereto.
[0315] In the lipid-PEG conjugates of the LNP disclosed herein, PEG can be directly conjugated to the lipid or linked to the lipid via a linker portion. Any linker portion suitable for binding PEG to the lipid can be used, and includes, for example, ester-free and ester-containing linker portions. The ester-free linker portions include, but are not limited to, amide groups (-C(O)NH-), amino groups (-NR-), carbonyl groups (-C(O)-), carbamate groups (-NHC(O)O-), urea groups (-NHC(O)NH-), disulfides (-SS-), ethers (-O-), succinoyl groups (-(O)CCH2CH2C(O)-), succinimide groups (-NHC(O)CH2CH2C(O)NH-), ethers, and disulfides, but also combinations thereof (e.g., linkers containing both carbamate and amide linker portions). Ester-containing linker portions include, for example, carbonates (-OC(O)O-), succinyl groups, phosphate esters (-O-(O)POH-O-), sulfonates, and combinations thereof, but are not limited thereto.
[0316] steroids
[0317] In some embodiments, the LNP and LNP composition disclosed herein comprise at least one steroid or a derivative thereof. In some embodiments, the steroid comprises cholesterol. In some embodiments, the LNP and LNP composition comprises a cholesterol derivative selected from: cholesterolanol, cholesterolanone, cholesterol ketone, coprostinol, cholesterol-2′-hydroxyethyl ether, cholesterol-4′-hydroxybutyl ether, and any combination thereof.
[0318] In some embodiments, the steroids (e.g., cholesterol) of the LNP of this disclosure account for about 1 mol% to about 60 mol%, about 2 mol% to about 50 mol%, about 5 mol% to about 40 mol%, or about 5 mol% to about 20 mol% of the total lipids present in the LNP and / or the LNP composition. In other embodiments, the steroids (e.g., cholesterol) of the LNP of this disclosure account for at least about 1 mol%, 2 mol%, 5 mol%, 10 mol%, 15 mol%, 20 mol%, 25 mol%, 30 mol%, 35 mol%, 40 mol%, 45 mol%, 50 mol%, 55 mol%, or 60 mol%, or an intermediate range of any of the foregoing, of the total lipids present in the LNP and / or the LNP composition.
[0319] Other lipids
[0320] In some embodiments, the LNP and LNP composition disclosed herein include at least one additional lipid. In some embodiments, the additional lipid is a non-cationic lipid selected from anionic lipids, neutral lipids, or both. In some embodiments, the additional lipid comprises at least one phospholipid. In some embodiments, the phospholipid is selected from anionic phospholipids, neutral phospholipids, or both. The phospholipids of the LNP and LNP composition can function in covering and protecting the core of the LNP formed by the interaction of cationic lipids and nucleic acids in the LNP, and can promote cell membrane permeation and endosome escape during intracellular delivery of nucleic acids by binding to the phospholipid bilayer of the target cell. Phospholipids that can promote LNP fusion with cells can include, but are not limited to, any phospholipid selected from the group described below.
[0321] In some embodiments, the LNP and the LNP composition comprise at least one phospholipid selected from, but not limited to, the following: dipalmitoylphosphatidylcholine (DPPC), distearylphosphatidylcholine (DSPC), dioleoylphosphatidylethanolamine (DOPE), dioleoylphosphatidylcholine (DOPC), dioleoylphosphatidylglycerol (DOPG), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), palmitoylglycerol phosphatidylglycerol (POPG), dipalmitoylphosphatidylethanolamine (DPPE), dipalmitoylphosphatidylglycerol (DPPG), and dimyristoylphosphatidylethanolamine (DMPE). Distearate phosphatidylethanolamine (DSPE), monomethylphosphatidylethanolamine, dimethylphosphatidylethanolamine, diacylphosphatidylethanolamine (DEPE), stearoylphosphatidylethanolamine (SOPE), lecithin (EPC), phosphatidylethanolamine (PE), 1,2-dioleoyl-sn-glycerol-3-phosphate ethanolamine, 1-palmitoyl-2-oleoyl-sn-glycerol-3-phosphate choline (POPC), 1,2-dioleoyl-sn-glycerol-3-[phospho-L-serine] (DOPS), 1,2-dioleoyl-sn-glycerol-3-[phospho-L-serine], and any combination thereof. In one instance, LNPs containing DOPE can be effective in mRNA delivery.
[0322] In some embodiments, the additional lipids (e.g., phospholipids) of the LNP of this disclosure account for about 1 mol% to about 60 mol%, about 2 mol% to about 50 mol%, about 5 mol% to about 40 mol%, or about 5 mol% to about 20 mol% of the total lipids present in the LNP and / or the LNP composition. In other embodiments, the additional lipids (e.g., phospholipids) of the LNP of this disclosure account for at least about 1 mol%, 2 mol%, 5 mol%, 10 mol%, 15 mol%, 20 mol%, 25 mol%, 30 mol%, 35 mol%, 40 mol%, 45 mol%, 50 mol%, 55 mol%, or 60 mol%, or any intermediate range of the foregoing, of the total lipids present in the LNP and / or the LNP composition.
[0323] It should be understood that the total lipids present in LNP and / or LNP compositions comprise a combination of cationic lipids or ionizable cationic lipids, conjugated lipids (e.g., PEGylated lipids), steroids (e.g., cholesterol) and other lipids (e.g., phospholipids).
[0324] LNPs and / or LNP compositions can be prepared by dissolving total lipids (or a portion thereof) in an organic solvent (e.g., ethanol) and then mixing them with a payload (e.g., the system's nucleic acid) dissolved in an acidic buffer (e.g., pH 4) using a micromixer. At this pH, the cationic lipids are positively charged and interact with the negatively charged nucleic acid polymer. The resulting nanostructure containing the nucleic acid is then converted to a neutral LNP upon dialyzing against a neutral buffer, and the organic solvent (e.g., ethanol) can be removed, and the LNP exchanged into a physiologically relevant buffer. The LNPs and / or LNP compositions thus formed have a unique electronically dense nanostructured core, in which the cationic lipids are organized into reverse micelles surrounding the encapsulated payload, compared to conventional bilayer liposome structures. In another embodiment, the LNPs can form a filter bubble-like structure with nucleic acids in an aqueous vesicle along a non-electronically dense lipid core.
[0325] b. Properties of lipid nanoparticles
[0326] In some embodiments, the LNP and / or the LNP composition comprises about 50 mol% to about 85 mol% of cationic lipids or ionizable cationic lipids, about 0.5 mol% to about 10 mol% of conjugated lipids (e.g., PEGylated lipids), about 0.5 mol% to about 10 mol% of steroids (e.g., cholesterol), and about 5 mol% to about 50 mol% of other lipids (e.g., phospholipids). In some embodiments, the LNP and / or the LNP composition comprises about 50 mol% to about 85 mol% of cationic lipids or ionizable cationic lipids, about 0.5 mol% to about 5 mol% of conjugated lipids (e.g., PEGylated lipids), about 0.5 mol% to about 5 mol% of steroids (e.g., cholesterol), and about 5 mol% to about 20 mol% of other lipids (e.g., phospholipids).
[0327] In some embodiments, the LNP and / or LNP compositions disclosed herein comprise a cationic lipid:another lipid (e.g., phospholipid):steroid (e.g., cholesterol):conjugated lipid (e.g., PEGylated lipid) in a molar ratio of 20 to 50:10 to 30:30 to 60:0.5 to 5, 25 to 45:10 to 25:40 to 50:0.5 to 3, 25 to 45:10 to 20:40 to 55:0.5 to 3, or 25 to 45:10 to 20:40 to 55:1.0 to 1.5.
[0328] In some embodiments, the total lipids:load ratio (mass / mass) of the LNP and / or LNP compositions disclosed herein is about 1:about 100. In some embodiments, the total lipids:load ratio is about 1:about 50, about 2:about 25, about 3:about 20, about 4:about 15, or about 5:about 10. In some embodiments, the total lipids:load ratio is about 5:about 15, for example about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or an intermediate range of any of the foregoing.
[0329] In some embodiments, the LNP of this disclosure comprises a total lipid:nucleic acid mass ratio of about 5:1 to about 15:1. In some embodiments, the weight ratio of cationic lipids and nucleic acids included in the LNP may be 1 to 20:1, 1 to 15:1, 1 to 10:1, 5 to 20:1, 5 to 15:1, 5 to 10:1, 7.5 to 20:1, 7.5 to 15:1, or 7.5 to 10:1.
[0330] In some embodiments, the LNP disclosed herein may comprise 20 to 50 parts by weight of cationic lipids, 10 to 30 parts by weight of phospholipids, 20 to 60 parts by weight (or 20 to 60 parts by weight) of cholesterol, and 0.1 to 10 parts by weight (or 0.25 to 10 parts by weight, 0.5 to 5 parts by weight) of a lipid-PEG conjugate. Alternatively, based on the total nanoparticle weight, the LNP may comprise 20% to 50% by weight of cationic lipids, 10% to 30% by weight of phospholipids, 20% to 60% by weight (or 30% to 60% by weight) of cholesterol, and 0.1% to 10% by weight (or 0.25% to 10% by weight, 0.5% to 5% by weight) of a lipid-PEG conjugate. As an alternative, based on the total nanoparticle weight, the LNP may contain 25% to 50% cationic lipids, 10% to 20% phospholipids, 35% to 55% cholesterol, and 0.1% to 10% (or 0.25% to 10% and 0.5% to 5% lipid-PEG conjugates) of lipids.
[0331] In some embodiments, the average diameter of the LNP disclosed herein is approximately 20 nm to 200 nm, 20 nm to 180 nm, 20 nm to 170 nm, 20 nm to 150 nm, 20 nm to 120 nm, 20 nm to 100 nm, 20 nm to 90 nm, 30 nm to 200 nm, 30 nm to 180 nm, 30 nm to 170 nm, 30 nm to 150 nm, 30 nm to 120 nm, 30 nm to 100 nm, 30 nm to 90 nm, 40 nm to 200 nm, 40 nm to 180 nm, 40 nm to 170 nm, 40 nm to 150 nm, 40 nm to 120 nm, 40 nm to 100 nm, 40 nm to 90 nm, 40 nm to 80 nm, 40 nm to 70 nm, 50 nm to 200 nm, 50 nm to 180 nm, 50 nm to 170 nm, 50 nm to 200 nm, 50 nm to 180 nm, 50 nm to 170 nm, 50 nm to 170 nm, 50 nm to 18 ... nm to 150 nm, 50 nm to 120 nm, 50 nm to 100 nm, 50 nm to 90 nm, 60 nm to 200 nm, 60 nm to 180 nm, 60 nm to 170 nm, 60 nm to 150 nm, 60 nm to 120 nm, 60 nm to 100 nm, 60 nm to 90 nm, 70 nm to 200 nm, 70 nm to 180 nm, 70 nm to 170 nm, 70 nm to 150 nm, 70 nm to 120 nm, 70 nm to 100 nm, 70 nm to 90 nm, 80 nm to 200 nm, 80 nm to 180 nm, 80 nm to 170 nm, 80 nm to 150 nm, 80 nm to 120 nm, 80 nm to 100 nm, 80 nm to 90 nm, 90 nm to 200 nm, 90 nm to 180 nm, 90 nm to 170 nm nm, 90 nm to 150 nm, 90 nm to 120 nm, or 90 nm to 100 nm, or any intermediate range of the foregoing.
[0332] In some embodiments, the LNPs and / or LNP compositions of this disclosure have a positive charge at an acidic pH and can encapsulate the payload (e.g., a therapeutic agent, such as the LTRP:gRNA system, or a polynucleotide encoding it) by electrostatic charge generated by the negative charge of the payload (e.g., a therapeutic agent). The term “encapsulation” refers to a mixture of lipids that surround and encapsulate the payload (e.g., a therapeutic agent) under physiological conditions, thereby forming an LNP. The term “encapsulation efficiency” as used herein is the amount of payload (e.g., a therapeutic agent) encapsulated by the LNP divided by the total amount of payload (e.g., a therapeutic agent) used to load the payload (e.g., a therapeutic agent) into the LNP. The encapsulation efficiency of the LNPs and / or LNP compositions can be 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 94% or more, or 95% or more. In other embodiments, the encapsulation efficiency of the LNP and / or the LNP composition is about 80% to 99%, about 85% to 98%, about 88% to 95%, or about 90% to 95%, or the payload (e.g., a systemic nucleic acid) can be completely encapsulated within the lipid portion of the LNP composition, thereby preventing enzymatic degradation. In some embodiments, after exposing the LNP and / or the LNP composition to a nuclease at 37°C for at least about 20, 30, 45, or 60 minutes, or at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, or 36 hours, the payload (e.g., a therapeutic agent) is substantially undegraded. In some embodiments, the payload (e.g., a systemic nucleic acid) is compounded with the lipid portion of the LNP and / or the LNP composition. The LNP and / or LNP compositions disclosed herein are non-toxic to mammals such as humans.
[0333] The term "fully encapsulated" indicates that the payload (e.g., systemic nucleic acid) in the LNP and / or LNP composition does not significantly degrade after exposure to conditions that significantly degrade free DNA, RNA, or protein. In a fully encapsulated system, less than about 25%, more preferably less than about 10%, and most preferably less than about 5% of the payload (e.g., systemic nucleic acid) in the LNP and / or LNP composition is degraded by conditions that degrade 100% of the unencapsulated payload. "Fully encapsulated" also indicates that the LNP and / or LNP composition is serum stable and does not break down into its components upon administration in vivo.
[0334] In some embodiments, the amount of LNP and / or LNP composition encapsulated therein, including the payload (e.g., a therapeutic agent), is about 30% to about 100%, about 40% to about 100%, about 50% to about 100%, about 60% to about 100%, about 70% to about 100%, about 80% to about 100%, about 90% to about 100%, about 30% to about 95%, about 40% to about 95%, about 50% to about 95%, about 60% to about 95%, about 70% to about 95%, about 8 ... 5% to about 95%, about 90% to about 95%, about 30% to about 90%, about 40% to about 90%, about 50% to about 90%, about 60% to about 90%, about 70% to about 90%, about 80% to about 90%, or at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or any intermediate range of the foregoing.
[0335] In some embodiments, the amount of payload (e.g., nucleic acid) encapsulated within the LNP and / or LNP composition is about 30% to about 100%, about 40% to about 100%, about 50% to about 100%, about 60% to about 100%, about 70% to about 100%, about 80% to about 100%, about 90% to about 100%, about 30% to about 95%, about 40% to about 95%, about 50% to about 95%, about 60% to about 95%, about 70% to about 95%, about 80% to about 95%, or about 85%. The percentage is approximately 95%, approximately 90% to approximately 95%, approximately 30% to approximately 90%, approximately 40% to approximately 90%, approximately 50% to approximately 90%, approximately 60% to approximately 90%, approximately 70% to approximately 90%, approximately 80% to approximately 90%, or at least approximately 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or any intermediate range of the foregoing.
[0336] In some embodiments, the nucleic acids of this disclosure, such as mRNA and / or gRNA encoding repressor fusion proteins, may be provided in a solution mixed with a lipid solution, such that the nucleic acids can be encapsulated in lipid nanoparticles. Suitable nucleic acid solutions may be any aqueous solution containing various concentrations of the nucleic acids to be encapsulated. For example, suitable nucleic acid solutions may contain nucleic acids (or nucleic acids) at concentrations of about 0.01 mg / ml, 0.05 mg / ml, 0.06 mg / ml, 0.07 mg / ml, 0.08 mg / ml, 0.09 mg / ml, 0.1 mg / ml, 0.15 mg / ml, 0.2 mg / ml, 0.3 mg / ml, 0.4 mg / ml, 0.5 mg / ml, 0.6 mg / ml, 0.7 mg / ml, 0.8 mg / ml, 0.9 mg / ml, 1.0 mg / ml, 1.25 mg / ml, 1.5 mg / ml, 1.75 mg / ml, or 2.0 mg / ml. In some embodiments, the nucleic acid comprises mRNA encoding a repressor fusion protein, and a suitable mRNA solution may contain concentrations ranging from about 0.01-2.0 mg / ml, 0.01-1.5 mg / ml, 0.01-1.25 mg / ml, 0.01-1.0 mg / ml, 0.01-0.9 mg / ml, 0.01-0.8 mg / ml, 0.01-0.7 mg / ml, 0.01-0.6 mg / ml, 0.01-0.5 mg / ml, 0.01-0.4 mg / ml, 0.01-0.3 mg / ml, 0.01-0.2 mg / ml, 0.01-0.1 mg / ml, 0.05-1.0 mg / ml, 0.05-0.9 mg / ml, 0.05-0.8 mg / ml, 0.05-0.7 mg / ml, and 0.05-0.6 mg / ml. mg / ml, 0.05-0.5 mg / ml, 0.05-0.4 mg / ml, 0.05-0.3 mg / ml, 0.05-0.2 mg / ml, 0.05-0.1 mg / ml, 0.1-1.0 mg / ml, 0.2-0.9 mg / ml, 0.3-0.8 mg / ml, 0.4-0.7 mg / ml or 0.5-0.6 mg / ml of mRNA.In some embodiments, a suitable mRNA solution may contain mRNA at concentrations up to about 5.0 mg / ml, 4.0 mg / ml, 3.0 mg / ml, 2.0 mg / ml, 1.0 mg / ml, 0.9 mg / ml, 0.8 mg / ml, 0.7 mg / ml, 0.6 mg / ml, 0.5 mg / ml, 0.4 mg / ml, 0.3 mg / ml, 0.2 mg / ml, 0.1 mg / ml, 0.05 mg / ml, 0.04 mg / ml, 0.03 mg / ml, 0.02 mg / ml, 0.01 mg / ml, or 0.05 mg / ml. In some embodiments, a suitable gRNA solution may contain gRNA at concentrations up to about 5.0 mg / ml, 4.0 mg / ml, 3.0 mg / ml, 2.0 mg / ml, 1.0 mg / ml, 0.9 mg / ml, 0.8 mg / ml, 0.7 mg / ml, 0.6 mg / ml, 0.5 mg / ml, 0.4 mg / ml, 0.3 mg / ml, 0.2 mg / ml, 0.1 mg / ml, 0.05 mg / ml, 0.04 mg / ml, 0.03 mg / ml, 0.02 mg / ml, 0.01 mg / ml, or 0.05 mg / ml.
[0337] In some embodiments, the average diameter of the LNP can be 20 nm to 200 nm, 20 nm to 180 nm, 20 nm to 170 nm, 20 nm to 150 nm, 20 nm to 120 nm, 20 nm to 100 nm, 20 nm to 90 nm, 30 nm to 200 nm, 30 nm to 180 nm, 30 nm to 170 nm, 30 nm to 150 nm, 30 nm to 120 nm, 30 nm to 100 nm, 30 nm to 90 nm, 40 nm to 200 nm, 40 nm to 180 nm, 40 nm to 170 nm, 40 nm to 150 nm, 40 nm to 120 nm, 40 nm to 100 nm, 40 nm to 90 nm, 40 nm to 80 nm, 40 nm to 70 nm, 50 nm to 200 nm, 50 nm to 180 nm, 50 nm to 170 nm, 50 nm to 15 ...170 nm, 50 nm to 150 nm, 50 nm to 180 nm, 50 nm to 170 nm, 50 nm to 150 nm, 50 nm to 180 nm, 50 nm to 120 nm, 50 nm to 100 nm, 40 nm to 90 nm, 40 nm to 80 nm, 40 nm to 70 nm, 50 nm to 200 nm, 50 nm to 180 nm, nm to 120 nm, 50 nm to 100 nm, 50 nm to 90 nm, 60 nm to 200 nm, 60 to 180 nm, 60 nm to 170 nm, 60 nm to 150 nm, 60 nm to 120 nm, 60 nm to 100 nm, 60 nm to 90 nm, 70 nm to 200 nm, 70 to 180 nm, 70 nm to 170 nm, 70 nm to 150 nm, 70 nm to 120 nm, 70 nm to 100 nm, 70 nm to 90 nm, 80 nm to 200 nm, 80 nm to 180 nm, 80 nm to 170 nm, 80 nm to 150 nm, 80 nm to 120 nm, 80 nm to 100 nm, 80 nm to 90 nm, 90 nm to 200 nm, 90 nm to 180 nm, 90 nm to 170 nm, 90 nm to 150 nm, 90 LNPs can be sized to 120 nm or 90 nm to 100 nm for easy delivery to liver tissue, hepatocytes, and / or LSECs (hepatic sinusoidal endothelial cells). LNPs can be sized for easy delivery to organs or tissues, including but not limited to the liver, lungs, heart, spleen, and tumors. When the size of LNPs is smaller than the above ranges, stability may be difficult to maintain due to the excessive increase in surface area, and therefore delivery to the target tissue and / or drug efficacy may be reduced. LNPs can specifically target liver tissue. Not wishing to be bound by theory, one mechanism by which LNPs are thought to be used for therapeutic delivery is by mimicking the metabolic behavior of natural lipoproteins, and therefore LNPs can be efficiently delivered to the subject through lipid metabolism processes occurring in the liver.During the delivery of therapeutic agents to hepatocytes and / or LSECs (hepatic sinusoidal endothelial cells), the diameter of the fenestrations opening from the sinusoidal lumen to the hepatocytes and LSECs is about 140 nm in mammals and about 100 nm in humans. Therefore, LNP compositions for therapeutic agent delivery having LNPs with diameters within the above range can have superior delivery efficiency to hepatocytes and LSECs when compared to LNPs with diameters outside the above range.
[0338] According to one example, the LNP in the LNP composition may comprise a cationic lipid:phospholipid:cholesterol:lipid-PEG conjugate in the ranges described above or in molar ratios of 20 to 50:10 to 30:30 to 60:0.5 to 5, 25 to 45:10 to 25:40 to 50:0.5 to 3, 25 to 45:10 to 20:40 to 55:0.5 to 3, or 25 to 45:10 to 20:40 to 55:1.0 to 1.5. LNPs containing components in molar ratios within the above ranges may exhibit excellent delivery efficiency as therapeutic agents specific to the cells of target organs.
[0339] In some respects, LNPs exhibit a positive charge under acidic pH conditions by displaying a pKa of 5 to 8, 5.5 to 7.5, 6 to 7, or 6.5 to 7, and can readily encapsulate nucleic acids with high efficiency by forming complexes with therapeutic agents such as negatively charged nucleic acids through electrostatic interactions. In such cases, LNPs can be effectively used as compositions for intracellular or in vivo delivery of therapeutic agents (e.g., nucleic acids).
[0340] In this article, "encapsulation" or "encapsulation" refers to the incorporation of an effectively delivered therapeutic agent, i.e., by surrounding it with the particle surface and / or embedding it within the particle. Encapsulation efficiency refers to the amount of therapeutic agent encapsulated in the LNP relative to the total amount of therapeutic agent used to prepare the LNP.
[0341] The encapsulation of nucleic acids in the LNP of the composition may be 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 94% or more, or 95% or more of the LNP encapsulated nucleic acids in the composition. In some embodiments, the encapsulation of nucleic acids in the LNP of the composition results in 80% to 99%, 80% to 97%, 80% to 95%, 85% to 95%, 87% to 95%, 90% to 95%, 91% or more to 95% or less, 91% or more to 94% or less, more than 91% to 95% or less, 92% to 99%, 92% to 97%, or 92% to 95% of the LNP encapsulated nucleic acids. In some embodiments, the mRNA and / or gRNA encoding LTRP of any embodiment of this disclosure are completely encapsulated in the LNP.
[0342] The target organs to which nucleic acids are to be delivered by the LNP include, but are not limited to, the liver, lungs, heart, spleen, and tumors. According to one example, the LNP is liver tissue-specific and exhibits excellent biocompatibility, and can efficiently deliver nucleic acids of the composition, and therefore can be used in related technical fields such as lipid nanoparticle-mediated gene therapy. In a specific embodiment, the target cells to which nucleic acids are to be delivered by the LNP according to one example may be hepatocytes and / or in vivo LSECs. In other embodiments, this disclosure provides LNPs formulated for delivering nucleic acids of the embodiments to ex vivo cells.
[0343] This disclosure provides a pharmaceutical composition comprising a plurality of LNPs and a pharmaceutically acceptable carrier, diluent, or excipient, wherein the LNPs comprise nucleic acids, such as mRNA and / or gRNA variants encoding long-term repressor fusion proteins as described herein.
[0344] In some embodiments, the LNP containing nucleic acid has an electronically dense core.
[0345] This disclosure provides LNPs comprising one or more nucleic acids, said nucleic acids comprising: (a) mRNA and / or gRNA variants encoding repressor fusion proteins as described herein; (b) one or more cationic lipids or ionizable cationic lipids or salts thereof, said one or more cationic lipids or ionizable cationic lipids or salts thereof comprising about 50 mol% to about 85 mol% of the total lipids present in the LNP; (c) one or more non-cationic lipids, said one or more non-cationic lipids comprising about 13 mol% to about 49.5 mol% of the total lipids present in the LNP; and (d) one or more conjugated lipids that inhibit the aggregation of LNPs comprising about 0.5 mol% to about 2 mol% of the total lipids present in the particles. In another embodiment, this disclosure provides an LNP comprising one or more nucleic acids, said nucleic acids comprising: (a) mRNA and / or gRNA variants encoding the repressor fusion protein described herein; (b) one or more cationic lipids or ionizable cationic lipids or salts thereof, said one or more cationic lipids or ionizable cationic lipids or salts thereof comprising about 22 mol% to about 85 mol% of the total lipids present in the LNP; (c) one or more non-cationic / phospholipids, said one or more non-cationic / phospholipids comprising about 10 mol% to about 70 mol% of the total lipids present in the LNP; (d) 15 mol% to about 50 mol% of sterols; and (d) 1 mol% to about 5 mol% of lipid-PEG or lipid-PEG-peptide in the particles. In some embodiments, the long-term repressor fusion protein mRNA and gRNA may be present in the same LNP, or they may be present in different LNPs.
[0346] This disclosure provides an LNP comprising one or more nucleic acids, said nucleic acids comprising: (a) mRNA encoding a long-term repressor fusion protein as described herein; (b) a cationic lipid or a salt thereof, said cationic lipid or salt thereof comprising about 52 mol% to about 62 mol% of the total lipids present in the LNP; (c) a mixture of phospholipids and cholesterol or derivatives thereof, said mixture comprising about 36 mol% to about 47 mol% of the total lipids present in the LNP; and (d) a PEG-lipid conjugate comprising about 1 mol% to about 2 mol% of the total lipids present in the LNP. In a particular embodiment, the formulation is a four-component system comprising about 1.4 mol% of a PEG-lipid conjugate (e.g., PEG2000-C-DMA), about 57.1 mol% of a cationic lipid (e.g., DLin-K-C2-DMA) or a salt thereof, about 7.1 mol% of DPPC (or DSPC) and about 34.3 mol% of cholesterol (or a derivative thereof). In some embodiments, the LNP comprises mRNA and gRNA encoding CasX as described herein.
[0347] In other embodiments, the LNP comprising one or more nucleic acids comprises: (a) mRNA and / or gRNA encoding a long-term repressor fusion protein of any of the embodiments described herein; (b) a cationic lipid or a salt thereof, said cationic lipid or salt thereof comprising about 46.5 mol% to about 66.5 mol% of the total lipids present in the LNP; (c) cholesterol or a derivative thereof, said cholesterol or a derivative thereof comprising about 31.5 mol% to about 42.5 mol% of the total lipids present in the LNP; and (d) a PEG-lipid conjugate comprising about 1 mol% to about 2 mol% of the total lipids present in the LNP. In a particular embodiment, the formulation is a phospholipid-free three-component system and comprises about 1.5 mol% of a PEG-lipid conjugate (e.g., PEG2000-C-DMA), about 61.5 mol% of a cationic lipid (e.g., DLin-K-C2-DMA) or a salt thereof, and about 36.9 mol% of cholesterol (or a derivative thereof). In some embodiments, the LNP comprises mRNA and gRNA encoding CasX as described herein.
[0348] Other formulations are described in PCT Publication WO 09 / 127060 and U.S. Patent Publications US 2011 / 0071208 A1 and US 2011 / 0076335 A1, the disclosures of which are incorporated herein by reference in their entirety.
[0349] In other embodiments, the LNP comprising one or more nucleic acids comprises: (a) mRNA and gRNA encoding a long-term repressor fusion protein of any of the embodiments described herein; (b) one or more cationic lipids or ionizable cationic lipids or salts thereof, said one or more cationic lipids or ionizable cationic lipids or salts thereof comprising about 2 mol% to about 50 mol% of the total lipids present in the LNP; (c) one or more non-cationic lipids or ionizable cationic lipids, said one or more non-cationic lipids or ionizable cationic lipids comprising about 5 mol% to about 90 mol% of the total lipids present in the LNP; and (d) one or more conjugated lipids that inhibit the aggregation of particles comprising about 0.5 mol% to about 20 mol% of the total lipids present in the LNP. In some embodiments, the LNP comprises mRNA and gRNA encoding CasX as described herein.
[0350] In other embodiments, the LNP comprising one or more nucleic acids comprises: (a) mRNA and gRNA encoding a long-term repressor fusion protein of any of the embodiments described herein; (b) a cationic lipid or a salt thereof, said cationic lipid or salt thereof comprising about 30 mol% to about 50 mol% of the total lipids present in the LNP; (c) a mixture of phospholipids and cholesterol or derivatives thereof, said mixture comprising about 47 mol% to about 69 mol% of the total lipids present in the LNP; and (d) a PEG-lipid conjugate comprising about 1 mol% to about 3 mol% of the total lipids present in the LNP. In a particular embodiment, the formulation is a four-component system comprising about 2 mol% of a PEG-lipid conjugate (e.g., PEG2000-C-DMA), about 40 mol% of a cationic lipid (e.g., DLin-K-C2-DMA) or a salt thereof, about 10 mol% of DPPC (or DSPC) and about 48 mol% of cholesterol (or a derivative thereof). In some embodiments, the LNP comprises mRNA and gRNA encoding CasX as described herein.
[0351] In other embodiments, the LNP comprising one or more nucleic acids comprises: (a) mRNA and gRNA encoding a long-term repressor fusion protein of any of the embodiments described herein; (b) one or more cationic lipids or ionizable cationic lipids or salts thereof, said one or more cationic lipids or ionizable cationic lipids or salts thereof comprising about 50 mol% to about 65 mol% of the total lipids present in the LNP; (c) one or more non-cationic lipids or ionizable cationic lipids, said one or more non-cationic lipids or ionizable cationic lipids comprising about 25 mol% to about 45 mol% of the total lipids present in the LNP; and (d) one or more conjugated lipids that inhibit the aggregation of particles comprising about 5 mol% to about 10 mol% of the total lipids present in the LNP. In some embodiments, the LNP comprises mRNA and gRNA encoding CasX as described herein.
[0352] In other embodiments, the LNP comprising one or more nucleic acids comprises: (a) mRNA and gRNA encoding a long-term repressor fusion protein of any of the embodiments described herein; (b) a cationic lipid or a salt thereof, said cationic lipid or salt thereof comprising about 50 mol% to about 60 mol% of the total lipids present in the LNP; (c) a mixture of phospholipids and cholesterol or derivatives thereof, said mixture comprising about 35 mol% to about 45 mol% of the total lipids present in the LNP; and (d) a PEG-lipid conjugate comprising about 5 mol% to about 10 mol% of the total lipids present in the LNP.
[0353] In some embodiments, the non-cationic lipid mixture in the formulation comprises: (i) about 10 mol% to about 70 mol% of the total lipids present in the LNP, phospholipids; (ii) about 15 mol% to about 50 mol% of the total lipids present in the LNP, cholesterol or a derivative thereof; and 1-5% lipid-PEG or lipid-PEG-peptide. In a specific embodiment, the formulation is a four-component system comprising about 7 mol% of a PEG-lipid conjugate (e.g., PEG750-C-DMA), about 54 mol% of a cationic lipid (e.g., DLin-K-C2-DMA) or a salt thereof, about 7 mol% of DPPC (or DSPC), and about 32 mol% of cholesterol (or a derivative thereof).
[0354] In other embodiments, the LNP comprising one or more nucleic acids comprises: (a) mRNA and / or gRNA encoding a long-term repressor fusion protein of any of the embodiments described herein; (b) a cationic lipid or a salt thereof, said cationic lipid or salt thereof comprising about 55 mol% to about 65 mol% of the total lipids present in the LNP; (c) cholesterol or a derivative thereof, said cholesterol or a derivative thereof comprising about 30 mol% to about 40 mol% of the total lipids present in the LNP; and (d) a PEG-lipid conjugate comprising about 5 mol% to about 10 mol% of the total lipids present in the LNP. In a particular embodiment, the formulation is a phospholipid-free three-component system and comprises about 7 mol% of a PEG-lipid conjugate (e.g., PEG750-C-DMA), about 58 mol% of a cationic lipid (e.g., DLin-K-C2-DMA) or a salt thereof, and about 35 mol% of cholesterol (or a derivative thereof). In some embodiments, the LNP comprises mRNA and gRNA encoding CasX as described herein.
[0355] In other embodiments, the LNP comprising one or more nucleic acids comprises: (a) mRNA and / or gRNA encoding a long-term repressor fusion protein of any of the embodiments described herein; (b) a cationic lipid or a salt thereof, said cationic lipid or salt thereof comprising about 48 mol% to about 62 mol% of the total lipids present in the LNP; (c) a mixture of phospholipids and cholesterol or derivatives thereof, wherein said phospholipids comprise about 7 mol% to about 17 mol% of the total lipids present in the LNP, and wherein said cholesterol or derivatives thereof comprise about 25 mol% to about 40 mol% of the total lipids present in the LNP; and (d) a PEG-lipid conjugate comprising about 0.5 mol% to about 3.0 mol% of the total lipids present in the LNP. In some embodiments, the LNP comprises mRNA and gRNA encoding CasX as described herein.
[0356] IX. Methods for repressing target nucleic acids
[0357] On the other hand, this disclosure relates to a method of transcribing a target nucleic acid sequence of a gene in vitro, in vitro, or in vivo in a subject's cell population using the LTRP:gRNA system of this disclosure. The programmable nature of the systems provided herein allows for precise targeting to achieve the desired effect at one or more predetermined regions of interest in the target nucleic acid sequence of the gene. In some embodiments, it may be desirable to repress or silence a gene in the cells that contains a mutation causing a disease or condition in the subject.
[0358] In some embodiments, the method comprises introducing into a cell a long-term repressor fusion protein of the present disclosure and one or more gRNAs having a targeting sequence complementary to a target nucleic acid, wherein the long-term repressor fusion protein is capable of complexing with the gRNA to form an RNP, and wherein the RNP is capable of binding to the target nucleic acid and repressing or silencing gene transcription in the cell (it should be understood that additional cytokines may be recruited and participate in repression). In some embodiments, the method comprises introducing into a cell an mRNA encoding a long-term repressor fusion protein of the present disclosure and one or more gRNAs having a targeting sequence complementary to a target nucleic acid, thereby expressing the long-term repressor fusion protein and enabling it to complex with the gRNA to form an RNP, wherein the RNP is capable of binding to the target nucleic acid and repressing or silencing gene transcription in the cell. In some embodiments, the mRNA and gRNA encoding the long-term repressor fusion protein may be co-regulated in nanoparticles for delivery to cells in a population. In some embodiments, the mRNA and gRNA encoding the long-term repressor fusion protein may be regulated in separate nanoparticles for delivery to cells in a population. In some embodiments, the nanoparticles are lipid nanoparticles (LNPs), as described herein.
[0359] In some embodiments of gene transcription repression methods, the LTRP:gRNA system of this disclosure can be programmed to target any region of a gene or its vicinity, or to target a region of a gene for which transcriptional repression is sought. When the entire gene is to be repressed, this disclosure envisions the use of a guide having a targeting sequence complementary to a sequence covering or near the transcription start site (TSS). The core promoter acts as a binding platform for transcriptional mechanisms, containing Pol II and its associated universal transcription factor (GTF) (Haberle, V. et al., Eukaryotic corepromoters and the functional basis of transcription initiation (Nature Review of Molecular Cell Biology 19(10):621 (2018)). Variability in TSS selection has been proposed to involve DNA 'splitting' and 'anti-splitting', marked by: (i) forward and reverse movement of the RNA polymerase front relative to the DNA, but not the movement of the trailing edge, and (ii) expansion and contraction of the transcription vesicle. In some embodiments, the target sequence of the gRNA in the LTRP:gRNA system is complementary to the target nucleic acid sequence located within 1 kb of the transcription start site (TSS) in the gene being targeted to repress. In some embodiments of the method, the target sequence of the gRNA in the LTRP:gRNA system is 20 bp, 50 bp, 100 bp, 150 bp upstream of the TSS of the gene being targeted to repress. The target nucleic acid sequences are complementary to the target nucleic acid sequences within 20 bp, 50 bp, 100 bp, 150 bp, 200 bp, 250 bp, 500 bp, 1 kb, or 1.5 kb downstream of the TSS of the gene being targeted to repress. In some embodiments of the method, the target sequence of the gRNA in the LTRP:gRNA system is complementary to the target nucleic acid sequences within 700 bp upstream to 700 bp downstream, 500 bp upstream to 500 bp downstream, 300 bp upstream to 300 bp downstream, or 100 bp upstream to 100 bp downstream of the TSS of the gene. In some embodiments of the method, the target sequence of the gRNA in the LTRP:gRNA system is complementary to the target nucleic acid sequences within 20 bp, 50 bp, 100 bp, 200 bp, 250 bp, 500 bp, 1 kb, or 1.5 kb downstream of the enhancer of the gene being targeted to repress. The target nucleic acid sequence is complementary to the target nucleic acid sequence within 1 bp, 150 bp, 200 bp, 250 bp, 500 bp or 1 kb.In some embodiments of the method, the targeting sequence of the gRNA in the LTRP:gRNA system is complementary to the target nucleic acid sequence located within the 1 kb 3' to 5' untranslated region of the gene being targeted and repressed. In some embodiments of the method, the targeting sequence of the gRNA in the LTRP:gRNA system is complementary to the target nucleic acid sequence located within the open reading frame of the gene being targeted and repressed. In some embodiments of the method, the targeting sequence of the gRNA in the LTRP:gRNA system is complementary to the target nucleic acid sequence of the exon of the gene being targeted and repressed. In a particular embodiment, the targeting sequence of the gRNA in the system of this disclosure is complementary to the target nucleic acid sequence of exon 1 of the gene being targeted and repressed. In other embodiments of the method, the targeting sequence of the gRNA in the system of this disclosure is complementary to the target nucleic acid sequence of the intron of the gene being targeted and repressed. In other embodiments of the method, the targeting sequence of the gRNA in the system of this disclosure is complementary to the target nucleic acid sequence of the intron-exon junction of the gene being targeted and repressed. In other embodiments of the method, the targeting sequence of the gRNA of the disclosed system is complementary to the target nucleic acid sequence of the regulatory element of the gene being targeted to repress. In other embodiments of the method, the targeting sequence of the gRNA of the disclosed system is complementary to the sequence of the intergenic region of the gene being targeted to repress. In other embodiments of the method, the targeting sequence of the gRNA of the disclosed system is complementary to the junction of the exon, intron, or regulatory element of the gene being targeted to repress. In those cases where the targeting sequence is complementary to the regulatory element, such regulatory elements include, but are not limited to, promoter regions, enhancer regions, intergenic regions, 5' untranslated regions (5' UTR), 3' untranslated regions (3' UTR), conserved elements, and regions containing cis-regulatory elements. In some embodiments of the method, the targeting sequence of the gRNA of the system is complementary to the target nucleic acid sequence within 1 kb of the enhancer of the gene being targeted to repress. In some embodiments of the method, the targeting sequence of the gRNA of the disclosed system is complementary to the target nucleic acid sequence within the 3' untranslated region of the gene being targeted to repress. The promoter region is intended to encompass nucleotides within 5 kb of the start of the coding sequence, or, in the case of gene enhancer elements or conserved elements, can be thousands, hundreds of thousands, or even millions of bp away from the coding sequence of the gene targeted to be repressed. In the foregoing, a target is a target whose coding gene is intended to be repressed and / or epigenetically modified so that the gene product is not expressed or is expressed at a low level in the cell. In some embodiments, when the RNP of the system of this disclosure binds to the binding site of the target nucleic acid, the system is capable of repressing transcription of the gene at the 5' of the RNP binding site. In other embodiments, when the RNP of the system binds to the binding site of the target nucleic acid, the system is capable of repressing transcription of the gene at the 3' of the RNP binding site.
[0360] This disclosure provides a method for transcriptionally repressing or silencing target genes in a cell population. In some embodiments, the method includes contacting a cell population with an LTRP:gRNA system comprising mRNA and gRNA, the mRNA comprising a sequence selected from the group consisting of SEQ ID NO: 2409-18636 or having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity therewith, the gRNA comprising a scaffold comprising a sequence selected from the group consisting of SEQ ID NO: 1744-1746, 2136-2144, 2146-2154, and 2156-2164 or having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity therewith, and wherein the gRNA comprises a linked target sequence complementary to the target nucleic acid of the gene to be repressed. In some embodiments, the LTRP:gRNA system comprises a gRNA variant containing the sequence of SEQ ID NO: 1744. In some embodiments, the LTRP:gRNA system comprises a gRNA variant containing the sequence of SEQ ID NO: 1745. In some embodiments, the LTRP:gRNA system comprises a gRNA variant containing the sequence of SEQ ID NO: 1746. In some embodiments, the LTRP:gRNA system comprises a gRNA variant containing one or more chemical modifications, including gRNA variants containing sequences of SEQ ID NO: 2136-2144, 2146-2154, or 2156-2164, wherein a targeting sequence complementary to the target nucleic acid replaces 20 nucleotides at the 3' end of the listed gRNA sequence. In a particular embodiment, the LTRP:gRNA system comprises an mRNA encoding LTRP, the mRNA comprising a sequence selected from the group consisting of SEQ ID NO: 2411, 2421, 2467 and 2477, and the gRNA comprising the sequence of SEQ ID NO: 2156 and a linked targeting sequence complementary to a sequence of a gene targeted to repress or silence 20 nucleotides replacing the 3' end of SEQ ID NO: 2156.
[0361] In some embodiments, a method for transcriptional repression or silencing of a target nucleic acid comprises contacting a cell population with an LNP comprising an LTRP:gRNA system, the system comprising mRNA and gRNA, the mRNA comprising a sequence selected from the group consisting of sequences of SEQ ID NO: 2409-18636 or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with it, the gRNA comprising a scaffold, the scaffold comprising sequences selected from SEQ ID NO: The gRNA comprises a sequence of the group consisting of 1744-1746, or alternatively, a sequence selected from the group consisting of 2136-2144, 2146-2154, and 2156-2164, or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with it, wherein a targeting sequence complementary to the target nucleic acid replaces 20 nucleotides at the 3' end of the gRNA of the listed sequence, and the gRNA comprises a targeting sequence complementary to the target nucleic acid of the gene to be repressed. In some embodiments of the method, the LNP comprising the LTRP:gRNA system comprises a gRNA variant comprising a scaffold containing the sequence of SEQ ID NO: 1744. In some embodiments of the method, the LNP comprising the LTRP:gRNA system comprises a gRNA variant comprising a scaffold containing the sequence of SEQ ID NO: 1745. In some embodiments of the method, the LNP comprising the LTRP:gRNA system comprises a gRNA variant comprising a scaffold containing the sequence of SEQ ID NO: 1746. In some embodiments of the method, the LNP comprising the LTRP:gRNA system comprises a chemically modified gRNA variant comprising the sequences of SEQ ID NO: 2136-2144, 2146-2154, and 2156-2164, wherein a targeting sequence complementary to the target nucleic acid replaces 20 nucleotides at the 3' end of the listed gRNA. In a particular embodiment of the method, the LNP comprising the LTRP:gRNA system comprises an mRNA and gRNA encoding LTRP, the mRNA comprising a sequence selected from the group consisting of SEQ ID NO: 2411, 2421, 2467, and 2477, and the gRNA comprising the scaffold portion of SEQ ID NO: 2156, wherein a linked targeting sequence complementary to the sequence of the gene targeted for repression or silencing replaces 20 nucleotides at the 3' end of SEQ ID NO: 2156.
[0362] In some embodiments of the method, contacting cells with the LTRP:gRNA system of this disclosure results in transcriptional repression of the target gene in at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or more cells in a population targeted by the LTRP:gRNA system. In some embodiments of the method, the gene in the cells targeted by the LTRP:gRNA system is repressed or silenced, such that the expression of the protein encoded by the gene is reduced by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% compared to cells where the gene is not targeted. In some embodiments, transcriptional repression of genes in cells lasts for at least about 8 hours, at least about 1 day, at least about 7 days, at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, or at least about 6 months or longer. In some embodiments, transcriptional repression in cells treated with the LTRP:gRNA system of the embodiment is heritable and stable in one or more cell divisions. In some embodiments, transcriptional repression is stable in 1, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 cell divisions or more. In some embodiments, repression is determined in an in vitro assay. In some embodiments, repression in a subject is determined by assay of cells taken from the subject or by assay of proteins or biomarkers in samples obtained from the subject.
[0363] The systems and methods described herein can be used in a variety of disease-related cells, such as cells of the liver, intestine, lung, heart, bone, kidney, eye, central nervous system, smooth muscle cells, macrophages, or arterial wall cells, in which gene products contributing to the disease or symptom are repressed or silenced. In some embodiments, the cells targeted for transcriptional repression are eukaryotic cells. In some embodiments, the eukaryotic cells are selected from the group consisting of rodent cells, mouse cells, rat cells, primate cells, and non-human primate cells. In some embodiments, the eukaryotic cells are human cells. In some embodiments of the method, the cells are embryonic stem cells, induced pluripotent stem cells, germ cells, fibroblasts, oligodendrocytes, glial cells, hematopoietic stem cells, neuronal progenitor cells, neurons, astrocytes, myocytes, osteocytes, hepatocytes, pancreatic cells, lung cells, kidney cells, retinal cells, cancer cells, T cells, B cells, NK cells, fetal cardiomyocytes, myofibroblasts, mesenchymal stem cells, autologous expanded cardiomyocytes, adipocytes, totipotent cells, pluripotent cells, hematopoietic stem cells, myoblasts, bone marrow cells, mesenchymal cells, parenchymal cells, epithelial cells, endothelial cells, mesothelial cells, fibroblasts, osteoblasts, chondrocytes, bone marrow-derived progenitor cells, cardiomyocytes, bone cells, fetal cells, undifferentiated cells, pluripotent progenitor cells, unipotent progenitor cells, monocytes, cardiac myoblasts, skeletal myoblasts, macrophages, capillary endothelial cells, xenogeneic cells, allogeneic cells, and postnatal stem cells.
[0364] This disclosure provides a method for reversing transcriptional repression caused by the LTRP:gRNA system. In some embodiments, transcriptional repression is reversible by using a DNMT inhibitor. In some embodiments of the method, transcriptional repression is reversible by treating cells with a cytidine analogue inhibitor of DNMT. In some embodiments, the transcriptional repression can be reversed by treating cells with an inhibitor selected from the group consisting of: azoxycine, decitabine, clofarabine, and zablaline. In some embodiments of the method, the reversal of transcriptional repression is performed in a subject systemically treated with this disclosure, the method comprising administering a therapeutically effective dose of a DNMT inhibitor.
[0365] X. Treatment methods
[0366] This disclosure provides a method for treating a disease or condition in a subject using the LTRP:gRNA system of this disclosure. In some embodiments, the method of this disclosure can prevent, treat, and / or improve a subject's disease or condition by administering a therapeutically effective dose of the composition of this disclosure to the subject. Therefore, this method can be used in subjects suffering from diseases or conditions such as, but not limited to, autosomal dominant hypercholesterolemia (ADH), hypercholesterolemia, elevated total cholesterol levels, hyperlipidemia, elevated low-density lipoprotein (LDL) levels, elevated LDL-cholesterol levels, decreased high-density lipoprotein (HDL) levels, hepatic steatosis, coronary artery disease, ischemia, stroke, peripheral vascular disease, thrombosis, type 2 diabetes, hypertension, atherosclerosis, obesity, Alzheimer's disease, neurodegeneration, or age-related macular degeneration (AMD).
[0367] In some cases, one or both alleles of a subject's gene containing a disease or condition may contain a mutation. In some cases, the mutation is a gain-of-function mutation. In others, the disease mutation is a loss-of-f...
Claims
1. A system for transcriptional repression of a gene, the system comprising: (a) mRNA encoding the long-term repressor fusion protein (LTRP), The LTRP, from its N-terminus to its C-terminus, comprises: a DNA methyltransferase (DNMT) 3A catalytic domain (DNMT3A); a DNMT3-like interaction domain (DNMT3L); a DNA-binding protein comprising catalytically dead CasX (dCasX); and a first repressor domain (RD1); and (b) Guide RNA (gRNA) containing a target sequence complementary to the target nucleic acid sequence of a gene in the cell.
2. The system of claim 1, wherein the LTRP includes a DNMT3A ATRX-DNMT3-DNMT3L structural domain (ADD), the ADD being connected to the N-terminus of the DNMT3A.
3. The system according to claim 1 or claim 2, wherein the mRNA comprises a sequence encoding the dCasX selected from the group consisting of SEQ ID NO: 1948, 2405 and 2406, or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity with it.
4. The system of claim 3, wherein the mRNA comprises a sequence encoding the dCasX comprising SEQ ID NO: 2406 or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with it.
5. The system according to any one of claims 1 to 3, wherein the mRNA comprises a sequence encoding the DNMT3A comprising SEQ ID NO: 1955 or SEQ ID NO: 21878, or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with it.
6. The system according to any one of claims 1 to 4, wherein the mRNA comprises a sequence encoding the DNMT3L comprising SEQ ID NO: 1945 or SEQ ID NO: 21879, or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with it.
7. The system according to any one of claims 1 to 6, wherein the mRNA comprises a sequence encoding the RD1 selected from the group consisting of SEQ ID NO:18637-21830 or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with it.
8. The system of claim 7, wherein the mRNA comprises a sequence encoding the RD1 selected from the group consisting of SEQ ID NO: 18637-18646 and 20234-20243, or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with it.
9. The system of claim 7 or claim 8, wherein the mRNA comprises a sequence encoding the RD1 selected from the group consisting of SEQ ID NO: 18642 and 20239, or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with it.
10. The system of claim 7 or claim 8, wherein the mRNA comprises a sequence encoding the RD1 selected from the group consisting of SEQ ID NO: 18637 and 20234, or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with it.
11. The system of claim 7 or claim 8, wherein the mRNA comprises a sequence encoding the RD1 selected from the group consisting of SEQ ID NO: 18638 and 20235, or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with it.
12. The system according to any one of claims 1 to 11, wherein the mRNA comprises one or more sequences encoding nuclear localization sequences (NLS).
13. The system of claim 12, wherein the mRNA comprises a sequence encoding the one or more NLS comprising SEQ ID NO: 21875.
14. The system according to any one of claims 1 to 13, wherein the mRNA comprises one or more sequences encoding a linker peptide.
15. The system according to any one of claims 1 to 14, wherein the mRNA comprises a sequence encoding the LTRP selected from the group consisting of SEQ ID NO: 2410-2428 and 2466-2484, or a sequence having at least about 70%, at least about 80%, at least about 90%, or at least about 95%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% sequence identity with it.
16. The system of claim 15, wherein the mRNA comprises a sequence encoding the LTRP selected from the group consisting of SEQ ID NO: 2411, 2421, 2467 and 2477, or a sequence having at least about 70%, at least about 80%, at least about 90%, or at least about 95%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98% or at least about 99% sequence identity with it.
17. The system of claim 15, wherein the mRNA comprises a sequence encoding the LTRP selected from the group consisting of SEQ ID NO: 2410, 2420, 2466 and 2476, or a sequence having at least about 70%, at least about 80%, at least about 90%, or at least about 95%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98% or at least about 99% sequence identity with it.
18. The system of claim 15, wherein the mRNA comprises a sequence encoding the LTRP selected from the group consisting of SEQ ID NO: 2412, 2422, 2468 and 2478, or a sequence having at least about 70%, at least about 80%, at least about 90%, or at least about 95%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98% or at least about 99% sequence identity with it.
19. The system according to any one of claims 15 to 18, wherein: (a) The dCasX comprises the amino acid sequence of SEQ ID NO: 4-29 or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 99% sequence identity with it; (b) The RD1 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 130-224 or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 99% sequence identity with it; (c) The DNMT3A comprises the amino acid sequence of SEQ ID NO: 126 or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 99% sequence identity with it; and / or (d) The DNMT3L contains the amino acid sequence of SEQ ID NO: 127 or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 99% sequence identity with it.
20. The system according to any one of claims 15 to 18, wherein: (a) The dCasX contains the amino acid sequence of SEQ ID NO: 4-29; (b) The RD1 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 130-224, optionally wherein the RD1 comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 130, 131 and 135; (c) The DNMT3A comprises the amino acid sequence of SEQ ID NO: 126, and / or (d) The DNMT3L contains the amino acid sequence of SEQ ID NO:
127.
21. The system according to any one of claims 15 to 20, wherein the mRNA sequence encoding the LTRP is codon-optimized.
22. The system according to any one of claims 1 to 21, wherein the target sequence of the gRNA is complementary to the target nucleic acid sequence within 1 kb of the transcription start site (TSS) in the gene.
23. The system of claim 22, wherein the gRNA comprises a scaffold comprising the sequence of SEQ ID NO:1746 or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with it.
24. The system of claim 23, wherein the gRNA is chemically modified.
25. The system of claim 24, wherein the chemical modification comprises adding a 2'O-methyl group to one or more nucleotides of the gRNA.
26. The system of claim 24 or claim 25, wherein one or more nucleotides located at one, two, three or four nucleotides from the 5' end, 3' end or both ends of the gRNA are modified by adding a 2'O-methyl group.
27. The system according to any one of claims 24 to 26, wherein the chemical modification of the gRNA comprises substitution of phosphate thioester bonds between two or more nucleotides of the gRNA.
28. The system of claim 27, wherein the chemical modification comprises substitution of a phosphate thioester bond between two or more nucleotides located at one, two, three or four nucleotides from the 5' end, 3' end or both ends of the gRNA.
29. The system according to any one of claims 24 to 28, wherein the gRNA comprises a sequence selected from SEQ ID NO:2156-2164 and comprises a targeting sequence complementary to a target nucleic acid that replaces 20 nucleotides at the 3' end of SEQ ID NO:2156-2164.
30. The system according to any one of claims 1 to 29, wherein the mRNA comprises a 5' UTR, a 3' UTR, a poly(A) sequence and / or a 5' cap.
31. A lipid nanoparticle (LNP) comprising the system according to any one of claims 1 to 30.
32. A pharmaceutical composition comprising the system according to any one of claims 1 to 30 or the LNP according to claim 31, and a pharmaceutically acceptable carrier, diluent, or excipient.
33. A method for inhibiting the transcription of a gene in a cell population, the method comprising contacting cells in the population with a system according to any one of claims 1 to 30, an LNP according to claim 31, or a pharmaceutical composition according to claim 32, wherein the contact inhibits the transcription of the gene in the cell population.
34. A composition for treating a disease in a subject in need, the composition comprising a therapeutically effective dose of the system according to any one of claims 1 to 30, the LNP according to claim 31, or the pharmaceutical composition according to claim 32, wherein transcription of a target gene in the subject is repressed by the LTRP, thereby treating the disease.
35. A composition for preparing a medicament for treating a disease in a subject in need, said composition comprising a therapeutically effective dose of the system according to any one of claims 1 to 30 or the LNP according to claim 31, wherein transcription of a target gene in the subject is repressed by said LTRP, thereby treating said disease.
36. A kit comprising the system according to any one of claims 1 to 30, the LNP according to claim 31 or the pharmaceutical composition according to claim 32, and instructions for use.