Cancer markers and methods of modulating proliferation of isolated hepatocarcinoma cells

By using HKDC1 and RBBP5 as cancer biomarkers to regulate the proliferation and diagnosis of liver cancer cells, the toxicity and wide target distribution of existing drugs targeting hexokinase are solved, achieving efficient diagnosis and treatment of liver cancer.

CN122146649APending Publication Date: 2026-06-05INST OF HEALTH & MEDICINE HEFEI COMPREHENSIVE NAT SCI CENT
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-12-02
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Existing drugs targeting hexokinase have important functions in both normal and tumor tissues, leading to toxicity issues. Furthermore, hexokinase has multiple isoenzymes and is widely distributed, making it unsuitable as a target and resulting in limited efficacy in cancer treatment.

Method used

Using HKDC1 and RBBP5 as cancer biomarkers, kits and drugs were developed to regulate the proliferation and diagnosis of liver cancer cells by modulating the expression or protein kinase activity of HKDC1 and the phosphorylation level of RBBP5.

Benefits of technology

It significantly improves the accuracy of liver cancer detection and treatment efficacy. By regulating the function of HKDC1 and RBBP5, it reduces drug toxicity and improves the specificity and safety of treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005165809350000141
    Figure BDA0005165809350000141
  • Figure BDA0005165809350000142
    Figure BDA0005165809350000142
  • Figure BDA0005165809350000143
    Figure BDA0005165809350000143
Patent Text Reader

Abstract

The present invention provides a method for regulating proliferation of isolated hepatocarcinoma cells. According to an embodiment of the present invention, at least one of HKDC1 expression or protein kinase activity or RBBP5 phosphorylation level is regulated in the hepatocarcinoma cells. According to the method of an embodiment of the present invention, the proliferation rate of the isolated hepatocarcinoma cells can be significantly regulated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of tumor cells, and more specifically, to cancer markers and methods for regulating the proliferation of isolated liver cancer cells. More specifically, this invention relates to methods for regulating RBBP5 phosphorylation, the use of reagents in the preparation of reagent kits, and the use of reagents in the preparation of pharmaceuticals. Background Technology

[0002] Hexokinase is the first rate-limiting enzyme in glucose metabolism, converting glucose to glucose-6-phosphate. Its crucial role in both normal and tumor tissues is irreplaceable. There are several isoenzymes of hexokinase, namely HK1, HK2, HK3, HK4 (GK), and HKDC1. Due to subtle differences in structure and function, the distribution of each member in human tissues varies. Given the important role of hexokinase in cancer progression, a few drugs have been developed to inhibit its glucose metabolism function and thus suppress tumor development and progression, such as 2-DG, LND (Lonidamine), 3-BP (3-Bromopyruvate), and Metformin. However, most of these drugs have failed in preclinical trials due to significant side effects or toxicity. For example, high doses of 2-DG have strong toxic side effects, and 3-BP may have other targets with high toxicity. Existing drug targeting of hexokinase has two main drawbacks: First, hexokinase functions crucially in both normal and tumor tissues, and targeting it would be toxic; second, hexokinase has multiple isoenzymes and is widely distributed in the human body, making it unsuitable as a target.

[0003] Therefore, the present invention aims to discover new functions of HKDC1 beyond hexokinase, and the relationship between new HKDC1 functions and cancer, laying the foundation for the subsequent development of drugs for cancer diagnosis and treatment that target new HKDC1 functions. Summary of the Invention

[0004] In a first aspect, the present invention provides a cancer biomarker. According to embodiments of the invention, the biomarker comprises at least one of HKDC1 and RBBP5; wherein HKDC1 has an amino acid sequence with at least 90% identity as shown in SEQ ID NO:1, and RBBP5 has an amino acid sequence with at least 90% identity as shown in SEQ ID NO:2. The biomarker according to embodiments of the present invention can improve the accuracy of liver cancer detection.

[0005] In a second aspect, the invention provides for the use of the reagent in the preparation of a kit. According to embodiments of the invention, the kit is used to indicate the occurrence of liver cancer, and the reagent is used to bind to or identify the biomarkers described in the first aspect of the invention.

[0006] In a third aspect, the present invention provides a method for regulating the proliferation of isolated hepatocellular carcinoma cells. According to embodiments of the invention, the method includes regulating at least one of the following: the expression of HKDC1 or the activity of a protein kinase, or the phosphorylation level of RBBP5, in the hepatocellular carcinoma cells. The method according to embodiments of the invention can significantly regulate the proliferation rate of isolated hepatocellular carcinoma cells.

[0007] In a fourth aspect, the present invention provides a method for regulating RBBP5 phosphorylation. According to embodiments of the invention, the expression of HKDC1 or protein kinase activity is regulated in the hepatocellular carcinoma cells. The method according to embodiments of the invention is capable of regulating the phosphorylation level of RBBP5.

[0008] In a fifth aspect of the invention, the invention provides the use of a reagent in the preparation of a kit for regulating the proliferation of liver cancer cells, the reagent being used to regulate the markers described in the first aspect of the invention.

[0009] In a sixth aspect of the invention, the invention provides the use of reagents in the preparation of a kit for regulating the phosphorylation level of RBBP5, the reagents for regulating the expression of HKDC1 or protein kinase activity.

[0010] In a seventh aspect of the invention, the invention provides the use of a reagent in the preparation of a kit for regulating the proliferation of liver cancer cells, the reagent being used to regulate the phosphorylation level of RBBP5.

[0011] In an eighth aspect of the invention, the invention provides the use of a reagent in the preparation of a kit for regulating the proliferation of liver cancer cells, the reagent being used to regulate the phosphorylation level of the S497 site of RBBP5.

[0012] In a ninth aspect of the invention, the invention provides the use of the reagent in the preparation of a medicament for the prevention / treatment of the occurrence of liver cancer, wherein the reagent is used to inhibit the expression of HKDC1 or the activity of a protein kinase.

[0013] In a tenth aspect of the invention, the invention provides the use of the reagent in the preparation of a medicament for the prevention / treatment of liver cancer, wherein the reagent is used to inhibit the phosphorylation level of RBBP5.

[0014] In an eleventh aspect of the invention, the invention provides the use of the reagent in the preparation of a medicament for the prevention / treatment of the development of liver cancer, wherein the reagent is used to inhibit the phosphorylation level of the S497 site of RBBP5.

[0015] In a twelfth aspect, the present invention provides a method for diagnosing liver cancer. According to embodiments of the invention, the method includes: diagnosing whether liver cancer has occurred by detecting the expression level or activity of HKDC1 or the phosphorylation level of RBBP5 at the S497 site in a test sample; wherein a HKDC1 protein expression level in the test sample that is 1.5 times higher than the HKDC1 protein expression level in a normal sample diagnoses liver cancer, and a HKDC1 protein expression level in the test sample that is less than 1.5 times higher than the HKDC1 protein expression level in a normal sample indicates that liver cancer has not occurred; wherein a phosphorylation level of RBBP5 at the S497 site in the test sample that is 2 times higher than the phosphorylation level of RBBP5 at the S497 site in a normal sample diagnoses liver cancer, and a phosphorylation level of RBBP5 at the S497 site in the test sample that is less than 2 times higher than the phosphorylation level of RBBP5 at the S497 site in a normal sample indicates that liver cancer has not occurred. The method according to embodiments of the present invention can effectively improve the accuracy of liver cancer diagnosis.

[0016] Additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. Attached Figure Description

[0017] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the description of the embodiments taken in conjunction with the following drawings, in which:

[0018] Figure 1 Example 1 illustrates the role of immunoblotting in identifying the phosphorylation of RBBP5 by HKDC1 as a protein kinase. A shows the phosphorylation of RBBP5 by HKDC1 in vitro; B shows the phosphorylation level of RBBP5 in Hep3B cells after HKDC1 deficiency.

[0019] Figure 2 Example 1 illustrates the identification of the HKDC1 protein kinase site using Western blotting. A shows the phosphorylation of RBBP5 in vitro by a mutation at the HKDC1 protein kinase site (KD); B shows the phosphorylation levels of RBBP5 in Hep3B cells after overexpression of wild-type (WT) and KD mutant HKDC1.

[0020] Figure 3Example 2 illustrates the role of the HKDC1 protein kinase function in histone methylation modification as determined by immunoblotting. Example A shows histone methylation in Hep3B cells after knocking down HKDC1, or after overexpressing HKDC1 in wild-type (WT) and KD mutants; Example B shows histone methylation in Hep3B cells after knocking down HKDC1 in wild-type (WT) and phosphorylation-mimicking mutants (S497D) overexpressing RBBP5.

[0021] Figure 4 Example 3 illustrates the role of quantitative real-time PCR (qRT-PCR) in identifying gene expression by the HKDC1 protein kinase function in Hep3B cells. The mRNA levels of HKDC1 and RBBP5 target genes were measured in Hep3B cells after overexpression of wild-type (WT) and KD mutant HKDC1. Statistical analysis was performed using a T-test (n=3), where *** represents a statistically significant difference (P<0.001).

[0022] Figure 5 Example 4 illustrates the role of HKDC1 protein kinase function in Hep3B cells during cell proliferation assays. Figure A shows the cell proliferation of wild-type (WT) and KD mutant Hep3B cells overexpressing HKDC1; Figure B shows the cell proliferation of Hep3B cells overexpressing the phosphorylation site-inactivated mutant of RBBP5 (S497A) and the phosphorylation-mimicking mutant (S497D). EV in the figures represents the empty vector. Statistical analysis was performed using a T-test, n=3, where *** represents a significant difference (P<0.001).

[0023] Figure 6 Example 5 illustrates the expression of HKDC1, phosphorylated RBBP5, and total RBBP5 proteins in 12 clinical liver cancer samples. In the figure, N represents normal or adjacent normal tissue; T represents tumor tissue. Both the top and bottom figures show the results of Western blotting experiments.

[0024] Figure 7 Example 5 shows the results of immunohistochemical experiments on the expression of HKDC1, phosphorylated RBBP5, and total RBBP5 proteins in serial sections of three clinical liver cancer tissue samples. The brownish-yellow color indicates the expression level, and the darker the color, the higher the protein expression level. Detailed Implementation

[0025] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.

[0026] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of indicated technical features. Therefore, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. Furthermore, in the description of this invention, unless otherwise stated, "a plurality of" means two or more.

[0027] To facilitate understanding of this invention, certain technical and scientific terms are specifically defined below. Unless otherwise expressly defined elsewhere in this invention, all other technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which this invention pertains.

[0028] In this invention, the terms "comprising" or "including" are open-ended expressions, meaning they include the contents specified in this invention but do not exclude other aspects.

[0029] In this invention, the terms “optionally,” “optionally,” or “optionally” generally refer to events or conditions described subsequently that may but may not occur, and the description includes both cases in which the event or condition occurs and cases in which the event or condition does not occur.

[0030] In this invention, the terms “identity,” “homology,” or “similarity” are used to describe the percentage of identical amino acids or nucleotides between two amino acid sequences or nucleic acid sequences relative to a reference sequence, determined by conventional methods, for example, see Ausubel et al., eds. (1995), Current Protocols in Molecular Biology, Chapter 19 (Greene Publishing and Wiley-Interscience, New York); and the ALIGN procedure (Dayhoff (1978), Atlas of Protein Sequence and Structure 5: Suppl. 3 (National Biomedical Research Institute)). Foundation, Washington, DC). There are many algorithms for aligning sequences and determining sequence identity, including: Needleman et al. (1970) J. Mol. Biol. 48: 443, a homology alignment algorithm; Smith et al. (1981) Adv. Appl. Math. 2: 482, a local homology algorithm; Pearson et al. (1988) Proc. Natl. Acad. Sci. 85: 2444, a similarity search method; and the Smith-Waterman algorithm (Meth. Mol. Biol). .70:173-187 (1997); and the BLASTP, BLASTN, and BLASTX algorithms (see Altschul et al. (1990) J.Mol.Biol. 215:403-410). Computer programs utilizing these algorithms are also available, including but not limited to: ALIGN or Megalign (DNASTAR) software, or WU-BLAST-2 (Altschul et al., Meth.Enzym., 266:460-480 (1996)); or GAP, BESTFIT, BLAST Altschul et al., above, FASTA, and TFASTA, available in Genetics Computing Group (GCG) package, version 8, Madison, Wisconsin, USA; and CLUSTAL in the PC / Gene program provided by Intelligenetics, Mountain View, California.

[0031] In this invention, the term "at least 90% identity" means at least 90% identity with each reference sequence, which may be 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9%.

[0032] This invention proposes the use of cancer biomarkers and reagents in the preparation of reagent kits, methods for regulating the proliferation of isolated hepatocellular carcinoma cells, methods for regulating RBBP5 phosphorylation, the use of reagents in the preparation of drugs, and methods for diagnosing hepatocellular carcinoma, which will be described in detail below.

[0033] Cancer markers

[0034] In a first aspect, the present invention provides a cancer biomarker. According to embodiments of the invention, the biomarker comprises at least one of HKDC1 and RBBP5; wherein HKDC1 has an amino acid sequence with at least 90% identity as shown in SEQ ID NO:1, and RBBP5 has an amino acid sequence with at least 90% identity as shown in SEQ ID NO:2. The biomarker according to embodiments of the present invention can improve the accuracy of liver cancer detection.

[0035] According to an embodiment of the present invention, the cancer is liver cancer.

[0036] (SEQ ID NO:1).

[0037] (SEQ ID NO:2).

[0038] Use of reagents in the preparation of reagent kits

[0039] In a second aspect, the invention provides for the use of the reagent in the preparation of a kit. According to embodiments of the invention, the kit is used to indicate the occurrence of liver cancer, and the reagent is used to bind to or identify the biomarkers described in the first aspect of the invention.

[0040] According to embodiments of the present invention, the reagent is used to identify the expression level of HKDC1 or the phosphorylation level of RBBP5.

[0041] According to an embodiment of the present invention, the reagent is used to identify the phosphorylation level of the S497 site of RBBP5.

[0042] According to embodiments of the present invention, the reagent comprises an antibody, probe, or small-molecule chemiluminescent reagent that binds to the biomarker. It should be explained that an antibody is an immunoglobulin capable of specifically recognizing and binding to a specific antigen (such as a protein, polysaccharide, or small molecule). In biomarker detection, antibodies are commonly used to capture and detect specific molecules, for example in enzyme-linked immunosorbent assays (ELISA) or Western blots. A probe is a molecular tool used to detect and locate specific molecules; these can be DNA, RNA, or proteins. In biomarker detection, probes can be used to recognize and quantify specific nucleic acid sequences or proteins, for example in fluorescence in situ hybridization (FISH) or chemiluminescent in situ hybridization (EMSA). Small-molecule chemiluminescent reagents are commonly used to detect and quantify biomarkers; they generate a light signal through a chemical reaction, thereby allowing them to be detected. For example, L 012 sodium salt is a luminol-based chemiluminescent probe used to detect NADPH oxidase (Nox)-derived superoxide anion (O2·-) and recognize Nox inhibitors. Chemiluminescence kits, such as the chemiluminescence EMSA kit (GS009), use Streptavidin-HRP and subsequent BeyoECL Moon reagents to achieve chemiluminescence detection of biotin-labeled EMSA probes.

[0043] Methods to regulate the proliferation of isolated liver cancer cells

[0044] In a third aspect, the present invention provides a method for regulating the proliferation of isolated hepatocellular carcinoma cells. According to embodiments of the invention, the method includes regulating at least one of the following: the expression of HKDC1 or the activity of a protein kinase, or the phosphorylation level of RBBP5, in the hepatocellular carcinoma cells. The method according to embodiments of the invention can significantly regulate the proliferation rate of isolated hepatocellular carcinoma cells.

[0045] According to an embodiment of the present invention, the liver cancer cells include at least one of Hep3B and PLC.

[0046] According to embodiments of the present invention, a method for promoting the proliferation of isolated hepatocellular carcinoma cells includes increasing the expression of HKDC1 or the activity of protein kinase or increasing the phosphorylation level of RBBP5 in the hepatocellular carcinoma cells.

[0047] According to embodiments of the present invention, the enhancement of HKDC1 expression or protein kinase activity is achieved by at least one of the following methods:

[0048] Viral / non-viral vector-mediated gene / mRNA transfection technology, transposase or recombinase-mediated gene integration, and CRISPR / CAS-based gene editing or transcriptional activation.

[0049] According to embodiments of the present invention, the gene / mRNA transfection technology is achieved by utilizing at least one of the following methods: liposome or LNP-mediated transfection, calcium phosphate-mediated transfection, cationic transfection reagent-mediated transfection, virus-like particle (VLP)-mediated transfection, electroporation transfection, gene delivery via lentiviral vector, gene delivery via adeno-associated virus (AAV) vector, gene delivery via adenovirus vector, and gene delivery via Sendai virus vector.

[0050] According to an embodiment of the present invention, a method for promoting the proliferation of isolated hepatocellular carcinoma cells includes increasing the phosphorylation level of the S497 site of the RBBP5.

[0051] According to an embodiment of the present invention, the improvement of the phosphorylation level of RBBP5 at the S497 site is carried out by an activator activation treatment, wherein the activator includes at least one of a vector virus and liposomes.

[0052] According to embodiments of the present invention, a method for inhibiting the proliferation of isolated hepatocellular carcinoma cells includes at least one of inhibiting the expression of HKDC1 or the activity of protein kinases or reducing the phosphorylation level of RBBP5 in the hepatocellular carcinoma cells.

[0053] According to embodiments of the present invention, the inhibition of HKDC1 expression or protein kinase activity or the reduction of RBBP5 phosphorylation level is achieved by at least one of the following methods:

[0054] Mutate HKDC1, reduce the expression level of HKDC1, mutate RBBP5, and reduce the expression level of RBBP5.

[0055] According to an embodiment of the present invention, the mutation HKDC1 is implemented in the following manner:

[0056] At least one of the following is performed on at least a portion of the HKDC1 sequence: deletion, substitution, insertion, inversion, and displacement.

[0057] According to an embodiment of the present invention, at least a portion of the sequence of HKDC1 includes at least one of the amino acid sequences at positions G231-G233 and G678-G880.

[0058] According to an embodiment of the present invention, the mutation HKDC1 is performed in the presence of at least one of gene editing system-related reagents, chemical mutagens, transposons, shRNA, siRNA, and long non-coding RNA.

[0059] According to an embodiment of the present invention, the reduction of HKDC1 expression is performed under the condition that at least one of shRNA and siRNA is present.

[0060] According to an embodiment of the present invention, the shRNA that reduces the expression level of HKDC1 has a nucleotide sequence as shown in SEQ ID NO:3.

[0061] CCTGTACTTGTGGATGAACAT (SEQ ID NO: 3).

[0062] According to an embodiment of the present invention, the mutation RBBP5 is implemented in the following manner:

[0063] At least one of the following is performed on at least a portion of the RBBP5 sequence: deletion, substitution, insertion, inversion, and displacement.

[0064] According to an embodiment of the present invention, the mutated RBBP5 is performed in the presence of at least one of gene editing system-related reagents, chemical mutagens, transposons, shRNA, siRNA, and long non-coding RNA.

[0065] According to an embodiment of the present invention, the reduction of RBBP5 expression is performed under conditions where at least one of shRNA and siRNA is present.

[0066] According to an embodiment of the present invention, the shRNA that reduces the expression level of RBBP5 has a nucleotide sequence as shown in SEQ ID NO:4.

[0067] TCATTGTACCCAGCGTCATTT (SEQ ID NO: 4).

[0068] Methods for regulating RBBP5 phosphorylation

[0069] In a fourth aspect, the present invention provides a method for regulating RBBP5 phosphorylation. According to embodiments of the invention, the expression of HKDC1 or protein kinase activity is regulated in the hepatocellular carcinoma cells. The method according to embodiments of the invention is capable of regulating the phosphorylation level of RBBP5.

[0070] According to an embodiment of the present invention, the liver cancer cells include at least one of Hep3B and PLC.

[0071] According to embodiments of the present invention, a method for increasing RBBP5 phosphorylation includes increasing the expression of HKDC1 or the activity of protein kinase in the hepatocellular carcinoma cells.

[0072] According to an embodiment of the present invention, the enhancement of HKDC1 expression is achieved by at least one of the following methods:

[0073] Viral / non-viral vector-mediated gene / mRNA transfection technology, transposase or recombinase-mediated gene integration, and CRISPR / CAS-based gene editing or transcriptional activation.

[0074] According to embodiments of the present invention, the gene / mRNA transfection technology is achieved by utilizing at least one of the following methods: liposome or LNP-mediated transfection, calcium phosphate-mediated transfection, cationic transfection reagent-mediated transfection, virus-like particle (VLP)-mediated transfection, electroporation transfection, gene delivery via lentiviral vector, gene delivery via adeno-associated virus (AAV) vector, gene delivery via adenovirus vector, and gene delivery via Sendai virus vector.

[0075] According to an embodiment of the present invention, the enhancement of RBBP5 phosphorylation further includes enhancing the phosphorylation level of the S497 site of RBBP5.

[0076] According to an embodiment of the present invention, the improvement of the phosphorylation level of the S497 site of RBBP5 is carried out by an activator activation treatment, wherein the activator includes at least one of a vector virus and liposomes.

[0077] According to embodiments of the present invention, a method for inhibiting RBBP5 phosphorylation includes inhibiting the expression of HKDC1 or the activity of a protein kinase in the hepatocellular carcinoma cells.

[0078] According to embodiments of the present invention, the inhibition of HKDC1 expression or protein kinase activity is achieved by at least one of the following methods: mutating HKDC1 or reducing the expression level of HKDC1.

[0079] According to an embodiment of the present invention, the mutation HKDC1 is achieved by deleting, replacing, inserting, inverting, and transposing at least one of the following methods to at least a portion of the HKDC1 sequence.

[0080] According to an embodiment of the present invention, at least a portion of the sequence of HKDC1 includes at least one of the amino acid sequences at positions G231-G233 and G678-G880.

[0081] According to an embodiment of the present invention, the mutation HKDC1 is performed in the presence of at least one of gene editing system-related reagents, chemical mutagens, transposons, shRNA, siRNA, and long non-coding RNA.

[0082] According to an embodiment of the present invention, the reduction of HKDC1 expression is performed under the condition that at least one of shRNA and siRNA is present.

[0083] According to an embodiment of the present invention, the shRNA that reduces the expression level of HKDC1 has a nucleotide sequence as shown in SEQ ID NO:3.

[0084] Use of reagents in the preparation of reagent kits

[0085] In a fifth aspect of the invention, the invention provides the use of a reagent in the preparation of a kit for regulating the proliferation of liver cancer cells, the reagent being used to regulate the markers described in the first aspect of the invention.

[0086] According to embodiments of the present invention, the kit is used to promote the proliferation of liver cancer cells, and the reagent is used to increase the expression of HKDC1 or the activity of protein kinase or to increase the phosphorylation level of RBBP5.

[0087] According to embodiments of the present invention, the reagent includes an activator, viral / non-viral vector-mediated gene / mRNA transfection technology, gene editing technology, or transcriptional activation, wherein the activator includes at least one of a vector virus and liposomes.

[0088] According to embodiments of the present invention, the kit is used to inhibit the proliferation of liver cancer cells, and the reagent is used to inhibit the expression of HKDC1 or the activity of protein kinase or reduce the phosphorylation level of RBBP5.

[0089] According to embodiments of the present invention, the reagent is used to mutate at least one of HKDC1 and RBBP5, and the reagent includes at least one of gene editing system-related reagents, chemical mutagens, transposons, shRNA, siRNA, and long non-coding RNA.

[0090] According to embodiments of the present invention, the chemical mutagen includes at least one of nitrosoururacil, ethyl methanesulfonic acid, and N-methyl-N'-nitrosourea.

[0091] According to an embodiment of the present invention, the mutation HKDC1 is implemented in the following manner:

[0092] At least one of the following is performed on at least a portion of the HKDC1 sequence: deletion, substitution, insertion, inversion, and displacement.

[0093] According to an embodiment of the present invention, at least a portion of the sequence of HKDC1 includes at least one of amino acids at positions G231-G233 and G678-G880.

[0094] According to an embodiment of the present invention, the reagent is used to reduce the expression level of HKDC1, and the reagent includes at least one of shRNA and siRNA.

[0095] According to an embodiment of the present invention, the shRNA that reduces the expression level of HKDC1 has a nucleotide sequence as shown in SEQ ID NO:3.

[0096] According to an embodiment of the present invention, the mutated RBBP5 is achieved by deleting, substituting, inserting, inverting, or translocating at least one portion of the RBBP5 sequence.

[0097] According to an embodiment of the present invention, the reagent is used to reduce the expression level of RBBP5, and the reagent includes at least one of shRNA and siRNA.

[0098] According to an embodiment of the present invention, the shRNA that reduces the expression level of RBBP5 has a nucleotide sequence as shown in SEQ ID NO:4.

[0099] Use of reagents in the preparation of reagent kits

[0100] In a sixth aspect of the invention, the invention provides the use of reagents in the preparation of a kit for regulating the phosphorylation level of RBBP5, the reagents for regulating the expression of HKDC1 or protein kinase activity.

[0101] According to embodiments of the present invention, the kit is used to increase the phosphorylation level of RBBP5, and the reagent is used to increase the expression of HKDC1 or the activity of protein kinase.

[0102] According to embodiments of the present invention, the reagent includes an activator, viral / non-viral vector-mediated gene / mRNA transfection technology, gene editing technology, or transcriptional activation, wherein the activator includes at least one of a vector virus and liposomes.

[0103] According to embodiments of the present invention, the kit is used to reduce the phosphorylation level of RBBP5, and the reagent is used to inhibit the expression of HKDC1 or protein kinase activity.

[0104] According to an embodiment of the present invention, the reagent is used to mutate HKDC1, and the reagent includes at least one of gene editing system-related reagents, chemical mutagens, transposons, shRNA, siRNA, and long non-coding RNA.

[0105] According to embodiments of the present invention, the chemical mutagen includes at least one of nitrosoururacil, ethyl methanesulfonic acid, and N-methyl-N'-nitrosourea.

[0106] According to an embodiment of the present invention, the mutation HKDC1 is achieved by deleting, replacing, inserting, inverting, and transposing at least one of the following methods to at least a portion of the HKDC1 sequence.

[0107] According to an embodiment of the present invention, at least a portion of the sequence of HKDC1 includes at least one of amino acids at positions G231-G233 and G678-G880.

[0108] According to an embodiment of the present invention, the reagent is used to reduce the expression level of HKDC1, and the reagent includes at least one of shRNA and siRNA.

[0109] According to an embodiment of the present invention, the shRNA that reduces the expression level of HKDC1 has a nucleotide sequence as shown in SEQ ID NO:3.

[0110] Use of reagents in the preparation of reagent kits

[0111] In a seventh aspect of the invention, the invention provides the use of a reagent in the preparation of a kit for regulating the proliferation of liver cancer cells, the reagent being used to regulate the phosphorylation level of RBBP5.

[0112] According to an embodiment of the present invention, the kit is used to promote the proliferation of liver cancer cells, and the reagent is used to increase the phosphorylation level of RBBP5.

[0113] According to embodiments of the present invention, the reagent includes activator activation treatment, viral / non-viral vector-mediated gene / mRNA transfection technology, gene editing technology, or transcriptional activation, wherein the activator includes at least one of vector viruses and liposomes.

[0114] According to an embodiment of the present invention, the kit is used to inhibit the proliferation of liver cancer cells, and the reagent is used to reduce the phosphorylation level of RBBP5.

[0115] According to an embodiment of the present invention, the reagent is used to mutate RBBP5, and the reagent includes at least one of gene editing system-related reagents, chemical mutagens, transposons, shRNA, siRNA, and long non-coding RNA.

[0116] According to embodiments of the present invention, the chemical mutagen includes at least one of nitrosoururacil, ethyl methanesulfonic acid, and N-methyl-N'-nitrosourea.

[0117] According to an embodiment of the present invention, the mutated RBBP5 is achieved by deleting, substituting, inserting, inverting, or translocating at least one portion of the RBBP5 sequence.

[0118] According to an embodiment of the present invention, the reagent is used to reduce the expression level of RBBP5, and the reagent includes at least one of shRNA and siRNA.

[0119] According to an embodiment of the present invention, the shRNA that reduces the expression level of RBBP5 has a nucleotide sequence as shown in SEQ ID NO:4.

[0120] According to an embodiment of the present invention, the reagent is used to regulate the phosphorylation level of the S497 site of RBBP5.

[0121] Use of reagents in the preparation of reagent kits

[0122] In an eighth aspect of the invention, the invention provides the use of a reagent in the preparation of a kit for regulating the proliferation of liver cancer cells, the reagent being used to regulate the phosphorylation level of the S497 site of RBBP5.

[0123] According to an embodiment of the present invention, the kit is used to promote the proliferation of liver cancer cells, and the reagent is used to increase the phosphorylation level of RBBP5 at the S497 site.

[0124] According to embodiments of the present invention, the reagent includes an activator, viral / non-viral vector-mediated gene / mRNA transfection technology, gene editing technology, or transcriptional activation, wherein the activator includes at least one of a vector virus and liposomes.

[0125] According to an embodiment of the present invention, the kit is used to inhibit the proliferation of liver cancer cells, and the reagent is used to reduce the phosphorylation level of RBBP5 at the S497 site.

[0126] According to an embodiment of the present invention, the reagent is used to mutate the S497 site of RBBP5, and the reagent includes at least one of gene editing system-related reagents, chemical mutagens, transposons, shRNA, siRNA, and long non-coding RNA.

[0127] According to embodiments of the present invention, the chemical mutagen includes at least one of nitrosoururacil, ethyl methanesulfonic acid, and N-methyl-N'-nitrosourea.

[0128] Uses of reagents in drug preparation

[0129] In a ninth aspect of the invention, the invention provides the use of the reagent in the preparation of a medicament for the prevention / treatment of the occurrence of liver cancer, wherein the reagent is used to inhibit the expression of HKDC1 or the activity of a protein kinase.

[0130] According to an embodiment of the present invention, the reagent is used to mutate HKDC1, and the reagent includes at least one of gene editing system-related reagents, chemical mutagens, transposons, shRNA, siRNA, and long non-coding RNA.

[0131] According to embodiments of the present invention, the chemical mutagen includes at least one of nitrosoururacil, ethyl methanesulfonic acid, and N-methyl-N'-nitrosourea.

[0132] According to an embodiment of the present invention, the mutation HKDC1 is implemented in the following manner:

[0133] At least one of the following is performed on at least a portion of the HKDC1 sequence: deletion, substitution, insertion, inversion, and displacement.

[0134] According to an embodiment of the present invention, the reagent is used to reduce the expression level of HKDC1, and the reagent includes at least one of shRNA and siRNA.

[0135] According to an embodiment of the present invention, the shRNA that reduces the expression level of HKDC1 has a nucleotide sequence as shown in SEQ ID NO:3.

[0136] Uses of reagents in drug preparation

[0137] In a tenth aspect of the invention, the invention provides the use of the reagent in the preparation of a medicament for the prevention / treatment of liver cancer, wherein the reagent is used to inhibit the phosphorylation level of RBBP5.

[0138] According to an embodiment of the present invention, the reagent is used to mutate RBBP5, and the reagent includes at least one of gene editing system-related reagents, chemical mutagens, transposons, shRNA, siRNA, and long non-coding RNA.

[0139] According to an embodiment of the present invention, the mutation RBBP5 is implemented in the following manner:

[0140] At least one of the following is performed on at least a portion of the RBBP5 sequence: deletion, substitution, insertion, inversion, and displacement.

[0141] According to an embodiment of the present invention, the reagent is used to reduce the expression level of RBBP5, and the reagent includes at least one of shRNA and siRNA.

[0142] According to an embodiment of the present invention, the shRNA that reduces the expression level of RBBP5 has a nucleotide sequence as shown in SEQ ID NO:4.

[0143] According to embodiments of the present invention, the chemical mutagen includes at least one of nitrosoururacil, ethyl methanesulfonic acid, and N-methyl-N'-nitrosourea.

[0144] Uses of reagents in drug preparation

[0145] In an eleventh aspect of the invention, the invention provides the use of the reagent in the preparation of a medicament for the prevention / treatment of the development of liver cancer, wherein the reagent is used to inhibit the phosphorylation level of the S497 site of RBBP5.

[0146] According to an embodiment of the present invention, the reagent is used to mutate the S497 site of RBBP5, and the reagent includes at least one of gene editing system-related reagents, chemical mutagens, transposons, shRNA, siRNA, and long non-coding RNA.

[0147] According to embodiments of the present invention, the chemical mutagen includes at least one of nitrosoururacil, ethyl methanesulfonic acid, and N-methyl-N'-nitrosourea.

[0148] Methods for diagnosing liver cancer

[0149] In a twelfth aspect, the present invention provides a method for diagnosing liver cancer. According to embodiments of the invention, the method includes: diagnosing whether liver cancer has occurred by detecting the expression level or activity of HKDC1 or the phosphorylation level of RBBP5 at the S497 site in a test sample; wherein a HKDC1 protein expression level in the test sample that is more than 1-2 times higher than the HKDC1 protein expression level in a normal sample indicates the occurrence of liver cancer, and a HKDC1 protein expression level in the test sample that is less than 1-2 times lower than the HKDC1 protein expression level in a normal sample indicates the absence of liver cancer; wherein a phosphorylation level of RBBP5 at the S497 site in the test sample that is twice higher than the phosphorylation level of RBBP5 at the S497 site in a normal sample indicates the occurrence of liver cancer, and a phosphorylation level of RBBP5 at the S497 site in the test sample that is less than twice the phosphorylation level of RBBP5 at the S497 site in a normal sample indicates the absence of liver cancer. The method according to embodiments of the present invention can effectively improve the accuracy of liver cancer diagnosis.

[0150] The present invention will be explained below with reference to embodiments. Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be considered as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0151] Example 1: Identification of HKDC1 protein kinase activity

[0152] 1. In vitro protein kinase experiment

[0153] (1) HKDC1 and RBBP5 protein induction

[0154] The purified CDS sequences of HKDC1 and RBBP5 were constructed into the pet22(b)His prokaryotic expression vector (purchased from Addgene). The recombinant plasmids were transformed into Rosetta competent cells, plated, and incubated overnight at 37°C inverted mode. Single colonies were picked and added to 15 mL centrifuge tubes containing LB medium, along with the appropriate volume of antibiotic, and incubated overnight at 37°C. The bacterial culture was then added to Erlenmeyer flasks containing LB medium at a 1:50 ratio and incubated at 37°C with shaking. After 2 hours of incubation, the absorbance at 600 nm was measured using a UV spectrophotometer. When the OD value reached 0.6-0.8, the culture was cooled in a chromatography cabinet at 4°C. After 20 minutes, 1 mM IPTG was added to the cooled culture, and induction was performed overnight at 16°C. The culture was collected the next day and stored at -80°C.

[0155] (2) His protein purification

[0156] Collect 50 mL of bacterial pellet from the bacterial culture, resuspend in 10 mL of 20 mM imidazole buffer, and add the appropriate volume of PMSF and cocktail. Perform sonication using a 6 mm probe at 18% power, with a sonication time of 1 second followed by a 2-second pause, for a total of 30 min. The entire process is performed at low temperature. Centrifuge at 10,000 rpm for 10 min. Transfer the supernatant to a pre-treated nickel column and incubate at low temperature for 1 h. Centrifuge at 2,500 rpm for 2 min. Wash the nickel column twice with 50 mM imidazole buffer. Elute with 5 mL of 200 mM imidazole buffer, rotating at low temperature for 10 min, then at 3,000 rpm for 1 min. Concentrate the purified protein eluent using a concentration tube. The imidazole buffer formulation is shown in Table 1.

[0157] Table 1

[0158]

[0159] (3) In vitro protein kinase experiment

[0160] Take 2 μg of in vitro purified His-HKDC1 and 2 μg of His-RBBP5, with His-RBBP5 as the substrate protein. Prepare the reaction system.

[0161] The formulation of the in vitro protein kinase reaction buffer is shown in Table 2:

[0162] Table 2

[0163]

[0164] The in vitro protein kinase reaction system is shown in Table 3:

[0165] Table 3

[0166]

[0167] The reaction was carried out in a 37°C water bath for 30 min, followed by the addition of 40 mM EDTA and incubation at 37°C for 5 min to terminate the kinase reaction. 2 μL of PNBM was added to the above system and the reaction was carried out at room temperature for 1 h to alkylate the thiophosphate groups. 10 μL of 5× loading buffer was added directly and the mixture was heated in a 100°C metal bath for 5 min. The sample was collected, and the changes in RBBP5 phosphorylation levels were detected by Western blotting. The specific steps were as follows: After separating the protein by SDS-PAGE electrophoresis, the protein was transferred to a nitrocellulose membrane and blocked with skim milk. The protein was then fully bound to the membrane with a His-tagged antibody, an antibody specifically binding to RBBP5 (primary antibody), and a thiophosphate ester antibody (primary antibody), respectively. A secondary antibody specifically binding to the primary antibody was then used for binding, followed by chemical imaging and fixing. The images were scanned and analyzed. Specific results are shown below. Figure 1 As shown in Figure A, HKDC1 significantly promotes the phosphorylation level of RBBP5 in the in vitro system, indicating that HKDC1 can function as a protein kinase in vitro and promote the phosphorylation of the substrate protein RBBP5.

[0168] 2. Western blot analysis was used to detect the phosphorylation level of RBBP5 in cells with knockdown or overexpression of HKDC1.

[0169] HKDC1 was knocked down in Hep3B (ATCC; catalog number HB8064) and PLC (ATCC; catalog number CRL-8024), respectively. A knockdown plasmid was constructed by ligating the HKDC1 shRNA (nucleotide sequence shown in SEQ ID NO:3) into the PLKO.1 vector (Addgene; catalog number 8453). Lentiviral cells containing HKDC1 knockdown were produced using 293T cells in the presence of the packaging plasmids psPAX2 and pMD2.G. The lentivirus was used to infect Hep3B or PLC cells. After passage, stable HKDC1 knockdown cell lines were established through antibiotic selection. Cells were harvested, and cell lysis buffer was used to lyse each cell component, allowing cell contents (including proteins) to be incorporated into the lysate. Protein quantification of the cell lysate was performed under the same conditions. Finally, the samples with uniform protein content were analyzed by Western spectroscopy. The blot analysis procedure is as follows: After separating the protein by SDS-PAGE electrophoresis, the protein is transferred to a nitrocellulose membrane and blocked with skim milk; the protein is then fully bound to the membrane with antibodies (primary antibodies) against HKDC1 (Proteintech, catalog number 25874-1-AP), RBBP5 (Cell Signaling Technology, catalog number 13171), and ACTIN, as well as with RBBP5 S497 phosphorylation antibody (pS497) (Abclonal, catalog number E20544) (primary antibody); then, the protein is bound to the membrane with a secondary antibody that specifically binds to the primary antibody; chemical imaging and fixing are then performed; the images are then scanned and analyzed.

[0170] The results are as follows Figure 1 As shown in Figure B, the pS497 level was significantly decreased in Hep3B and PLC with HKDC1 knockdown, indicating that HKDC1 promotes phosphorylation of the substrate protein RBBP5 at the S497 site.

[0171] 3. Identification of HKDC1 protein kinase site

[0172] (1) The binding of HKDC1 to ATP was simulated using AlphaFold2. The results showed that HKDC1 has a structure similar to that of classical protein kinases. Both its N-terminus and C-terminus contain cavities for ATP binding. ATP binds to the glycine-rich loop at the lower margin of the leaflet. The terminal end of ATP is a hinge structure that can change conformation, where the protein substrate binds. The amino acid that interacts with HKDC1 in the intermolecular direction is the GTG (glycine-threonine-glycine) motif in the glycine-rich loop, and it has the same sequence and similar ATP binding mode at the N-terminus and C-terminus, namely amino acids G231-G233 and G678-G880, respectively. The predicted ATP binding site of HKDC1 was mutated into an inactivating mutant (Kinase-dead mutant, i.e., KD), which mutated the GTG sequence at both the N-terminus and C-terminus to alanine (i.e., AAA). The WT and KD mutants of His-HKDC1 were purified from bacteria and subjected to in vitro kinase reactions with His-RBBP5, respectively. Changes in RBBP5 phosphorylation levels were then detected using Western blot experiments. His-tagged antibodies, RBBP5 protein-specific antibodies (primary antibodies), and thiophosphate ester antibodies (primary antibodies) were used for detection. The results after imaging were analyzed. Figure 2 As shown in Figure A, the results indicate that the KD mutation in HKDC1 prevents RBBP5 phosphorylation. This suggests that the predicted glycine-enriched GTG sequence is the protein kinase site of HKDC1.

[0173] (2) The pSin-EF2-puro vector (purchased from Addgene, catalog number 16580) was ligated with the wild-type (WT) sequence of HKDC1 or the kinase site inactivation mutant (KD) sequence of HKDC1 to construct overexpression plasmids. In the presence of packaging plasmids psPAX2 and pMD2.G, lentiviruses that knocked down HKDC1, overexpressed HKDC1-WT, and overexpressed HKDC1-KD were produced using 293T cells. The viruses were collected and first infected with the knocked-down HKDC1 virus in Hep3B and PLC cells, respectively. After screening with antibiotics to ensure stable knockdown of HKDC1, the cells were then infected with the lentiviruses that overexpressed HKDC1-WT or HKDC1-KD. After stable overexpression, the cells were harvested, lysed, and incubated with antibodies (primary antibodies) against HKDC1, RBBP5, and ACTIN, as well as the RBBP5 S497 phosphorylation antibody (pS497) (primary antibody) by Western blot. After development, the images were scanned and analyzed.

[0174] The results are as follows Figure 2As shown in Figure B, overexpression of the KD mutant cannot phosphorylate RBBP5, indicating that the protein kinase sites of HKDC1 are amino acids G231-G233 and G678-G880.

[0175] Example 2: HKDC1 promotes histone methylation modification through protein kinase activity

[0176] HKDC1 was knocked down in Hep3B and PLC cells, or wild-type (WT) and kinase site inactivation mutant (KD) HKDC1 were stably overexpressed after knocking down endogenous HKDC1. After stable knockdown or overexpression, cells were harvested and nuclear proteins were extracted. The steps for extracting nuclear proteins are as follows:

[0177] 1. Resuspend the cells in 500 μL Nuclear buffer 1 (add DTT and PMSF before use), transfer 1 / 5 of the volume to a 1.5 mL EP tube, centrifuge, and then add cell lysis buffer separately to extract total protein; the formulation of Nuclear buffer 1 is shown in Table 4:

[0178] Table 4

[0179]

[0180] 2. Add 500 μL of Nuclear buffer 2 (add 0.6% Triton X-100 to Nuclear buffer 1), lyse for 10 min, gently inverting the container several times during the lysis, and centrifuge at 1500×g at 4℃ for 10 min;

[0181] 3. The supernatant is cytoplasm, and the precipitate is cell nucleus. Take 200 μL of supernatant into a new 1.5 mL EP tube and discard the remaining supernatant. If cell lysis is insufficient, resuspend the cells in 500 μL of Nuclear buffer 1, add 3-4 mL of Nuclear buffer 2 for lysis, invert the tube several times, and centrifuge at 1500 × g at 4 °C for 10 min.

[0182] 4. Discard the supernatant, add an appropriate amount of Nuclear lysis, and sonicate to lyse the cell nuclei at a power of 20-30%, sonicating for 3 seconds and pausing for 3 seconds, repeating this process 15-20 times until the suspension is clear and flowable; the Nuclear lysis formula is shown in Table 5.

[0183] Table 5

[0184]

[0185] 5. Centrifuge the protein at 16,000×g at 4℃ for 10 min, quantify it, and then detect histone methylation by Western blot.

[0186] The results are as follows Figure 3 As shown, in Hep3B and PLC cells with knocked-down HKDC1 ( Figure 3 As shown in Figure A), H3K4me3 levels were significantly reduced; however, after knocking down endogenous HKDC1, overexpression of WT enhanced H3K4me3 levels, while KD mutants did not, indicating that the protein kinase function of HKDC1 promotes H3K4me3 modification.

[0187] Example 3: HKDC1 promotes gene expression through protein kinase activity

[0188] After knocking down endogenous HKDC1 in Hep3B and PLC cells, wild-type (WT) and kinase site inactivation mutants (KD) of HKDC1 were stably overexpressed. Cells were harvested after stable knockdown or overexpression, and mRNA was extracted for quantitative real-time PCR (qRT-PCR) to detect the mRNA levels of HKDC1-regulated target genes ATAD5, CENPE, CDC27, KIF14, KNL1, NEK7, NEK9, TTK, and TOPBP1. The mRNA extraction and qRT-PCR experimental procedures are as follows:

[0189] 1. Discard the culture medium, wash the cells with pre-cooled PBS, add 1 mL of Trizol to each dish and pipette repeatedly to completely lyse the cells, then transfer to 1.5 mL RNase-free EP tubes;

[0190] 2. Add 200 μL of chloroform, shake vigorously, allow to stand until the layers separate, and centrifuge at 10,000 × g at 4 °C for 15 min;

[0191] 3. Add 500 μL of isopropanol to each of the new 1.5 mL RNA-Free EP tubes. Carefully transfer the supernatant from the previous step into the isopropanol, shake vigorously, and incubate at room temperature for 10 min. Centrifuge at 10,000 × g at 4 °C for 15 min to obtain RNA precipitate.

[0192] 4. Discard the supernatant, add 700 μL of 75% ethanol (prepared with DEPC water), gently vortex, resuspend the RNA, and centrifuge at 10,000 × g at 4 °C for 15 min;

[0193] 5. Discard the supernatant, leave the container open in a clean bench for 5-10 minutes to allow the ethanol to evaporate completely, add 40-100 μL of DEPC water to dissolve the RNA, mix well, and take a small amount to determine the concentration.

[0194] 6. Reverse transcription system 1 was synthesized according to the reverse transcription kit instructions and reacted at 65℃ for 5 min using a PCR instrument. Then, reverse transcription system 2 was prepared, and cDNA was synthesized using a PCR instrument. After reverse transcription, the cDNA was diluted with water at a ratio of 1:10. The cDNA can be stored long-term at -20℃. Reverse transcription systems 1 and 2 are shown in Tables 6 and 7.

[0195] Table 6

[0196]

[0197] Table 7

[0198]

[0199] 7. Using cDNA as a template, the following qRT-PCR reaction system was prepared using SYBR Green fluorescent dye for real-time quantitative PCR to detect mRNA expression. The mRNA expression abundance was expressed as the difference between the relative expression levels of the target gene and the internal control 18S. Three replicates were performed for each group, and the average value was used for calculation. The qRT-PCR reaction system is shown in Table 8.

[0200] Table 8

[0201]

[0202] The results are as follows Figure 4 As shown, WT cells overexpressing HKDC1 in Hep3B and PLC upregulated the mRNA levels of target genes ATAD5, CENPE, CDC27, KIF14, KNL1, NEK7, NEK9, TTK, and TOPBP1, while KD mutant cells overexpressing HKDC1 did not. These genes are all related to cell mitosis, indicating that the protein kinase function of HKDC1 promotes the proliferation of liver cancer cells by promoting the expression of cell division-related genes.

[0203] Example 4: HKDC1 promotes liver cancer cell proliferation through protein kinase activity

[0204] The effect of HKDC1 protein kinase function on the proliferation rate of liver cancer was confirmed by cell counting.

[0205] The results are as follows Figure 5 As shown, where Figure 5 As shown in Figure A, in Hep3B cells overexpressing HKDC1, the cell proliferation rate increased, reaching 30,000 cells on day 6; while in Hep3B cells overexpressing the HKDC1 protein kinase site mutant KD, the cell number only reached 10,000 on day 6. This indicates that overexpression of HKDC1 promotes the proliferation of liver cancer cells, while inhibiting the protein kinase activity of HKDC1 does not change the cell proliferation rate.

[0206] Among them, such as Figure 5 As shown in Figure B, in Hep3B cells overexpressing the RBBP5 phosphorylation site-inactivated mutant (S497A), the cell proliferation rate was not significantly different compared to the control group (EV). However, in Hep3B cells overexpressing the RBBP5 mimic phosphorylation site mutant (S497D), the cell proliferation rate was significantly increased compared to the control group (EV) and comparable to the proliferation rate of Hep3B cells overexpressing RBBP5 wild-type (WT). This indicates that phosphorylation modification of the RBBP5 protein at the S497 site enhances the survival of liver cancer cells.

[0207] The above cell experiments showed that in liver cancer cells, the expression level of HKDC1 protein and protein kinase activity were positively correlated with cell proliferation rate. Tumor cells with high expression of HKDC1 and high phosphorylation level of RBBP5 had better survival, suggesting that the protein kinase activity of HKDC1 can be used as a biomarker for cancer development.

[0208] Example 5: High expression of HKDC1 and pS497 in multiple clinical tumor samples

[0209] 1. Detection of HKDC1 and pS497 levels in clinical liver cancer samples using immunoblotting.

[0210] Samples were collected from clinical liver cancer patients (from the First Affiliated Hospital of the University of Science and Technology of China (Anhui Provincial Hospital), with the approval of the Ethics Committee of the Affiliated Hospital of USTC). Tumor tissues in the samples were separated from adjacent normal tissues, and the phosphorylation of HKDC1 and RBBP5 at S497 site and the expression of total RBBP5 protein in different tissues were detected. The specific steps are as follows: Add the tissue lysis buffer (50 mL of lysis buffer containing 47.55 mL of RIPA lysis buffer, 100 μL of 0.5 M Na3VO4 solution, 1 mL of 0.5 M NaF solution, 100 μL of 1 M DTT solution, 250 μL of 0.2 M PMSF solution, and 1 mL of protease inhibitor cocktails; RIPA lysis buffer: Tris 6 g, NaCl 8.76 g, sodium deoxycholate 5 g, SDS 1 g, NaF 0.42 g, EDTA·2Na·2H2O 1.86 g, Triton X-100 10 mL, adjust pH to 7.4 with hydrochloric acid, add ddH2O to bring the volume to 1000 mL, and store at 4℃) to the tumor tissue and adjacent normal tissue. After ultrasonic disruption and thorough lysis, extract the protein components from the tissue. Subsequently, the proteins in different components were quantitatively analyzed. Finally, samples with the same protein content were subjected to Western blot experiments, and incubated with antibodies (primary antibodies) of HKDC1, RBBP5 and Calnexin, as well as phosphorylation antibody (pS497) of RBBP5 (primary antibody). After development, the images were scanned and analyzed.

[0211] The results are as follows Figure 6 As shown, HKDC1 protein was significantly overexpressed in multiple clinical hepatocellular carcinoma tissue samples (n=12). However, the expression level of HKDC1 protein was low in normal tissues, and the phosphorylation level of RBBP5 was also high in hepatocellular carcinoma tissues, indicating that the level of HKDC1 and the phosphorylation level of RBBP5 showed a positive correlation.

[0212] This suggests that phosphorylation levels at HKDC1 and RBBP5 S497 sites can serve as biomarkers for detecting tumor development and progression. Measuring the phosphorylation levels of HKDC1 and RBBP5 S497 sites can indicate the presence of cancer; abnormally elevated levels suggest the presence of cancer.

[0213] 2. Immunohistochemical assay to detect the expression levels of HKDC1 and pS497 in clinical liver cancer samples.

[0214] Samples were collected from clinical liver cancer patients (from the First Affiliated Hospital of the University of Science and Technology of China (Anhui Provincial Hospital), with approval from the Ethics Committee of the University of Science and Technology of China). Paraffin sections were prepared from the samples, and immunohistochemical staining was used to detect the levels of HKDC1, RBBP5 S497 phosphorylation, and total RBBP5 protein in the serial sections. The immunohistochemical staining steps are as follows:

[0215] (1) Baking: Place the tissue sections on a slide rack and bake in a 65℃ oven for 5-10 minutes. The time should not be too long to prevent the tissue from falling off the slide.

[0216] (2) Dewaxing: Pass the tissue sections through three sets of xylene, ensuring the xylene completely covers the tissue, for 5 minutes per set, with 20 rapid up-and-down extractions during entry and exit.

[0217] (3) Hydration: Hydrate in anhydrous ethanol, 95% ethanol and 75% ethanol for 5 minutes in sequence. When entering and exiting, quickly extract 10 times up and down. After the extraction, place in a beaker containing cold water and rinse with running water for 2 minutes. Note that the water stream should not be directed at the tissue.

[0218] (4) Inactivation: Immerse the slices completely in 3% hydrogen peroxide (prepare fresh and discard after use), incubate at room temperature for 15 minutes, and then rinse under running water for 5 minutes.

[0219] (5) Antigen retrieval: Prepare EDTA aqueous solution, heat it in a pressure cooker, and when it is about to boil, put the tissue slices into the solution (make sure the solution covers the tissue), close the pressure cooker lid tightly and continue heating. When the pressure cooker starts to emit steam, time for 3-5 minutes. After the pressure cooker cools down, take out the slices.

[0220] (6) Blocking: Shake off the water on the section, draw a closed circle around the tissue with a colorless crayon, rinse the tissue with PBS 3 times, 1 min each time, shake off the water on the section, add 30-50 μL of 5% goat serum blocking solution (prepared with PBST), and block at room temperature for 30 min.

[0221] (7) Primary antibody incubation: spin dry the slices, add 30-50 μL of primary antibody (dilute with primary antibody dilution buffer, prepare fresh before use), HKDC1 antibody dilution ratio is 1:5000, pS497 antibody dilution ratio is 1:5000, RBBP5 antibody dilution ratio is 1:500, incubate at room temperature for 3 h or at 4℃ overnight;

[0222] (8) Secondary antibody incubation: Wash the sections 3 times with PBST (prepared by adding 0.1% Tween-20 to PBS) for 1 min each time, and then wash them 2 times with PBS for 1 min each time;

[0223] (9) Color development: Dilute DAB color development solution at a ratio of 1:20 (prepare fresh and store away from light), spin dry the section, add 30-50 μL of color development solution, and when the tissue turns brown, immediately rinse it in PBS. Wash with PBS twice for 1 min each time, and then rinse with water 2-3 times for 1 min each time.

[0224] (10) Counterstaining: Spin dry the sections and stain them in hematoxylin staining solution (the staining time can vary from 10s to 5min depending on the effect of the staining solution), and then immediately rinse them in running water for 2 to 3 minutes.

[0225] (11) Hydration: After placing the slices in 0.1% hydrochloric acid and anhydrous ethanol, immediately remove them and place them in a beaker containing cold water. Rinse with running water for 2-3 minutes.

[0226] (12) Dehydration and clearing: The slices were treated in 75% ethanol, 95% ethanol and anhydrous ethanol for 4 min in sequence, with 10 rapid up and down extractions during entry and exit, and then passed through xylene for 5 min each time. The slices were then air-dried.

[0227] (13) Mounting: Add an appropriate amount of resin to the center of the slide, mount with a coverslip, and then use a panoramic tissue quantitative analyzer for photography and quantification.

[0228] Immunohistochemical experiments were performed on tissue sections from three patients with liver cancer. Figure 7 The results of the immunohistochemical experiments are shown. The brownish-yellow color indicates the expression level of each protein; the darker the color, the higher the protein expression level. The red dashed line is the boundary between cancerous tissue and adjacent normal tissue; P represents adjacent normal tissue, and T represents cancerous tissue. Figure 7 The results showed that compared with adjacent normal tissue, the levels of HKDC1 and pS497 were significantly increased in cancerous tissue, while the level of total RBBP5 protein did not change significantly. This indicates that the protein expression level of HKDC1 is positively correlated with the level of pS497 and is significantly increased in cancerous tissue, and can be used as a biomarker to detect the occurrence of liver cancer.

[0229] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0230] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A cancer biomarker, characterized in that, The markers include at least one of HKDC1 and RBBP5; Wherein, HKDC1 has an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO:1, and RBBP5 has an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO:2; Optionally, the cancer is liver cancer.

2. Use of the reagent in the preparation of a kit for indicating the occurrence of liver cancer, wherein the reagent is used to bind to or identify the biomarker of claim 1; Optionally, the reagent is used to identify the expression level of HKDC1 or the phosphorylation level of RBBP5; Optionally, the reagent is used to identify the phosphorylation level at the S497 site of RBBP5.

3. The use according to claim 2, characterized in that, The reagents include antibodies, probes, or small molecule chemiluminescent reagents that bind to the markers.

4. A method for regulating the proliferation of isolated liver cancer cells, characterized in that, include: In the hepatocellular carcinoma cells, at least one of the following is regulated: the expression of HKDC1 or the activity of protein kinase, or the phosphorylation level of RBBP5; Optionally, the liver cancer cells include at least one of Hep3B and PLC.

5. The method according to claim 4, characterized in that, Methods for promoting the proliferation of isolated hepatocellular carcinoma cells include increasing the expression of HKDC1 or the activity of a protein kinase, or increasing the phosphorylation level of RBBP5 in the hepatocellular carcinoma cells; Optionally, the enhancement of HKDC1 expression or protein kinase activity is achieved by at least one of the following methods: Viral / non-viral vector-mediated gene / mRNA transfection technology, transposase or recombinase-mediated gene integration, and CRISPR / CAS-based gene editing or transcriptional activation. Optionally, the gene / mRNA transfection technology is achieved by utilizing at least one of the following methods: liposome or LNP-mediated transfection, calcium phosphate-mediated transfection, cationic transfection reagent-mediated transfection, virus-like particle (VLP)-mediated transfection, electroporation transfection, gene delivery via lentiviral vector, gene delivery via adeno-associated virus (AAV) vector, gene delivery via adenovirus vector, and gene delivery via Sendai virus vector. Optionally, methods for promoting the proliferation of isolated hepatocellular carcinoma cells include increasing the phosphorylation level of the S497 site of the RBBP5; Optionally, the enhancement of the phosphorylation level at the S497 site of RBBP5 is achieved by activator activation treatment, wherein the activator includes at least one of a vector virus and liposomes.

6. The method according to claim 4, characterized in that, Methods for inhibiting the proliferation of isolated hepatocellular carcinoma cells include at least one of inhibiting the expression of HKDC1 or the activity of a protein kinase or reducing the phosphorylation level of RBBP5 in the hepatocellular carcinoma cells; Optionally, the inhibition of HKDC1 expression or protein kinase activity or the reduction of RBBP5 phosphorylation level is achieved by at least one of the following methods: Mutate HKDC1, reduce the expression level of HKDC1, mutate RBBP5, and reduce the expression level of RBBP5. Optionally, the mutation HKDC1 is implemented in the following manner: At least one of the following is performed on at least a portion of the HKDC1 sequence: deletion, substitution, insertion, inversion, and transposition. Optionally, at least a portion of the sequence of HKDC1 includes at least one of the amino acid sequences at positions G231-G233 and G678-G880; Optionally, the HKDC1 mutation is performed in the presence of at least one of gene editing system-related reagents, chemical mutagens, transposons, shRNA, siRNA, and long non-coding RNA; Optionally, the reduction of HKDC1 expression is performed under conditions where at least one of shRNA and siRNA is present; Optionally, the shRNA that reduces the expression level of HKDC1 has a nucleotide sequence as shown in SEQ ID NO:3; Optionally, the mutation RBBP5 is implemented in the following manner: At least one of the following is performed on at least a portion of the RBBP5 sequence: deletion, substitution, insertion, inversion, and transposition. Optionally, the mutated RBBP5 is performed in the presence of at least one of gene editing system-related reagents, chemical mutagens, transposons, shRNA, siRNA, and long non-coding RNA; Optionally, the reduction of RBBP5 expression is performed under conditions where at least one of shRNA and siRNA is present; Optionally, the shRNA that reduces RBBP5 expression has a nucleotide sequence as shown in SEQ ID NO:

4.

7. A method for regulating RBBP5 phosphorylation, characterized in that, Regulates the expression of HKDC1 or the activity of protein kinases in liver cancer cells; Optionally, the liver cancer cells include at least one of Hep3B and PLC.

8. The method according to claim 7, characterized in that, Methods to increase RBBP5 phosphorylation include increasing the expression of HKDC1 or the activity of protein kinase in the hepatocellular carcinoma cells; Optionally, the improvement in the expression of HKDC1 is achieved by at least one of the following methods: Viral / non-viral vector-mediated gene / mRNA transfection technology, transposase or recombinase-mediated gene integration, and CRISPR / CAS-based gene editing or transcriptional activation. Optionally, the gene / mRNA transfection technology is achieved by utilizing at least one of the following methods: liposome or LNP-mediated transfection, calcium phosphate-mediated transfection, cationic transfection reagent-mediated transfection, virus-like particle (VLP)-mediated transfection, electroporation transfection, gene delivery via lentiviral vector, gene delivery via adeno-associated virus (AAV) vector, gene delivery via adenovirus vector, and gene delivery via Sendai virus vector. Optionally, the enhancement of RBBP5 phosphorylation further includes enhancing the phosphorylation level of the S497 site of RBBP5.

9. The method according to claim 7, characterized in that, Methods for inhibiting RBBP5 phosphorylation include inhibiting the expression of HKDC1 or the activity of protein kinase in the hepatocellular carcinoma cells; Optionally, the inhibition of HKDC1 expression or protein kinase activity is achieved by at least one of the following methods: Mutate HKDC1 and reduce its expression level; Optionally, the mutation HKDC1 is implemented in the following manner: At least one of the following is performed on at least a portion of the HKDC1 sequence: deletion, substitution, insertion, inversion, and transposition. Optionally, at least a portion of the sequence of HKDC1 includes at least one of the amino acid sequences at positions G231-G233 and G678-G880; Optionally, the HKDC1 mutation is performed in the presence of at least one of gene editing system-related reagents, chemical mutagens, transposons, shRNA, siRNA, and long non-coding RNA; Optionally, the reduction of HKDC1 expression is performed under conditions where at least one of shRNA and siRNA is present; Optionally, the shRNA that reduces the expression level of HKDC1 has a nucleotide sequence as shown in SEQ ID NO:

3.

10. Use of the reagent in the preparation of a kit for regulating the proliferation of liver cancer cells, wherein the reagent is used to regulate the marker of claim 1.

11. The use according to claim 10, characterized in that, The kit is used to promote the proliferation of liver cancer cells, and the reagent is used to increase the expression of HKDC1 or the activity of protein kinase or to increase the phosphorylation level of RBBP5. Optionally, the reagent includes an activator, viral / non-viral vector-mediated gene / mRNA transfection technology, gene editing technology, or transcriptional activation, wherein the activator includes at least one of a vector virus and liposomes.

12. The use according to claim 10, characterized in that, The kit is used to inhibit the proliferation of liver cancer cells, and the reagent is used to inhibit the expression of HKDC1 or the activity of protein kinase or reduce the phosphorylation level of RBBP5. Optionally, the reagent is used to mutate at least one of HKDC1 and RBBP5, and the reagent includes at least one of gene editing system-related reagents, chemical mutagens, transposons, shRNA, siRNA, and long non-coding RNA; Optionally, the chemical mutagen includes at least one of nitrosoururacil, ethyl methanesulfonic acid, and N-methyl-N'-nitrosourea; Optionally, the mutation HKDC1 is implemented in the following manner: At least one of the following is performed on at least a portion of the HKDC1 sequence: deletion, substitution, insertion, inversion, and transposition. Optionally, at least a portion of the sequence of HKDC1 includes at least one of amino acids at positions G231-G233 and G678-G880; Optionally, the reagent is used to reduce the expression level of HKDC1, and the reagent includes at least one of shRNA and siRNA; Optionally, the shRNA that reduces the expression level of HKDC1 has a nucleotide sequence as shown in SEQ ID NO:3; Optionally, the mutation RBBP5 is implemented in the following manner: At least one of the following is performed on at least a portion of the RBBP5 sequence: deletion, substitution, insertion, inversion, and transposition. Optionally, the reagent is used to reduce the expression level of RBBP5, and the reagent includes at least one of shRNA and siRNA; Optionally, the shRNA that reduces RBBP5 expression has a nucleotide sequence as shown in SEQ ID NO:

4.

13. Use of the reagent in the preparation of the kit for regulating the phosphorylation level of RBBP5, and the reagent for regulating the expression of HKDC1 or the activity of the protein kinase.

14. The use according to claim 13, characterized in that, The kit is used to increase the phosphorylation level of RBBP5, and the reagent is used to increase the expression of HKDC1 or the activity of protein kinases. Optionally, the reagent includes an activator, viral / non-viral vector-mediated gene / mRNA transfection technology, gene editing technology, or transcriptional activation, wherein the activator includes at least one of a vector virus and liposomes.

15. The use according to claim 13, characterized in that, The kit is used to reduce the phosphorylation level of RBBP5, and the reagent is used to inhibit the expression of HKDC1 or the activity of protein kinases. Optionally, the reagent is used to mutate HKDC1, and the reagent includes at least one of gene editing system-related reagents, chemical mutagens, transposons, shRNA, siRNA, and long non-coding RNA; Optionally, the chemical mutagen includes at least one of nitrosoururacil, ethyl methanesulfonic acid, and N-methyl-N'-nitrosourea; Optionally, the mutation HKDC1 is implemented in the following manner: At least one of the following is performed on at least a portion of the HKDC1 sequence: deletion, substitution, insertion, inversion, and transposition. Optionally, at least a portion of the sequence of HKDC1 includes at least one of amino acids at positions G231-G233 and G678-G880; Optionally, the reagent is used to reduce the expression level of HKDC1, and the reagent includes at least one of shRNA and siRNA; Optionally, the shRNA that reduces the expression level of HKDC1 has a nucleotide sequence as shown in SEQ ID NO:

3.

16. Use of the reagent in the preparation of a kit for regulating the proliferation of liver cancer cells, wherein the reagent is used to regulate the phosphorylation level of RBBP5.

17. The use according to claim 16, characterized in that, The kit is used to promote the proliferation of liver cancer cells, and the reagent is used to increase the phosphorylation level of RBBP5. Optionally, the reagent includes activator activation treatment, viral / non-viral vector-mediated gene / mRNA transfection technology, gene editing technology, or transcriptional activation, wherein the activator includes at least one of vector viruses and liposomes.

18. The use according to claim 16, characterized in that, The kit is used to inhibit the proliferation of liver cancer cells, and the reagent is used to reduce the phosphorylation level of RBBP5. Optionally, the reagent is used to mutate RBBP5, and the reagent includes at least one of gene editing system-related reagents, chemical mutagens, transposons, shRNA, siRNA, and long non-coding RNA; Optionally, the chemical mutagen includes at least one of nitrosoururacil, ethyl methanesulfonic acid, and N-methyl-N'-nitrosourea; Optionally, the mutation RBBP5 is implemented in the following manner: At least one of the following is performed on at least a portion of the RBBP5 sequence: deletion, substitution, insertion, inversion, and transposition. Optionally, the reagent is used to reduce the expression level of RBBP5, and the reagent includes at least one of shRNA and siRNA; Optionally, the shRNA that reduces RBBP5 expression has a nucleotide sequence as shown in SEQ ID NO:

4.

19. The use according to claim 16, characterized in that, The reagent is used to regulate the phosphorylation level at the S497 site of RBBP5.

20. Use of the reagent in the preparation of a kit for regulating the proliferation of liver cancer cells, wherein the reagent is used to regulate the phosphorylation level of RBBP5 at the S497 site.

21. The use according to claim 20, characterized in that, The kit is used to promote the proliferation of liver cancer cells, and the reagent is used to increase the phosphorylation level of RBBP5 at the S497 site. Optionally, the reagent includes an activator, viral / non-viral vector-mediated gene / mRNA transfection technology, gene editing technology, or transcriptional activation, wherein the activator includes at least one of a vector virus and liposomes.

22. The use according to claim 20, characterized in that, The kit is used to inhibit the proliferation of liver cancer cells, and the reagent is used to reduce the phosphorylation level of RBBP5 at the S497 site. Optionally, the reagent is used to mutate the S497 site of RBBP5, and the reagent includes at least one of gene editing system-related reagents, chemical mutagens, transposons, shRNA, siRNA, and long non-coding RNA; Optionally, the chemical mutagen includes at least one of nitrosoururacil, ethyl methanesulfonic acid, and N-methyl-N'-nitrosourea.

23. Use of the reagent in the preparation of a drug for the prevention / treatment of hepatocellular carcinoma, wherein the reagent is used to inhibit the expression of HKDC1 or the activity of a protein kinase; Optionally, the reagent is used to mutate HKDC1, and the reagent includes at least one of gene editing system-related reagents, chemical mutagens, transposons, shRNA, siRNA, and long non-coding RNA; Optionally, the chemical mutagen includes at least one of nitrosoururacil, ethyl methanesulfonic acid, and N-methyl-N'-nitrosourea; Optionally, the mutation HKDC1 is implemented in the following manner: At least one of the following is performed on at least a portion of the HKDC1 sequence: deletion, substitution, insertion, inversion, and transposition. Optionally, the reagent is used to reduce the expression level of HKDC1, and the reagent includes at least one of shRNA and siRNA; Optionally, the shRNA that reduces the expression level of HKDC1 has a nucleotide sequence as shown in SEQ ID NO:

3.

24. Use of the reagent in the preparation of a drug for the prevention / treatment of liver cancer, wherein the reagent is used to inhibit the phosphorylation level of RBBP5; Optionally, the reagent is used to mutate RBBP5, and the reagent includes at least one of gene editing system-related reagents, chemical mutagens, transposons, shRNA, siRNA, and long non-coding RNA; Optionally, the mutation RBBP5 is implemented in the following manner: At least one of the following is performed on at least a portion of the RBBP5 sequence: deletion, substitution, insertion, inversion, and transposition. Optionally, the reagent is used to reduce the expression level of RBBP5, and the reagent includes at least one of shRNA and siRNA; Optionally, the shRNA that reduces RBBP5 expression has a nucleotide sequence as shown in SEQ ID NO:4; Optionally, the chemical mutagen includes at least one of nitrosoururacil, ethyl methanesulfonic acid, and N-methyl-N'-nitrosourea.

25. Use of the reagent in the preparation of a drug for the prevention / treatment of the development of liver cancer, wherein the reagent is used to inhibit the phosphorylation level of RBBP5 at the S497 site; Optionally, the reagent is used to mutate the S497 site of RBBP5, and the reagent includes at least one of gene editing system-related reagents, chemical mutagens, transposons, shRNA, siRNA, and long non-coding RNA; Optionally, the chemical mutagen includes at least one of nitrosoururacil, ethyl methanesulfonic acid, and N-methyl-N'-nitrosourea.