Use of a compound or derivative or salt thereof in the prevention and treatment of viral vertical transmission

Abstract

The application belongs to the field of biological pharmacy, and provides application of a compound or a derivative or a salt thereof in prevention and treatment of vertical transmission of viruses, in particular, provides use of a compound or a pharmaceutically acceptable salt thereof in preparation of a medicine, and the medicine is used for at least one of the following: (1) inhibition and / or blocking of transmission of flavivirus from a mother to an embryo and / or a fetus; (2) prevention and / or treatment of flavivirus infection of the embryo and / or the fetus, and diseases caused by the flavivirus infection, wherein the compound comprises a transcytosis pathway inhibitor. The compound or the pharmaceutically acceptable salt thereof cannot significantly reduce the load of the flavivirus in the mother, but can effectively and specifically reduce the amount of the flavivirus infection in the fetus and the pre-embryo, significantly inhibits the vertical transmission of the flavivirus in the fetus or the embryo after the flavivirus infects the mother, and effectively guarantees the safety during pregnancy.

Description

Technical Field

[0001] This application pertains to the field of biopharmaceuticals, specifically the application of a compound or its derivative or salt in preventing vertical transmission of viruses. Background Technology

[0002] In recent years, it has been discovered that Zika virus infection can lead to neurological complications. Unlike neurotropic flaviviruses such as West Nile virus and Japanese encephalitis virus, Zika virus rarely causes encephalitis or meningitis in adults, but it can induce Guillain-Barré syndrome. More notably, the virus has a high affinity for the fetal nervous system. After infection in pregnant women, the virus can cross the placental barrier and invade the developing fetal central nervous system, leading to congenital Zika syndrome, clinically manifested as microcephaly, craniofacial abnormalities, eye lesions, sensorineural hearing loss, convulsions, and even stillbirth.

[0003] To date, there are no clinically approved specific anti-Zika virus drugs or therapies. Current treatment is mainly symptomatic and supportive, such as using acetaminophen to relieve fever and pain, or using antihistamines to control rash-related itching. In preclinical drug development, most strategies focus on targeting viral enzyme-active proteins (such as polymerases and proteases).

[0004] Therefore, given the high risk that Zika virus poses to the fetus, developing targeted interventions that can effectively block vertical transmission of the virus and ensure safety during pregnancy has become an urgent and important scientific research and clinical need. Summary of the Invention

[0005] This invention aims to at least partially solve at least one of the technical problems existing in the prior art. This invention is based on the discovery and understanding of the following facts and problems: Previous research in this application found that the E21K amino acid variation in the prM protein of flaviviruses, especially Zika virus, can significantly enhance the virus's vertical transmission capability and pathogenicity to newborn fetuses. Mechanistic studies showed that this variation significantly increases the efficiency of flaviviruses crossing the placental barrier via transcytosis, leading to a significant increase in viral load in fetal mice after flavivirus infection, thereby causing serious consequences such as impaired embryonic development, miscarriage, and brain development disorders in newborn fetuses.

[0006] Based on the above mechanism, this application systematically evaluated the effects of various compounds targeting the transcytosis pathway (brefidobacterium A, chlorpromazine, colchicine, and nystatin) on flavivirus translocation in an in vitro placental barrier model constructed in Transwell chambers. The results showed that all four inhibitors targeting the transcytosis pathway could inhibit flavivirus transmission, with brefidobacterium A and colchicine exhibiting stronger inhibitory effects in the experiments.

[0007] Furthermore, this application conducted in vivo experiments using a mouse pregnancy model carrying an E21K amino acid variant of the flavivirus prM protein. Surprisingly, administration of the aforementioned transcytosis pathway inhibitors did not significantly reduce the flavivirus load in maternal mice, but it significantly reduced the flavivirus load in fetal mice. Simultaneously, the transcytosis pathway inhibitors significantly alleviated fetal morphological abnormalities caused by viral infection and effectively reduced the miscarriage rate. Therefore, this application concludes that the aforementioned transcytosis pathway inhibitors can effectively inhibit the vertical transmission of flavivirus.

[0008] In a first aspect of the invention, the use of a compound or a pharmaceutically acceptable salt thereof in the preparation of a medicament is proposed. According to embodiments of the invention, the medicament is used for at least one of: (1) inhibiting and / or blocking the transmission of flavivirus from the mother to the embryo and / or fetus; (2) preventing and / or treating flavivirus infection in the embryo and / or fetus, and related diseases caused by flavivirus infection, wherein the compound comprises a transcytosis pathway inhibitor. This application has unexpectedly discovered that virus-targeting transcytosis pathway inhibitors can effectively inhibit and / or block the vertical transmission of flavivirus from the mother to the unborn fetus and pre-fetal embryo, and specifically reduce the flavivirus load in the unborn fetus and pre-fetal embryo, prevent and / or treat developmental disorders and malformations in the fetus or embryo, and reduce the probability of miscarriage.

[0009] According to embodiments of the present invention, the use of the above-mentioned compound or a pharmaceutically acceptable salt thereof in the preparation of a medicament further includes at least one of the following additional technical features: According to embodiments of the present invention, the compound comprises at least one of the following: brefidobacterium A, colchicine, chlorpromazine, nystatin, amiloride, pembrolizumin III, methyl-β-cyclodextrin, flubendiazole, itraconazole, vinblastine, imidazole, genistein, chloroquine, hydroxychloroquine, or nocodazole.

[0010] According to an embodiment of the present invention, the drug is used to reduce the content of flavivirus in the embryo and / or fetus. An unexpected discovery of the present invention is that, although the drug cannot directly reduce the viral load in the mother, it can significantly inhibit the vertical transmission of the virus from the mother to the early embryo and / or fetus, and can effectively reduce the viral content in the embryo and / or fetus, especially against flavivirus.

[0011] According to an embodiment of the present invention, the related diseases caused by the flavivirus infection include at least one of the following: miscarriage, embryonic and / or fetal malformation, and embryonic and / or fetal developmental disorders.

[0012] According to an embodiment of the present invention, the related diseases caused by flavivirus infection include at least one of the following: miscarriage, microcephaly, developmental delay, intellectual disability, hearing loss, visual impairment, joint contractures, and congenital Zika syndrome.

[0013] According to an embodiment of the present invention, the effective dose of the brevidin A or its derivatives, or pharmaceutically acceptable salts, is 0.81 to 1.63 mg / kg body weight, preferably 0.98 to 1.46 mg / kg body weight.

[0014] According to embodiments of the present invention, the effective dose of colchicine or its derivatives, or pharmaceutically acceptable salts, is 0.0081 to 0.0243 mg / kg body weight, preferably 0.0122 to 0.0203 mg / kg body weight.

[0015] According to an embodiment of the present invention, the concentration of brevidin A or its derivatives, or pharmaceutically acceptable salts, is 0.2 to 1.0 μM, preferably 0.3 to 0.8 μM.

[0016] According to an embodiment of the present invention, the concentration of colchicine or its derivatives, or pharmaceutically acceptable salts, used is 5-20 μM, preferably 8-15 μM.

[0017] According to embodiments of the present invention, the derivatives include tautomers, mesosomes, racemates, enantiomers, diastereomers, nitrides, or hydrates.

[0018] According to embodiments of the present invention, the pharmaceutically acceptable salt includes one or more of the following: hydrochloride, p-toluenesulfonate, sodium salt, methanesulfonate, sulfate, succinate, maleate, fumarate, acetate, phosphate, citrate, hydrobromide, benzoate, benzenesulfonate, tartrate, carbonate, citrate, gluconate, lactate, malate, stearate, valerate, nitrate, calcium salt, potassium salt, zinc salt, and meglumine salt.

[0019] According to embodiments of the present invention, the drug is administered in one or more of the following forms: injection, capsule, tablet, pill, liquid, powder, granule, fine granule, film-coated, pill, lozenge, sublingual, gel, sublingual preparation, paste, syrup, suspension, elixir, emulsion, coating, ointment, plaster, mud, transdermal preparation, lotion, inhaler, aerosol, and suppository.

[0020] In a second aspect, the present invention provides a medicament. According to embodiments of the invention, the medicament comprises a compound or a derivative thereof or a pharmaceutically acceptable salt thereof, said compound comprising a transcytosis pathway inhibitor. As previously stated, the present invention has investigated viral-targeting transcytosis pathway inhibitors and found that transcytosis pathway inhibitors, or their respective derivatives and salts, can specifically reduce viral load in unborn fetuses and pre-fetal embryos, prevent and / or treat fetal or embryonic developmental disorders and malformations, and reduce the probability of miscarriage. Therefore, a medicament comprising a transcytosis pathway inhibitor or its respective derivative and salt also possesses the above-mentioned effects, especially against flaviviruses.

[0021] According to embodiments of the present invention, the drug further includes at least one of the following additional technical features: According to embodiments of the present invention, the compound comprises at least one of the following: brefidobacterium A, colchicine, chlorpromazine, nystatin, amiloride, pembrolizumin III, methyl-β-cyclodextrin, flubendiazole, itraconazole, vinblastine, imidazole, genistein, chloroquine, hydroxychloroquine, or nocodazole.

[0022] According to an embodiment of the present invention, the drug is used for at least one of the following: (1) Inhibit and / or block the transmission of flaviviruses from the mother to the embryo and / or fetus; (2) Prevention and / or treatment of flavivirus infection in embryos and / or fetuses, and related diseases caused by flavivirus infection; (3) Reduce the amount of flavivirus in embryos and / or fetuses.

[0023] According to an embodiment of the present invention, the effective dose of the brevidin A or its derivatives, or pharmaceutically acceptable salts, is 0.81 to 1.63 mg / kg body weight, preferably 0.98 to 1.46 mg / kg body weight.

[0024] According to embodiments of the present invention, the effective dose of colchicine or its derivatives, or pharmaceutically acceptable salts, is 0.0081 to 0.0243 mg / kg body weight, preferably 0.0122 to 0.0203 mg / kg body weight.

[0025] According to an embodiment of the present invention, the concentration of brevidin A or its derivatives, or pharmaceutically acceptable salts, is 0.2 to 1.0 μM, preferably 0.3 to 0.8 μM.

[0026] According to an embodiment of the present invention, the concentration of colchicine or its derivatives, or pharmaceutically acceptable salts, used is 5-20 μM, preferably 8-15 μM.

[0027] According to an embodiment of the present invention, the related diseases caused by the flavivirus infection include at least one of the following: miscarriage, embryonic and / or fetal malformation, and embryonic and / or fetal developmental disorders.

[0028] According to an embodiment of the present invention, the related diseases caused by flavivirus infection include at least one of the following: miscarriage, microcephaly, developmental delay, intellectual disability, hearing loss, visual impairment, joint contractures, and congenital Zika syndrome.

[0029] According to embodiments of the present invention, the derivatives include tautomers, mesosomes, racemates, enantiomers, diastereomers, nitrides, or hydrates.

[0030] According to embodiments of the present invention, the pharmaceutically acceptable salt includes one or more of the following: hydrochloride, p-toluenesulfonate, sodium salt, methanesulfonate, sulfate, succinate, maleate, fumarate, acetate, phosphate, citrate, hydrobromide, benzoate, benzenesulfonate, tartrate, carbonate, citrate, gluconate, lactate, malate, stearate, valerate, nitrate, calcium salt, potassium salt, zinc salt, and meglumine salt.

[0031] According to embodiments of the present invention, the drug further includes a pharmaceutically acceptable carrier and / or excipient.

[0032] According to embodiments of the present invention, the drug is administered in one or more of the following forms: injection, capsule, tablet, pill, liquid, powder, granule, fine granule, film-coated, pill, lozenge, sublingual, gel, sublingual preparation, paste, syrup, suspension, elixir, emulsion, coating, ointment, plaster, mud, transdermal preparation, lotion, inhaler, aerosol, and suppository.

[0033] In a third aspect, the present invention provides a single-dose formulation. According to embodiments of the present invention, the single-dose formulation comprises a compound or a derivative thereof or a pharmaceutically acceptable salt thereof, wherein the compound comprises a transcytosis pathway inhibitor. Experimental verification according to this application shows that transcytosis pathway inhibitors or their derivatives and salts can inhibit and / or block the vertical transmission of viruses from the mother to the unborn fetus and pre-fetal embryo, specifically reducing the viral load in the unborn fetus and pre-fetal embryo, preventing and / or treating developmental disorders and malformations in the fetus or embryo, and reducing the probability of miscarriage, especially against flaviviruses. Therefore, a single-dose formulation containing a transcytosis pathway inhibitor or its derivative and salt also possesses the above-mentioned effects, and the single-dose formulation is more convenient to use.

[0034] According to embodiments of the present invention, the single dosage form further includes at least one of the following additional technical features: According to embodiments of the present invention, the compound comprises at least one of the following: brefidobacterium A, colchicine, chlorpromazine, nystatin, amiloride, pembrolizumin III, methyl-β-cyclodextrin, flubendiazole, itraconazole, vinblastine, imidazole, genistein, chloroquine, hydroxychloroquine, or nocodazole.

[0035] According to an embodiment of the present invention, the single dosage form comprises 30-165 mg of brevidin A or its derivatives, or a pharmaceutically acceptable salt, preferably 35-150 mg of brevidin A or its derivatives, or a pharmaceutically acceptable salt.

[0036] According to embodiments of the present invention, the single dosage form comprises 0.3200~2.450 mg colchicine or its derivatives, or a pharmaceutically acceptable salt, preferably 0.480~2.10 mg colchicine or its derivatives, or a pharmaceutically acceptable salt.

[0037] According to an embodiment of the present invention, the concentration of brevidin A or its derivatives, or pharmaceutically acceptable salts, is 0.2 to 1.0 μM, preferably 0.3 to 0.8 μM.

[0038] According to an embodiment of the present invention, the concentration of colchicine or its derivatives, or pharmaceutically acceptable salts, used is 5-20 μM, preferably 8-15 μM.

[0039] According to embodiments of the present invention, the derivatives include tautomers, mesosomes, racemates, enantiomers, diastereomers, nitrides, or hydrates.

[0040] According to embodiments of the present invention, the pharmaceutically acceptable salt includes one or more of the following: hydrochloride, p-toluenesulfonate, sodium salt, methanesulfonate, sulfate, succinate, maleate, fumarate, acetate, phosphate, citrate, hydrobromide, benzoate, benzenesulfonate, tartrate, carbonate, citrate, gluconate, lactate, malate, stearate, valerate, nitrate, calcium salt, potassium salt, zinc salt, and meglumine salt.

[0041] In a fourth aspect, the present invention provides a method for inhibiting and / or blocking the transmission of flaviviruses from the mother to the embryo and / or fetus. According to an embodiment of the invention, the method comprises: administering to the embryo and / or fetus and / or mother a pharmaceutically acceptable dose of a compound or a derivative thereof or a pharmaceutically acceptable salt thereof; wherein the compound comprises a transcytosis pathway inhibitor. This application has unexpectedly discovered that transcytosis pathway inhibitors or their respective derivatives and salts are effective in inhibiting and / or blocking viral transmission from the mother to the embryo and / or fetus, specifically reducing viral load in unborn fetuses and pre-fetal embryos, particularly against flaviviruses.

[0042] According to embodiments of the present invention, the above-described method for inhibiting and / or blocking the transmission of viruses from the mother to the embryo and / or fetus may further include at least one of the following additional technical features: According to embodiments of the present invention, the compound comprises at least one of the following: brefidobacterium A, colchicine, chlorpromazine, nystatin, amiloride, pembrolizumin III, methyl-β-cyclodextrin, flubendiazole, itraconazole, vinblastine, imidazole, genistein, chloroquine, hydroxychloroquine, or nocodazole.

[0043] According to an embodiment of the present invention, the effective dose of the brevidin A or its derivatives, or pharmaceutically acceptable salts, is 0.81 to 1.63 mg / kg body weight, preferably 0.98 to 1.46 mg / kg body weight.

[0044] According to embodiments of the present invention, the effective dose of colchicine or its derivatives, or pharmaceutically acceptable salts, is 0.0081 to 0.0243 mg / kg body weight, preferably 0.0122 to 0.0203 mg / kg body weight.

[0045] According to an embodiment of the present invention, the concentration of brevidin A or its derivatives, or pharmaceutically acceptable salts, is 0.2 to 1.0 μM, preferably 0.3 to 0.8 μM.

[0046] According to an embodiment of the present invention, the concentration of colchicine or its derivatives, or pharmaceutically acceptable salts, used is 5-20 μM, preferably 8-15 μM.

[0047] According to embodiments of the present invention, the derivatives include tautomers, mesosomes, racemates, enantiomers, diastereomers, nitrides, or hydrates.

[0048] According to embodiments of the present invention, the pharmaceutically acceptable salt includes one or more of the following: hydrochloride, p-toluenesulfonate, sodium salt, methanesulfonate, sulfate, succinate, maleate, fumarate, acetate, phosphate, citrate, hydrobromide, benzoate, benzenesulfonate, tartrate, carbonate, citrate, gluconate, lactate, malate, stearate, valerate, nitrate, calcium salt, potassium salt, zinc salt, and meglumine salt.

[0049] In a fifth aspect, the present invention provides a method for preventing and / or treating flavivirus infection in embryos and / or fetuses and related diseases caused by flavivirus infection. According to an embodiment of the invention, the method comprises: administering to the embryo and / or fetus and / or its mother a pharmaceutically acceptable dose of a compound or a pharmaceutically acceptable salt thereof; wherein the compound comprises a transcytosis pathway inhibitor.

[0050] The unexpected discovery in this application is that although transcytosis pathway inhibitors or their derivatives or salts cannot significantly reduce the flavivirus load in the mother, they can specifically reduce the flavivirus load in the unborn fetus and the pre-fetal embryo, prevent and / or treat fetal or embryonic developmental disorders and malformations, reduce the probability of miscarriage, and effectively ensure the safety of pregnancy.

[0051] According to embodiments of the present invention, the methods for preventing and / or treating flavivirus infection in embryos and / or fetuses and related diseases caused by flavivirus infection may further include at least one of the following additional technical features: According to embodiments of the present invention, the compound comprises at least one of the following: brefidobacterium A, colchicine, chlorpromazine, nystatin, amiloride, pembrolizumin III, methyl-β-cyclodextrin, flubendiazole, itraconazole, vinblastine, imidazole, genistein, chloroquine, hydroxychloroquine, or nocodazole.

[0052] According to an embodiment of the present invention, the prevention and / or treatment are used to reduce the content of flavivirus in the embryo and / or fetus.

[0053] According to an embodiment of the present invention, the prevention and / or treatment are used to reduce the content of flavivirus in embryos and / or fetuses by 60% to 90%.

[0054] According to an embodiment of the present invention, the effective dose of the brevidin A or its derivatives, or pharmaceutically acceptable salts, is 0.81 to 1.63 mg / kg body weight, preferably 0.98 to 1.46 mg / kg body weight.

[0055] According to embodiments of the present invention, the effective dose of colchicine or its derivatives, or pharmaceutically acceptable salts, is 0.0081 to 0.0243 mg / kg body weight, preferably 0.0122 to 0.0203 mg / kg body weight.

[0056] According to an embodiment of the present invention, the concentration of brevidin A or its derivatives, or pharmaceutically acceptable salts, is 0.2 to 1.0 μM, preferably 0.3 to 0.8 μM.

[0057] According to an embodiment of the present invention, the concentration of colchicine or its derivatives, or pharmaceutically acceptable salts, used is 5-20 μM, preferably 8-15 μM.

[0058] According to an embodiment of the present invention, the related diseases caused by the flavivirus infection include at least one of the following: miscarriage, embryonic and / or fetal malformation, and embryonic and / or fetal developmental disorders.

[0059] According to an embodiment of the present invention, the related diseases caused by flavivirus infection include at least one of the following: miscarriage, microcephaly, developmental delay, intellectual disability, hearing loss, visual impairment, joint contractures, and congenital Zika syndrome.

[0060] According to embodiments of the present invention, the derivatives include tautomers, mesosomes, racemates, enantiomers, diastereomers, nitrides, or hydrates.

[0061] According to embodiments of the present invention, the pharmaceutically acceptable salt includes one or more of the following: hydrochloride, p-toluenesulfonate, sodium salt, methanesulfonate, sulfate, succinate, maleate, fumarate, acetate, phosphate, citrate, hydrobromide, benzoate, benzenesulfonate, tartrate, carbonate, citrate, gluconate, lactate, malate, stearate, valerate, nitrate, calcium salt, potassium salt, zinc salt, and meglumine salt.

[0062] In a sixth aspect, the present invention provides a pregnancy biological model. According to an embodiment of the invention, the pregnancy biological model carries a flavivirus carrying a variant protein having a mutation at amino acid position 21 compared to the prM protein of wild-type flavivirus.

[0063] In a seventh aspect of the invention, the invention proposes the application of the aforementioned pregnancy biological model in drug screening. According to an embodiment of the invention, the method includes: administering a drug to be screened to the pregnancy biological model, determining a target drug based on the flavivirus content in the embryo and / or fetus of the pregnancy biological model before and after administration, wherein the drug is used for at least one of the following: (1) inhibiting and / or blocking the transmission of flavivirus from the mother to the embryo and / or fetus; (2) preventing and / or treating flavivirus infection in the embryo and / or fetus, and related diseases caused by flavivirus infection. This application has discovered that a mutation at amino acid position 21 (E) of the prM protein of wild-type virus significantly enhances the efficiency of flavivirus crossing the placental barrier via transcytosis, resulting in a significant increase in viral load in fetal mice after flavivirus infection, thereby causing problems such as impaired embryonic development, miscarriage, and developmental disorders of the newborn fetal brain. This mutation can significantly enhance the vertical transmission ability of flavivirus and its pathogenicity to the newborn fetus. After applying this biological model to screen the aforementioned drugs, this application found that it can effectively screen drugs that inhibit and / or block the transmission of flavivirus from the mother to the embryo and / or fetus, and reduce the flavivirus load in the embryo and / or fetus.

[0064] Beneficial effects: 1. The transcytosis pathway inhibitors or their derivatives or pharmaceutically acceptable salts described in this application have at least one of the following uses: (1) Inhibit and / or block the transmission of flaviviruses (e.g., Zika virus) from mother to embryo and / or fetus; (2) Prevention and / or treatment of flavivirus (e.g., Zika virus) infection in embryos and / or fetuses, and related diseases caused by flavivirus (e.g., Zika virus) infection; (3) Reduce the levels of flaviviruses (e.g., Zika virus) in embryos and / or fetuses; (4) Reduce the amount of flaviviruses (e.g., Zika virus) in embryos and / or fetuses by 60% to 90%.

[0065] 2. Compared with other virus-targeting transcytosis pathway inhibitors, the brefidobacterium A, colchicine or its derivatives or pharmaceutically acceptable salts of the present application have significantly better effects in inhibiting and / or blocking the transmission of flaviviruses (e.g., Zika virus) from the mother to the embryo and / or fetus, and better effects in preventing and / or treating diseases caused by flavivirus (e.g., Zika virus) infection.

[0066] 3. In this application, the prM protein of wild-type flavivirus (e.g., Zika virus) was subjected to E21K, and it was unexpectedly found that the vertical transmission ability and pathogenicity of the prepared flavivirus (e.g., Zika virus) were significantly enhanced. After applying this biological model to screen drugs, it was found that it could effectively screen drugs that inhibit and / or block the transmission of flavivirus (e.g., Zika virus) from the mother to the embryo and / or fetus, and reduce the flavivirus (e.g., Zika virus) load in the embryo and / or fetus.

[0067] Additional aspects and advantages of this application will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of this application. Attached Figure Description

[0068] The above and / or additional aspects and advantages of this application will become apparent and readily understood from the description of the embodiments taken in conjunction with the following drawings, in which: Figure 1 This is a schematic diagram of an in vitro placental barrier model according to an embodiment of the present invention.

[0069] Figure 2 The graph shows the results of the Zika virus crossing the placental barrier efficiency detection 24 h after infection, according to an embodiment of the present invention. The vertical axis represents the extracellular (MOI=1Vero, 24h) viral RNA (Viral RNA, Log copy number / mL).

[0070] Figure 3 This is a diagram showing the changes in permeability of JEG3 cells 24 hours after Zika virus infection, according to an embodiment of the present invention.

[0071] Figure 4 This is a graph showing the test results of the Zika virus crossing the placental barrier efficiency after infection at 4°C for 3 hours, according to an embodiment of the present invention.

[0072] Figure 5 This is a graph showing the test results of the Zika virus crossing the placental barrier efficiency after infection at 37°C for 3 hours, according to an embodiment of the present invention.

[0073] Figure 6 This figure shows the effect of the transcytosis pathway inhibitor on Zika virus crossing the placental barrier, according to an embodiment of the present invention.

[0074] Figure 7 This figure shows the cytotoxicity assessment results of the transcytosis pathway inhibitor in JEG-3 cells according to an embodiment of the present invention.

[0075] Figure 8 This figure shows the effect of transcytosis pathway inhibitor treatment on the reproductive tissue (uterus, left image) and placenta and fetal morphology (right image) of virus-infected pregnant mice according to an embodiment of the present invention.

[0076] Figure 9 The figure shows the effect of transcytosis pathway inhibitor treatment on fetal weight in pregnant mice infected with the virus, according to an embodiment of the present invention.

[0077] Figure 10 The figure shows the effect of transcytosis pathway inhibitor treatment on fetal abortion in pregnant mice infected with the virus, according to an embodiment of the present invention.

[0078] Figure 11 The figure shows the effect of transcytosis pathway inhibitor treatment on the RNA copy number of fetal rat Zika virus after viral infection in pregnant rats according to an embodiment of the present invention.

[0079] Figure 12 The figure shows the effect of transcytosis pathway inhibitor treatment on viremia in viral-infected pregnant mice according to an embodiment of the present invention.

[0080] Figure 13 The figure shows the effect of transcytosis pathway inhibitor treatment on placental viral load in pregnant mice infected with the virus, according to an embodiment of the present invention. Detailed Implementation

[0081] The embodiments of this application are described in detail below. The embodiments described below are exemplary and are only used to explain this application, and should not be construed as limiting this application.

[0082] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features indicated. Therefore, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. Furthermore, in the description of this application, unless otherwise stated, "multiple" means two or more.

[0083] Detailed description of the invention Definitions and General Terms It should be noted that the structural and chemical formula descriptions in the embodiments or implementations of this invention are intended to cover all alternatives, modifications, and equivalent technical solutions, all of which are within the scope of this invention as defined in the claims. Those skilled in the art will recognize that many similar or equivalent methods and materials can be used to practice this invention. This invention is by no means limited to the methods and materials described herein. In the event that one or more of the linked documents, patents, and similar materials differ from or contradict this application (including but not limited to defined terminology, terminology application, described techniques, etc.), this invention shall prevail.

[0084] It should be further appreciated that certain features of the invention, for clarity, have been described in multiple independent embodiments or implementations, but may also be provided in combination in a single embodiment or implementation. Conversely, various features of the invention, for brevity, have been described in a single embodiment or implementation, but may also be provided individually or in any suitable sub-combination.

[0085] Unless otherwise indicated, the technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains, and unless otherwise indicated, all patent publications cited in the entirety of this disclosure are incorporated herein by reference.

[0086] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0087] In this document, the terms “comprising” or “including” are open-ended expressions, meaning that they include the contents specified in this application but do not exclude other contents.

[0088] In this document, the terms “optionally,” “optionally,” or “optionally” generally refer to an event or condition that may, but may not, occur, and the description includes both cases in which the event or condition occurs and cases in which the event or condition does not occur.

[0089] In the text, "Brefeldin A" is a lactone antibiotic, a specific inhibitor of protein transport. Brefeldin A blocks the transport of secretory and membrane proteins from the endoplasmic reticulum to the Golgi apparatus. CAS No.: 20350-15-6, and its specific structure is shown in formula (Ⅰ). Equation (Ⅰ).

[0090] In this paper, the chemical structural formula of "Colchicine" is shown in formula (II), CAS No.: 477-27-0.

[0091] Formula (II).

[0092] In this paper, the chemical structural formula of "Chlorpromazine" is shown in formula (Ⅲ), CAS No.: 69-09-0.

[0093] Formula (III).

[0094] In this paper, the chemical structural formula of "Nystatin" is shown in formula (Ⅳ), CAS No.: 1400-61-9.

[0095] Formula (Ⅳ).

[0096] In this article, the term "flavivirus" refers to viruses within the genus Flaviviridae of the family Flaviviridae. These are enveloped, single-sense, positive-sense RNA viruses. These viruses cause infection through transmission by blood-sucking arthropods (mosquitoes, ticks, sandflies, etc.). Major flaviviruses include Zika virus (ZIKV), dengue virus (DENV), yellow fever virus (YFV), and West Nile virus (WNV).

[0097] In this article, the term "Zika virus (ZIKV)" refers to a mosquito-borne acute infectious disease pathogen belonging to the Flaviviridae family and the Flavivirus genus. Zika virus is approximately 40–50 nm in diameter, enveloped, and icosahedral in shape; it possesses a single-stranded positive-sense RNA, approximately 10.8 kb in length, containing only one open reading frame. After translation, it cleaves into: three structural proteins: capsid protein C, membrane precursor prM (which matures into M), and envelope protein E; and seven non-structural proteins: NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5.

[0098] In this document, the term "pharmaceutically acceptable" means that the compound can be administered to a subject without producing adverse physiological reactions that would prevent the administration of the compound or a pharmaceutically acceptable salt thereof.

[0099] In this document, the term "effective amount" refers to a therapeutic amount sufficient to reduce or improve the severity and / or duration of a condition or one or more of its symptoms; prevent disease progression; cause disease remission; prevent recurrence, development, or progression of one or more disease-related symptoms; detect disease; or enhance or improve the preventive or therapeutic effect of another therapy (e.g., a prophylactic or therapeutic agent). The therapeutically effective dose of the compounds described in this disclosure or their pharmaceutically acceptable salts depends on a variety of factors known in the art, such as weight, age, medical history, current treatment, the subject's health status and potential for cross-infection, allergies, hypersensitivity, and side effects, as well as the route of administration and the extent of tumor development. Those skilled in the art (e.g., physicians or veterinarians) may proportionally reduce or increase the dose based on these or other conditions or requirements.

[0100] In this document, the terms “treatment,” “reduction,” or “relief” are used interchangeably. These terms refer to methods of achieving beneficial or desired outcomes, including, but not limited to, treatment benefits. A “treatment benefit” means the eradication or improvement of one or more diseases, conditions, or circumstances associated with the underlying barrier being treated.

[0101] In this article, the terms “prevention” and “avoidance” are used interchangeably to refer to methods for obtaining beneficial or desired outcomes, including but not limited to preventive benefits. To obtain a “preventive benefit,” a drug may be given to a subject at risk of developing a specific disease, or to a subject who reports one or more physiological symptoms of a disease, even if a diagnosis of the disease may not have been made.

[0102] In this document, the term "administration" refers to the introduction of a predetermined amount of a substance into an individual in need by a suitable manner. The compounds of the present invention can be administered via any common route, as long as it can reach the intended tissue. Various routes of administration are contemplated, including oral, peritoneal, intravenous, intramuscular, subcutaneous, etc., but the present invention is not limited to these exemplified routes of administration. Preferably, the compounds of the present invention, or their pharmaceutically acceptable salts or drugs, are administered via intravenous or subcutaneous injection.

[0103] As used herein, the terms “application” or “giving” mean administered by a physician, nurse, healthcare provider, patient, or any other individual, including self-application and / or giving. This includes not only delivery into the body but also prescription, distribution, or any other means of facilitating delivery.

[0104] In this document, the term "identity" percentage refers to the degree to which the amino acids of two polypeptides are identical at equivalent positions when two sequences are optimally aligned. The alignment of amino acid sequence identity percentages can be performed using various methods within the art, such as software well-known in the field, including BLAST, BLAST-2, ALIGN, MEGALIGN (DNASTAR), CLUSTALW, or CLUSTAL OMEGA. Those skilled in the art can determine appropriate parameters for the aligned sequences, including any algorithms required to achieve maximum alignment of the full length of the compared sequences.

[0105] It should be noted that "at least 80% identity" means that compared with the wild-type viral strain protein, it has at least 80%, or at least 85%, or at least 90%, or at least 91%, or at least 92%, or at least 93%, or at least 94%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% similarity, and has the same or substantially similar properties or functions as the variant protein identified by the present invention.

[0106] It should be noted that "the drug is used to reduce the viral load in the embryo and / or fetus by 60% to 90%" means that the drug is used to reduce the viral load in the embryo and / or fetus by 60%, 63%, 65%, 68%, 70%, 73%, 75%, 78%, 80%, 83%, 85%, 88%, or 90%, or any range between the above values, such as 60% to 88%, 60% to 83%, 60% to 80%, 60% to 78%, 60% to 75%, 60% to 73 ... 0%, 60%~68%, 60%~65%, 60%~63%, 63%~90%, 63%~88%, 63%~85%, 63%~83%, 63%~80%, 63%~78%, 63%~75%, 63%~73%, 63%~70%, 63%~68%, 63%~65%, 65%~90%, 65%~88%, 65%~85%, 65%~83%, 65%~80%, 65%~78%, 65%~75%, 65%~73%, 65% ~70%, 65%~68%, 68%~90%, 68%~88%, 68%~85%, 68%~83%, 68%~80%, 68%~78%, 68%~75%, 68%~73%, 68%~70%, 70%~90%, 70%~88%, 70%~85%, 70%~83%, 70%~80%, 70%~78%, 70%~75%, 70%~73%, 73%~90%, 73%~88%, 73%~85%, 73%~83%, 7 The viral load is 3%~80%, 73%~78%, 73%~75%, 75%~90%, 75%~88%, 75%~85%, 75%~83%, 75%~80%, 75%~78%, 78%~90%, 78%~88%, 78%~85%, 78%~83%, 78%~80%, 80%~90%, 80%~88%, 80%~83%, 83%~90%, 83%~88%, 83%~85%, 85%~90%, 85%~88%, or 88%~90%. It should be noted that the drug can reduce the viral load in embryos and / or fetuses; the drug can reduce the viral load in embryos and / or fetuses by 60%~90%.

[0107] In this article, "EN" represents day N after the detection of the vaginal plug. In the "timed pregnancy" system of experimental mice, day 0.5 of the embryonic period (E0.5) is defined as noon on the day the vaginal plug is observed, and then one day is added every 24 hours thereafter. For example, E13.5 represents day 13 after the detection of the vaginal plug.

[0108] In this document, "embryo" and "fetus" refer to different developmental stages. In humans, an embryo refers to the developmental stage within 8 weeks after fertilization, particularly the period from week 3 to week 8, during which organs begin to form but are not yet fully differentiated. A fetus, on the other hand, refers to the stage from week 9 until full-term birth, during which organs further develop and acquire function. In specific embodiments of this invention, both the embryo and the fetus are unborn individuals. Those skilled in the art will understand that the specific timing of embryonic and fetal development varies depending on the animal species or animal model, and the time range for the embryonic and fetal stages can be artificially defined based on specific animal species or requirements.

[0109] In this article, the term "miscarriage," in humans, refers to the termination of pregnancy before 28 weeks of gestation and with a fetal weight of less than 1000 grams. Based on the mouse pregnancy model used in this article, miscarriage refers to the resorption of the embryo in early or late pregnancy, where late embryonic resorption means that placental structures can be observed in the uterus, but a formed fetus cannot be observed.

[0110] In this article, the term "microcephaly" refers to the condition in which a virus attacks neural stem cells in the fetal brain, inhibiting their proliferation and differentiation, leading to thinning of the cerebral cortex, reduction in brain volume, and abnormal brain development in the fetus from the uterine stage, resulting in a significantly smaller head.

[0111] In this article, the term “congenital Zika syndrome” refers to a series of fetal developmental abnormalities caused by Zika virus infection, mainly manifested as microcephaly, eye lesions (e.g., retinal abnormalities and other eye defects), and other neurological defects (neurodevelopmental delay, motor disorders, language disorders, and behavioral abnormalities).

[0112] Pharmaceutical Uses In embodiments of the present invention, the use of compounds or derivatives thereof or pharmaceutically acceptable salts thereof in the preparation of medicaments for at least one of the following: (1) inhibiting and / or blocking the transmission of flavivirus from mother to embryo and / or fetus; (2) preventing and / or treating flavivirus infection in embryo and / or fetus, and related diseases caused by flavivirus infection, wherein the compounds include transcytosis pathway inhibitors. Experiments using a constructed pregnancy biological model have shown that, although transcytosis pathway inhibitors cannot significantly reduce the flavivirus load in the mother, they can effectively inhibit the vertical transmission of flavivirus from mother to fetus, block or reduce the degree of flavivirus infection in embryo and / or fetus, and prevent and / or treat related diseases caused by flavivirus infection.

[0113] According to embodiments of the present invention, the use of the above-mentioned compound or a pharmaceutically acceptable salt thereof in the preparation of a medicament further includes at least one of the following additional technical features: In some alternative embodiments, the flavivirus includes at least one of the following: Zika virus, dengue virus, yellow fever virus, or West Nile virus.

[0114] In some specific embodiments, the flavivirus is Zika virus. According to specific embodiments of the present invention, the above-mentioned compound or its derivatives or pharmaceutically acceptable salts can effectively inhibit and / or block the vertical transmission of Zika virus from the mother to the fetus and pre-fetal embryo, specifically reduce the Zika virus load in the unborn fetus and pre-fetal embryo, prevent and / or treat developmental disorders and malformations of the fetus or embryo, and reduce the probability of miscarriage.

[0115] In some alternative embodiments, the compound comprises at least one of the following: brefidobacterium A, colchicine, chlorpromazine, nystatin, amiloride, filipin III, methyl-β-cyclodextrin, flubendazole, itraconazole, vinblastine, imipramine, genistein, chloroquine, hydroxychloroquine, and nocodazole.

[0116] In some preferred embodiments, the compound comprises at least one of the following: brevidicin A, colchicine, chlorpromazine, or nystatin. Based on verification of this invention, brevidicin A, colchicine, chlorpromazine, and nystatin, or their respective derivatives or pharmaceutically acceptable salts, can specifically reduce the viral load of flaviviruses (especially Zika virus) in unborn fetuses and pre-fetal embryos, prevent and / or treat developmental disorders and malformations in the fetus or embryo, and reduce the probability of miscarriage.

[0117] In some specific embodiments, the compound is preferably at least one of the following: brevidin A or colchicine. This application has unexpectedly discovered that, compared to other virus-targeting transcytosis inhibitors, brevidin A and colchicine, or their respective derivatives or salts, can specifically reduce viral load (especially Zika virus) in unborn fetuses and pre-fetal embryos, preventing and / or treating fetal or embryonic developmental disorders and malformations, and reducing the probability of miscarriage.

[0118] In some alternative embodiments, the drug is used to reduce the flavivirus content in the embryo and / or fetus. An unexpected discovery of this invention is that, while the drug cannot directly reduce the flavivirus load in the mother, it can significantly inhibit the vertical transmission of flavivirus from the mother to the early embryo and / or fetus, effectively reducing the flavivirus content in the embryo and / or fetus.

[0119] In some alternative embodiments, the drug is used to reduce the flavivirus content in the embryo and / or fetus by 60% to 90%. An unexpected discovery of this invention is that, although the drug cannot directly reduce the flavivirus load in the mother, it can significantly inhibit the vertical transmission of flavivirus from the mother to the early embryo and / or fetus, effectively reducing the flavivirus content in the embryo and / or fetus by 60% to 90%.

[0120] In some alternative embodiments, the effective dose of the brevidin A or its derivatives, or pharmaceutically acceptable salts, in mice is 10-20 mg / kg body weight, preferably 12-18 mg / kg body weight. Based on the conversion of human and mouse drug dosage by body surface area: Effective human dose = Effective mouse dose / 12.3 = (10~20) mg / kg / 12.3 = (0.81~1.63) mg / kg body weight. Therefore, the effective human dose of brevidin A or its derivatives, or pharmaceutically acceptable salts, is 0.81~1.63 mg / kg body weight. For example, the effective human doses of brevidin A or its derivatives, or pharmaceutically acceptable salts, are 0.81, 0.85, 0.90, 0.95, 1.00, 1.05, 1.10, 1.15, 1.20, 1.25, 1.30, 1.35, 1.40, 1.45, 1.50, 1.55, 1.60, or 1.63 mg / kg body weight. mg / kg body weight, or any range of values ​​above, such as 0.81~1.60, 0.81~1.55, 0.81~1.50, 0.81~1.45, 0.81~1.40, 0.81~1.35, 0.81~1.30, 0.81~1.25, 0.81~1.20, 0.81~1.15, 0.81~1.10, 0.81~1.05, 0.81~1.00, 0.81~0.95, 0.8 1~0.90, 0.81~0.85, 0.85~1.63, 0.85~1.60, 0.85~1.55, 0.85~1.50, 0.85~1.45, 0.85~1.40, 0.85~1.35, 0.85~1.30, 0.85~1.25, 0.85~1.20, 0.85~1.15, 0.85~1.10, 0.85~1.05, 0.85~1.00, 0.85~0.95, 0 0.85~0.90, 0.90~1.63, 0.90~1.60, 0.90~1.55, 0.90~1.50, 0.90~1.45, 0.90~1.40, 0.90~1.35, 0.90~1.30, 0.90~1.25, 0.90~1.20, 0.90~1.15, 0.90~1.10, 0.90~1.05, 0.90~1.00, 0.90~0.95, 0.95~1.63 0.95~1.60, 0.95~1.55, 0.95~1.50, 0.95~1.45, 0.95~1.40, 0.95~1.35, 0.95~1.30, 0.95~1.25, 0.95~1.20, 0.95~1.15, 0.95~1.10, 0.95~1.05, 0.95~1.00, 1.00~1.63, 1.00~1.60, 1.00~1.55, 1.00~1.50, 1.00~1.45, 1.00~1.40, 1.00~1.35, 1.00~1.30, 1.00~1.25, 1.00~1.20, 1.00~1.15, 1.00~1.10, 1.00~1.05, 1.05~1.63, 1.05~1.60, 1.05~1.55, 1.05~1.50, 1.05~1.45, 1.05~1.40, 1.05~1.35, 1.05~1.30, 1.05~1.25, 1.05~1.20, 1.05~1.15, 1.05~1.10, 1.10~ 1.63, 1.10~1.60, 1.10~1.55, 1.10~1.50, 1.10~1.45, 1.10~1.40, 1.10~1.35, 1.10~1.30, 1.10~1.25, 1.10~1.20, 1.10~1.15, 1.15~1.63, 1.15~1.60, 1.15~1.55, 1.15~1.50, 1.15~1.45, 1.15~1.40, 1.15~1.35, 1.15~1.30, 1.15~1.25, 1.15~1.20, 1.20~1.63, 1.2 0~1.60, 1.20~1.55, 1.20~1.50, 1.20~1.45, 1.20~1.40, 1.20~1.35, 1.20~1.30, 1.20~1.25, 1.25~1.63, 1.25~1.60, 1.25~1.55, 1.25~1.50, 1.25~1.45, 1.25~1.40, 1.25~1.35, 1.25~1.30, 1.30~1.63, 1.30~1.60, 1.30~1.55, 1.30~1.50, 1.30~1.45, 1.30~1.40, 1 0.30~1.35, 1.35~1.63, 1.35~1.60, 1.35~1.55, 1.35~1.50, 1.35~1.45, 1.35~1.40, 1.40~1.63, 1.40~1.60, 1.40~1.55, 1.40~1.50, 1.40~1.45, 1.45~1.63, 1.45~1.60, 1.45~1.55, 1.45~1.50, 1.50~1.63, 1.50~1.60, 1.50~1.55, 1.55~1.63, 1.55~1.60 or 1.60~1.63 mg / kg body weight. According to a preferred embodiment of the present invention, the effective dose of brevidin A or its derivatives or pharmaceutically acceptable salts for humans is 0.98~1.46 mg / kg body weight.

[0121] In some alternative embodiments, the effective dose of colchicine or its derivatives or pharmaceutically acceptable salts in mice is 0.1 to 0.3 mg / kg body weight, preferably 0.15 to 0.25 mg / kg body weight.Based on the conversion of drug dosage to body surface area between humans and mice: Effective dose in humans = Effective dose in mice / 12.3 = (0.1~0.3) mg / kg / 12.3 = (0.0081~0.0243) mg / kg body weight. That is, the effective dose of colchicine or its derivatives or pharmaceutically acceptable salts in humans is 0.0081~0.0243 mg / kg body weight. For example, the effective doses of brevidin A or its derivatives, and pharmaceutically acceptable salts in humans are 0.0081, 0.0085, 0.0090, 0.0095, 0.0100, 0.0105, 0.0110, 0.0115, 0.0120, 0.0125, 0.0130, 0.0135, 0.0140, and 0.014... 5. 0.0150, 0.0155, 0.0160, 0.0165, 0.0170, 0.0175, 0.0180, 0.0185, 0.0190, 0.0195, 0.0200, 0.0205, 0.0210, 0.0215, 0.0220, 0.0225, 0.0230, 0.0235, 0.0240 or 0.0243 mg / kg body weight, or a range between any two of the above values, for example: 0.0081~0.0240, 0.0081~0.0243, 0.0081~0.0240, 0.0081~0.0235, 0.0081~0.0230, 0.0081~0.0225, 0.0081~0.0220, 0.0081~ 0.0215, 0.0081~0.0210, 0.0081~0.0205, 0.0081~0.0200, 0.0081~0.0195, 0.0081~0.0190, 0.0081~0.0185, 0.0081~0.0180, 0.0081~0.0175, 0.0081~0.0170 0.0081~0.0165, 0.0081~0.0160, 0.0081~0.0155, 0.0081~0.0150, 0.0081~0.0145, 0.0081~0.0140, 0.0081~0.0135, 0.0081~0.0130, 0.0081~0.0125, 0.0081~ 0.0120, 0.0081~0.0115, 0.0081~0.0110, 0.0081~0.0105, 0.0081~0.0100, 0.0081~0.0095, 0.0081~0.0090, 0.0081~0.0085, 0.0120~0.0235 or 0.0120~0.0215.According to a preferred embodiment of the present invention, the effective dose of colchicine or its derivatives or pharmaceutically acceptable salts for humans is 0.0122~0.0203 mg / kg body weight.

[0122] In some optional embodiments, the concentration of brevidin A or its derivatives or pharmaceutically acceptable salts used is 0.2–1.0 μM. Exemplarily, the concentration of brevidin A or its derivatives or pharmaceutically acceptable salts used is 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0 μM, or a range between any two of the above values, such as: 0.2–1.0 μM, 0.2–0.9 μM, 0.2–0.8 μM, 0.2–0.7 μM, 0.2–0.6 μM, 0.2–0.5 μM, 0.2–0.4 μM, 0.2–0.3 μM, 0.3–1.0 μM, 0.3–0.9 μM, 0.3–0.8 μM, 0.3–0.7 μM, 0.3–0.6 μM, 0.3–0.5 μM. μM, 0.3~0.4 μM, 0.4~1.0 μM, 0.4~0.9 μM, 0.4~0.8 μM, 0.4~0.7 μM, 0.4~0.6 μM, 0.4~0.5 μM, 0.5~1.0 μM, 0.5~0.9 μM, 0.5~0.8 μM, 0.5~0.7 μM, 0.5~0.6 μM, 0.6~1.0 μM, 0.6~0.9 μM, 0.6~0.8 μM, 0.6~0.7 μM, 0.7~1.0 μM, 0.7~0.9 μM, 0.7~0.8 μM, 0.8~1.0 μM, 0.8~0.9 μM or 0.9~1.0 μM. In some preferred embodiments, the concentration of brefedipine A or its derivatives or pharmaceutically acceptable salts is 0.3 to 0.8 μM.

[0123] In some optional embodiments, the concentration of colchicine or its derivatives or pharmaceutically acceptable salts used is 5-20 μM. Exemplarily, the concentration of colchicine or its derivatives or pharmaceutically acceptable salts used is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 μM, or a range between any two of the above values, for example: 5-20, 5-19, 5-18, 5-17, 5-16, 5-15, 5-14, 5-13, 5-12, 5-11, 5-10, 5-9, 5-8, 5-7, 5-6, 6-20, 6-19, 6-18, 6-17, 6-16, 6-15, 6-14, 6-13, 6-12, 6-11, 6-10, 6-9, 6-8, 6-7, 7-20. 7~19, 7~18, 7~17, 7~16, 7~15, 7~14, 7~13, 7~12, 7~11, 7~10, 7~9, 7~8, 8~20, 8~19, 8~18, 8~17, 8~16, 8~15, 8~14, 8~13, 8~12, 8~11, 8~10, 8~9, 9~20, 9~19, 9~18, 9~17, 9~16, 9~15, 9~14, 9~13, 9~12, 9~ 11, 9~10, 10~20, 10~19, 10~18, 10~17, 10~16, 10~15, 10~14, 10~13, 10~12, 10~11, 11~20, 11~19, 11~18, 11~17, 11~16, 11~15, 11~14, 11~13, 11~12, 12~20, 12~19, 12~18, 12~17, 12~16, 12~15, 12~14, 1 2~13, 13~20, 13~19, 13~18, 13~17, 13~16, 13~15, 13~14, 14~20, 14~19, 14~18, 14~17, 14~16, 14~15, 15~20, 15~19, 15~18, 15~17, 15~16, 16~20, 16~19, 16~18, 16~17, 17~20, 17~19, 17~18, 18~20, 18~19 μM or 19~20 μM. In some preferred embodiments, the concentration of colchicine or its derivatives or pharmaceutically acceptable salts used is 8~15 μM.

[0124] In some alternative embodiments, the associated diseases caused by the flavivirus infection include at least one of the following: miscarriage, embryonic and / or fetal malformation, embryonic and / or fetal developmental disorders.

[0125] In some alternative embodiments, the associated diseases caused by the flavivirus infection include at least one of the following: miscarriage, microcephaly, developmental delay, intellectual disability, hearing loss, visual impairment, joint contractures, and congenital Zika syndrome.

[0126] In some alternative embodiments, the derivatives include tautomers, mesosomes, racemates, enantiomers, diastereomers, nitrides, or hydrates.

[0127] In some alternative embodiments, the pharmaceutically acceptable salt includes one or more of the following: hydrochloride, p-toluenesulfonate, sodium salt, methanesulfonate, sulfate, succinate, maleate, fumarate, acetate, phosphate, citrate, hydrobromide, benzoate, benzenesulfonate, tartrate, carbonate, citrate, gluconate, lactate, malate, stearate, valerate, nitrate, calcium salt, potassium salt, zinc salt, and meglumine salt.

[0128] In some alternative embodiments, the drug is administered in one or more of the following forms: injection, capsule, tablet, pill, liquid, powder, granule, fine granule, film-coated, pill, lozenge, sublingual, gel, sublingual preparation, paste, syrup, suspension, elixir, emulsion, coating, ointment, plaster, mud, transdermal preparation, lotion, inhaler, aerosol, and suppository.

[0129] Drugs, single-dose formulations In an embodiment of the present invention, a medicament is proposed comprising a compound or a derivative thereof or a pharmaceutically acceptable salt thereof, wherein the compound comprises a transcytosis pathway inhibitor. As previously described, the transcytosis pathway inhibitor can effectively inhibit the viral transcytosis pathway, thereby inhibiting viral invasion. The transcytosis pathway inhibitor proposed in this invention can inhibit the vertical transmission of viruses from the mother to the early embryo and / or fetus, and specifically reduce the viral load in the unborn fetus and pre-fetal embryo, prevent and / or treat developmental disorders and malformations in the fetus or embryo, and reduce the probability of miscarriage, especially against flaviviruses. Therefore, a medicament comprising the transcytosis pathway inhibitor or its derivative thereof or a salt thereof also possesses the above-mentioned effects.

[0130] According to embodiments of the present invention, the drug further includes at least one of the following additional technical features: In some alternative embodiments, the compound comprises at least one of the following: brefidobacterium A, colchicine, chlorpromazine, nystatin, amiloride, pembrolizumin III, methyl-β-cyclodextrin, flubendiazole, itraconazole, vinblastine, imidazole, genistein, chloroquine, hydroxychloroquine, and nocodazole.

[0131] In some preferred embodiments, the compound comprises at least one of the following: brevidin A, colchicine, chlorpromazine, or nystatin. Based on verification of this invention, brevidin A, colchicine, chlorpromazine, and nystatin, or their respective derivatives or pharmaceutically acceptable salts, can inhibit vertical transmission of viruses from the mother to the early embryo and / or fetus, specifically reducing viral load in the unborn fetus and pre-fetal embryo, preventing and / or treating developmental disorders and malformations in the fetus or embryo, and reducing the probability of miscarriage.

[0132] In some specific embodiments, the compound is preferably at least one of the following: brevidin A or colchicine. This application has unexpectedly discovered that, compared to other virus-targeting transcytosis inhibitors, brevidin A and colchicine, or their respective salts, are more effective at inhibiting vertical transmission of the virus from the mother to the early embryo and / or fetus, and can more significantly and specifically reduce viral load in the unborn fetus and pre-fetal embryo, thus preventing and / or treating developmental disorders and malformations in the fetus or embryo, and reducing the probability of miscarriage.

[0133] In some alternative embodiments, the drug is used to inhibit and / or block the transmission of flaviviruses from the mother to the embryo and / or fetus.

[0134] In some alternative embodiments, the drug is used to prevent and / or treat flavivirus infection in embryos and / or fetuses, as well as related diseases caused by flavivirus infection.

[0135] In some optional embodiments, the drug is used to reduce the flavivirus content in the embryo and / or fetus. An unexpected discovery of this invention is that, although the drug cannot directly reduce the flavivirus load in the mother, it can significantly inhibit the vertical transmission of flavivirus from the mother to the early embryo and / or fetus, effectively reducing the flavivirus content in the embryo and / or fetus. In some specific embodiments, the drug is used to reduce the flavivirus content (and / or copy number) in the embryo and / or fetus by 60% to 90%.

[0136] In some alternative embodiments, the effective dose of brevidin A or its derivatives or pharmaceutically acceptable salts is 0.81 to 1.63 mg / kg body weight. Exemplarily, the effective dose of brevidin A or its derivatives or pharmaceutically acceptable salts in humans is 0.81, 0.85, 0.90, 0.95, 1.00, 1.05, 1.10, 1.15, 1.20, 1.25, 1.30, 1.35, 1.40, 1.45, 1.50, 1.55, 1.60, or 1.63 mg / kg body weight. mg / kg body weight, or any range of values ​​above, such as 0.81~1.60, 0.81~1.55, 0.81~1.50, 0.81~1.45, 0.81~1.40, 0.81~1.35, 0.81~1.30, 0.81~1.25, 0.81~1.20, 0.81~1.15, 0.81~1.10, 0.81~1.05, 0.81~1.00, 0.81~0.95, 0.81~0.90, 0.81~0.85, 0.85~1.63, 0.85~1.6 0, 0.85~1.55, 0.85~1.50, 0.85~1.45, 0.85~1.40, 0.85~1.35, 0.85~1.30, 0.85~1.25, 0.85~1.20, 0.85~1.15, 0.85~1.10, 0.85~1.05, 0.85~1.00, 0.85~0.95, 0.85~0.90, 0.90~1.63, 0.90~1.60, 0.90~1.55, 0.90~1.50, 0.90~1.45, 0.90~1.40, 0 0.90~1.35, 0.90~1.30, 0.90~1.25, 0.90~1.20, 0.90~1.15, 0.90~1.10, 0.90~1.05, 0.90~1.00, 0.90~0.95, 0.95~1.63, 0.95~1.60, 0.95~1.55, 0.95~1.50, 0.95~1.45, 0.95~1.40, 0.95~1.35, 0.95~1.30, 0.95~1.25, 0.95~1.20, 0.95~1.15, 0.95 ~1.10, 0.95~1.05, 0.95~1.00, 1.00~1.63, 1.00~1.60, 1.00~1.55, 1.00~1.50, 1.00~1.45, 1.00~1.40, 1.00~1.35, 1.00~1.30, 1.00~1.25, 1.00~1.20, 1.00~1.15, 1.00~1.10, 1.00~1.05, 1.05~1.63, 1.05~1.60, 1.05~1.55, 1.05~1.50, 1.05~1.45, 1.05~1.40, 1.05~1.35, 1.05~1.30, 1.05~1.25, 1.05~1.20, 1.05~1.15, 1.05~1.10, 1.10~1.63, 1.10~1.60, 1.10~1.55, 1.10~1.50, 1.10~1.45, 1.10~1.40, 1.10~1.35, 1.10~1.30, 1.10~1.25, 1.10~1.20, 1.10~1.15 1.15~1.63, 1.15~1.60, 1.15~1.55, 1.15~1.50, 1.15~1.45, 1.15~1.40, 1.15~1.35, 1.15~1.30, 1.15~1.25, 1.15~1.20, 1.20~1.63, 1.20~1.60, 1.20~1.55, 1.20~1.50, 1.20~1.45, 1.20~1.40, 1.20~1.35, 1.20~1.30, 1.2 0~1.25, 1.25~1.63, 1.25~1.60, 1.25~1.55, 1.25~1.50, 1.25~1.45, 1.25~1.40, 1.25~1.35, 1.25~1.30, 1.30~1.63, 1.30~1.60, 1.30~1.55, 1.30~1.50, 1.30~1.45, 1.30~1.40, 1.30~1.35, 1.35~1.63, 1.35~1.60, 1.35~1 0.55, 1.35~1.50, 1.35~1.45, 1.35~1.40, 1.40~1.63, 1.40~1.60, 1.40~1.55, 1.40~1.50, 1.40~1.45, 1.45~1.63, 1.45~1.60, 1.45~1.55, 1.45~1.50, 1.50~1.63, 1.50~1.60, 1.50~1.55, 1.55~1.63, 1.55~1.60 or 1.60~1.63 mg / kg body weight. According to a preferred embodiment of the invention, the effective dose of brevidin A or its derivatives or pharmaceutically acceptable salts for humans is 0.98~1.46 mg / kg body weight.

[0137] In some optional embodiments, the effective dose of colchicine or its derivatives or pharmaceutically acceptable salts is 0.0081~0.0243 mg / kg body weight. For example, the effective doses of colchicine or its derivatives or pharmaceutically acceptable salts in humans are 0.0081, 0.0085, 0.0090, 0.0095, 0.0100, 0.0105, 0.0110, 0.0115, 0.0120, 0.0125, 0.0130, 0.0135, 0.0140, and 0.0145 mg / kg body weight. 0.0150, 0.0155, 0.0160, 0.0165, 0.0170, 0.0175, 0.0180, 0.0185, 0.0190, 0.0195, 0.0200, 0.0205, 0.0210, 0.0215, 0.0220, 0.0225, 0.0230, 0.0235, 0.0240 or 0.0243 mg / kg body weight, or a range between any two of the above values, for example: 0.0081~0.0240, 0.0081~0.0243, 0.0081~0.0240, 0.0081~0.0235, 0.0081~0.0230, 0.0081~0.0225, 0.0081~0.0220, 0.0081~ 0.0215, 0.0081~0.0210, 0.0081~0.0205, 0.0081~0.0200, 0.0081~0.0195, 0.0081~0.0190, 0.0081~0.0185, 0.0081~0.0180, 0.0081~0.0175, 0.0081~0.0170 0.0081~0.0165, 0.0081~0.0160, 0.0081~0.0155, 0.0081~0.0150, 0.0081~0.0145, 0.0081~0.0140, 0.0081~0.0135, 0.0081~0.0130, 0.0081~0.0125, 0.0081~ 0.0120, 0.0081~0.0115, 0.0081~0.0110, 0.0081~0.0105, 0.0081~0.0100, 0.0081~0.0095, 0.0081~0.0090, 0.0081~0.0085, 0.0120~0.0235, or 0.0120~0.0215. According to a preferred embodiment of the present invention, the effective dose of colchicine or its derivatives or pharmaceutically acceptable salts for humans is 0.0122~0.0203 mg / kg body weight.

[0138] As previously stated, the effective doses of brefedipine A or its derivatives or pharmaceutically acceptable salts, and colchicine or its derivatives or pharmaceutically acceptable salts, are human effective doses converted from mouse effective doses, specifically using the body surface area reduction method.

[0139] In some optional embodiments, the concentration of brevidin A or its derivatives or pharmaceutically acceptable salts used is 0.2 to 1.0 μM. Exemplarily, the concentration of brevidin A or its derivatives or pharmaceutically acceptable salts used is 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0 μM, or a range between any two of the above values, such as: 0.2 to 1.0, 0.2 to 0.9, 0.2 to 0.8, 0.2 to 0.7, 0.2 to 0.6, 0.2 to 0.5, 0.2 to 0.4, 0.2 to 0.3, 0.3 to 1.0, 0.3 to 0.9, 0.3 to 0.8, 0.3 to 0.7, 0.3 to 0.6, 0.3 to 0.5, 0.3 to 0.4, 0.4 to 1.0. 0.4~0.9, 0.4~0.8, 0.4~0.7, 0.4~0.6, 0.4~0.5, 0.5~1.0, 0.5~0.9, 0.5~0.8, 0.5~0.7, 0.5~0.6, 0.6~1.0, 0.6~0.9, 0.6~0.8, 0.6~0.7, 0.7~1.0, 0.7~0.9, 0.7~0.8, 0.8~1.0, 0.8~0.9 μM or 0.9~1.0 μM. In some preferred embodiments, the concentration of brevidin A or its derivatives or pharmaceutically acceptable salts is 0.3~0.8 μM.

[0140] In some optional embodiments, the concentration of colchicine or its derivatives or pharmaceutically acceptable salts used is 5-20 μM. Exemplarily, the concentration of colchicine or its derivatives or pharmaceutically acceptable salts used is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 μM, or a range between any two of the above values, for example: 5-20, 5-19, 5-18, 5-17, 5-16, 5-15, 5-14, 5-13, 5-12, 5-11, 5-10, 5-9, 5-8, 5-7, 5-6, 6-20, 6-19, 6-18, 6-17, 6-16, 6-15, 6-14, 6-13, 6-12, 6-11, 6-10, 6-9, 6-8, 6-7, 7-20. 7~19, 7~18, 7~17, 7~16, 7~15, 7~14, 7~13, 7~12, 7~11, 7~10, 7~9, 7~8, 8~20, 8~19, 8~18, 8~17, 8~16, 8~15, 8~14, 8~13, 8~12, 8~11, 8~10, 8~9, 9~20, 9~19, 9~18, 9~17, 9~16, 9~15, 9~14, 9~13, 9~12, 9~ 11, 9~10, 10~20, 10~19, 10~18, 10~17, 10~16, 10~15, 10~14, 10~13, 10~12, 10~11, 11~20, 11~19, 11~18, 11~17, 11~16, 11~15, 11~14, 11~13, 11~12, 12~20, 12~19, 12~18, 12~17, 12~16, 12~15, 12~14, 1 2~13, 13~20, 13~19, 13~18, 13~17, 13~16, 13~15, 13~14, 14~20, 14~19, 14~18, 14~17, 14~16, 14~15, 15~20, 15~19, 15~18, 15~17, 15~16, 16~20, 16~19, 16~18, 16~17, 17~20, 17~19, 17~18, 18~20, 18~19 μM or 19~20 μM. In some preferred embodiments, the concentration of colchicine or its derivatives or pharmaceutically acceptable salts used is 8~15 μM.

[0141] In some alternative embodiments, the associated diseases caused by the flavivirus infection include at least one of the following: miscarriage, embryonic and / or fetal malformation, embryonic and / or fetal developmental disorders.

[0142] In some alternative embodiments, the associated diseases caused by the flavivirus infection include at least one of the following: miscarriage, microcephaly, developmental delay, intellectual disability, hearing loss, visual impairment, joint contractures, and congenital Zika syndrome.

[0143] In some alternative embodiments, the flavivirus includes at least one of the following: Zika virus, dengue virus, yellow fever virus, or West Nile virus. In some preferred embodiments, the virus is Zika virus.

[0144] In some alternative embodiments, the derivatives include tautomers, mesosomes, racemates, enantiomers, diastereomers, nitrides, or hydrates.

[0145] In some alternative embodiments, the pharmaceutically acceptable salt includes one or more of the following: hydrochloride, p-toluenesulfonate, sodium salt, methanesulfonate, sulfate, succinate, maleate, fumarate, acetate, phosphate, citrate, hydrobromide, benzoate, benzenesulfonate, tartrate, carbonate, citrate, gluconate, lactate, malate, stearate, valerate, nitrate, calcium salt, potassium salt, zinc salt, and meglumine salt.

[0146] In an optional embodiment, the drug may further include one or more active pharmaceutical ingredients with other therapeutic effects, such as one or a combination of targeted therapeutic agents, cell therapeutic agents, gene therapeutic agents, hormone therapeutic agents, antiviral agents, antibiotics, analgesics, antioxidants and metal chelators.

[0147] In some alternative embodiments, the drug may further include a pharmaceutically acceptable carrier and / or excipient.

[0148] In some alternative embodiments, the drug is administered in one or more of the following forms: injection, capsule, tablet, pill, liquid, powder, granule, fine granule, film-coated, pill, lozenge, sublingual, gel, sublingual preparation, paste, syrup, suspension, elixir, emulsion, coating, ointment, plaster, mud, transdermal preparation, lotion, inhaler, aerosol, and suppository. Those skilled in the art will understand that the compound or its pharmaceutically acceptable salt, or the dosage form of the drug, is not particularly limited, and those skilled in the art can choose a suitable dosage form according to specific needs.

[0149] In an embodiment of the present invention, a single-dose formulation is proposed, comprising a compound or its derivative or a pharmaceutically acceptable salt thereof, wherein the compound comprises a transcytosis pathway inhibitor. Experimental verification according to this application shows that the transcytosis pathway inhibitor can effectively block and / or inhibit the vertical transmission of flavivirus from the mother to the embryo and / or fetus, specifically reducing the flavivirus load in the unborn fetus and pre-fetal embryo, preventing and / or treating developmental disorders and malformations in the fetus or embryo, and reducing the probability of miscarriage. Therefore, a single-dose formulation containing the transcytosis pathway inhibitor or its derivative or a pharmaceutically acceptable salt thereof also possesses the above-mentioned effects, and the single-dose formulation is more convenient to use.

[0150] In some alternative embodiments, the compound comprises at least one of the following: brefidobacterium A, colchicine, chlorpromazine, nystatin, amiloride, pembrolizumin III, methyl-β-cyclodextrin, flubendiazole, itraconazole, vinblastine, imidazole, genistein, chloroquine, hydroxychloroquine, and nocodazole.

[0151] In some alternative embodiments, the compound comprises at least one of the following: brevidin A, colchicine, chlorpromazine, or nystatin. Based on verification of this invention, brevidin A, colchicine, chlorpromazine, and nystatin, or their respective derivatives or pharmaceutically acceptable salts, can specifically reduce the flavivirus load in unborn fetuses and pre-fetal embryos, prevent and / or treat fetal or embryonic developmental disorders and malformations, and reduce the probability of miscarriage.

[0152] In some specific embodiments, the compound is preferably at least one of the following: brevidin A or colchicine. This application has unexpectedly discovered that, compared to other virus-targeting transcytosis inhibitors, brevidin A and colchicine, or their respective salts, can specifically reduce the flavivirus load in unborn fetuses and pre-fetal embryos, preventing and / or treating fetal or embryonic developmental disorders and malformations, and reducing the probability of miscarriage.

[0153] In some alternative embodiments, the single-dose formulation comprises 30-165 mg of brevidin A or a derivative thereof or a pharmaceutically acceptable salt thereof. Exemplarily, the single-dose formulation comprises 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, or 165 mg. mg brefidobacterium A or its derivatives or pharmaceutically acceptable salts thereof, or any range between any two of the above values, for example: 30~165, 30~160, 30~150, 30~140, 30~130, 30~120, 30~110, 30~100, 30~90, 30~80, 30~70, 30~60, 30~50, 30~40, 40~165, 40~160, 40~150, 40~140, 40~130, 40~120, 40~110, 40~100, 40~ 90, 40~80, 40~70, 40~60, 40~50, 50~165, 50~160, 50~150, 50~140, 50~130, 50~120, 50~110, 50~100, 50~90, 50~80, 50~70, 50~60, 60~165, 60~160, 60~150, 60~140, 60~130, 60~120, 60~110, 60~100, 60~90, 60~80, 60~70, 70~165, 70~160, 70 ~150, 70~140, 70~130, 70~120, 70~110, 70~100, 70~90, 70~80, 80~165, 80~160, 80~150, 80~140, 80~130, 80~120, 80~110, 80~100, 80~90, 90~165, 90~160, 90~150, 90~140, 90~130, 90~120, 90~110, 90~100, 100~165, 100~160, 100~150, 100 ~140, 100~130, 100~120, 100~110, 110~165, 110~160, 110~150, 110~140, 110~130, 110~120, 120~165, 120~160, 120~150, 120~140, 120~130, 130~165, 130~160, 130~150, 130~140, 140~165, 140~160, 140~150, 150~165, 150~160 or 160~165. According to a preferred embodiment of the invention, the single-dose formulation comprises 35~150 mg of brevidin A or a derivative thereof or a pharmaceutically acceptable salt thereof.

[0154] In some optional embodiments, the single-dose formulation comprises 0.3200–2.450 mg of colchicine or its derivatives or pharmaceutically acceptable salts thereof. Exemplarily, the single-dose formulation comprises 0.32, 0.50, 0.70, 0.80, 1.0, 1.2, 1.4, 1.6, 1.8, 2.0, 2.2, 2.4, or 2.45 mg of colchicine or its derivatives or pharmaceutically acceptable salts thereof, or a range between any two of the above values, such as: 0.32–2.45, 0.32–2.4, 0.32–2.2, 0.32–2.0, 0.32–1.8, 0.32–1.6, 0.32–1.4, 0.32–1… 0.2, 0.32~1.0, 0.32~0.8, 0.32~0.7, 0.32~0.5, 0.50~2.45, 0.50~2.4, 0.50~2.2, 0.50~2.0, 0.50~1.8, 0.50~1.6, 0.50~1.4, 0.50~1.2, 0.50~1.0, 0.50~0.8, 0.50~0.7, 0.70~2.45, 0.70~2.4, 0.70~2.2, 0.70~2.0, 0.70~1.8, 0.70~1.6, 0.70~1.4 0.70~1.2, 0.70~1.0, 0.70~0.8, 0.80~2.45, 0.80~2.4, 0.80~2.2, 0.80~2.0, 0.80~1.8, 0.80~1.6, 0.80~1.4, 0.80~1.2, 0.80~1.0, 1.0~2.45, 1.0~2.4, 1.0~2.2, 1.0~2.0, 1.0~1.8, 1.0~1.6, 1.0~1.4, 1.0~1.2, 1.2~2.45, 1.2~2.4, 1.2~2.2, 1.2 ~2.0, 1.2~1.8, 1.2~1.6, 1.2~1.4, 1.4~2.45, 1.4~2.4, 1.4~2.2, 1.4~2.0, 1.4~1.8, 1.4~1.6, 1.6~2.45, 1.6~2.4, 1.6~2.2, 1.6~2.0, 1.6~1.8, 1.8~2.45, 1.8~2.4, 1.8~2.2, 1.8~2.0, 2.0~2.45, 2.0~2.4, 2.0~2.2, 2.2~2.45, 2.2~2.4, 2.4~2.45. According to a preferred embodiment of the present invention, the single dosage form comprises 0.480~2.10 mg of colchicine or its derivatives or pharmaceutically acceptable salts thereof.

[0155] It should be noted that the above-mentioned single-dose formulation can be used once, twice, three times, or four times daily, preferably once. Based on the conversion between mouse and human dosages, this dosage conversion effectively protects unborn human embryos and / or fetuses from or alleviates Zika virus infection. Those skilled in the art will understand that the specifications of the single-dose formulation are not particularly limited. For example, the specifications of the single-dose formulation can be set according to the characteristics of different target populations, such as according to the weight of the target population, such as 40kg, 60kg, 70kg, 80kg, 90kg, 100kg, etc.

[0156] In some alternative implementations, the single-dose formulation is used to inhibit and / or block the transmission of flaviviruses from the mother to the embryo and / or fetus.

[0157] In some alternative implementations, the single-dose formulation is used for the prevention and / or treatment of flavivirus infection in embryos and / or fetuses, as well as related diseases caused by flavivirus infection.

[0158] In some alternative embodiments, the single-dose formulation is used to reduce the flavivirus content in the embryo and / or fetus. An unexpected discovery of this invention is that while the aforementioned single-dose formulation cannot directly reduce the flavivirus load in the mother, it can significantly inhibit the vertical transmission of flavivirus from the mother to the early embryo and / or fetus, effectively reducing the flavivirus content in the embryo and / or fetus.

[0159] In some specific implementations, the single-dose formulation is used to reduce the content of flavivirus in embryos and / or fetuses by 60% to 90%.

[0160] In some alternative embodiments, the derivatives include tautomers, mesosomes, racemates, enantiomers, diastereomers, nitrides, or hydrates.

[0161] In some alternative embodiments, the pharmaceutically acceptable salt includes one or more of the following: hydrochloride, p-toluenesulfonate, sodium salt, methanesulfonate, sulfate, succinate, maleate, fumarate, acetate, phosphate, citrate, hydrobromide, benzoate, benzenesulfonate, tartrate, carbonate, citrate, gluconate, lactate, malate, stearate, valerate, nitrate, calcium salt, potassium salt, zinc salt, and meglumine salt.

[0162] It should be noted that, in this application, "single-dosage form" refers to a dosage form in which one preparation is used up in a single dose. In some optional embodiments, the dosage form of the single-dosage form is not particularly limited, and the single-dosage form can be an injection, capsule, tablet, pill, liquid, powder, granule, fine granule, film-coated preparation, pill, lozenge, sublingual tablet, gel, sublingual preparation, paste, syrup, suspension, elixir, emulsion, coating agent, ointment, plaster, mud, transdermal preparation, lotion, inhaler, aerosol, or suppository. In some specific embodiments, the single-dosage form is an oral preparation.

[0163] method In embodiments of the present invention, a method for inhibiting and / or blocking the transmission of flavivirus from mother to embryo and / or fetus is provided, the method comprising: administering to the embryo and / or fetus and / or mother a pharmaceutically acceptable dose of a compound or a derivative thereof or a pharmaceutically acceptable salt thereof; wherein the compound comprises a transcytosis pathway inhibitor. This application has unexpectedly discovered that the transcytosis pathway inhibitor or its derivative thereof or a pharmaceutically acceptable salt thereof can effectively inhibit and / or block the transmission of flavivirus from mother to embryo and / or fetus, specifically reducing the flavivirus load in unborn fetuses and pre-fetal embryos.

[0164] According to embodiments of the present invention, the above-described method for inhibiting and / or blocking the transmission of flavivirus from mother to embryo and / or fetus may further include at least one of the following additional technical features: In some optional embodiments, the flavivirus includes at least one of the following: Zika virus, dengue virus, yellow fever virus, or West Nile virus. In some specific embodiments, the virus is Zika virus. In specific embodiments of the present invention, the above-mentioned compound exhibits superior efficacy against Zika virus.

[0165] In some alternative embodiments, the compound comprises at least one of the following: brefidobacterium A, colchicine, chlorpromazine, nystatin, amiloride, pembrolizumin III, methyl-β-cyclodextrin, flubendiazole, itraconazole, vinblastine, imidazole, genistein, chloroquine, hydroxychloroquine, and nocodazole.

[0166] In some alternative embodiments, the compound comprises at least one of the following: brevidin A, colchicine, chlorpromazine, or nystatin. Based on verification of this invention, brevidin A, colchicine, chlorpromazine, and nystatin, or their respective derivatives or pharmaceutically acceptable salts, can effectively block or inhibit the transmission of the virus from the mother to the embryo and / or fetus, specifically reducing the viral load in the unborn fetus and pre-fetal embryo.

[0167] In some specific embodiments, the compound is preferably at least one of the following: brevidin A or colchicine. This application has unexpectedly discovered that, compared to other virus-targeting transcytosis inhibitors, brevidin A and colchicine, or their respective salts, can effectively block or inhibit the transmission of flavivirus from the mother to the embryo and / or fetus, specifically reducing the flavivirus load in unborn fetuses and pre-fetal embryos.

[0168] In some alternative embodiments, the effective dose of brevidin A or its derivatives or pharmaceutically acceptable salts is 0.81 to 1.63 mg / kg body weight. Exemplarily, the effective dose of brevidin A or its derivatives or pharmaceutically acceptable salts in humans is 0.81, 0.85, 0.90, 0.95, 1.00, 1.05, 1.10, 1.15, 1.20, 1.25, 1.30, 1.35, 1.40, 1.45, 1.50, 1.55, 1.60, or 1.63 mg / kg body weight. mg / kg body weight, or any range of values ​​above, such as 0.81~1.60, 0.81~1.55, 0.81~1.50, 0.81~1.45, 0.81~1.40, 0.81~1.35, 0.81~1.30, 0.81~1.25, 0.81~1.20, 0.81~1.15, 0.81~1.10, 0.81~1.05, 0.81~1.00, 0.81~0.95, 0.81~0.90, 0.81~0.85, 0.85~1.63, 0.85~1.6 0, 0.85~1.55, 0.85~1.50, 0.85~1.45, 0.85~1.40, 0.85~1.35, 0.85~1.30, 0.85~1.25, 0.85~1.20, 0.85~1.15, 0.85~1.10, 0.85~1.05, 0.85~1.00, 0.85~0.95, 0.85~0.90, 0.90~1.63, 0.90~1.60, 0.90~1.55, 0.90~1.50, 0.90~1.45, 0.90~1.40, 0 0.90~1.35, 0.90~1.30, 0.90~1.25, 0.90~1.20, 0.90~1.15, 0.90~1.10, 0.90~1.05, 0.90~1.00, 0.90~0.95, 0.95~1.63, 0.95~1.60, 0.95~1.55, 0.95~1.50, 0.95~1.45, 0.95~1.40, 0.95~1.35, 0.95~1.30, 0.95~1.25, 0.95~1.20, 0.95~1.15, 0.95 ~1.10, 0.95~1.05, 0.95~1.00, 1.00~1.63, 1.00~1.60, 1.00~1.55, 1.00~1.50, 1.00~1.45, 1.00~1.40, 1.00~1.35, 1.00~1.30, 1.00~1.25, 1.00~1.20, 1.00~1.15, 1.00~1.10, 1.00~1.05, 1.05~1.63, 1.05~1.60, 1.05~1.55, 1.05~1.50, 1.05~1.45, 1.05~1.40, 1.05~1.35, 1.05~1.30, 1.05~1.25, 1.05~1.20, 1.05~1.15, 1.05~1.10, 1.10~1.63, 1.10~1.60, 1.10~1.55, 1.10~1.50, 1.10~1.45, 1.10~1.40, 1.10~1.35, 1.10~1.30, 1.10~1.25, 1.10~1.20, 1.10~1.15 1.15~1.63, 1.15~1.60, 1.15~1.55, 1.15~1.50, 1.15~1.45, 1.15~1.40, 1.15~1.35, 1.15~1.30, 1.15~1.25, 1.15~1.20, 1.20~1.63, 1.20~1.60, 1.20~1.55, 1.20~1.50, 1.20~1.45, 1.20~1.40, 1.20~1.35, 1.20~1.30, 1.2 0~1.25, 1.25~1.63, 1.25~1.60, 1.25~1.55, 1.25~1.50, 1.25~1.45, 1.25~1.40, 1.25~1.35, 1.25~1.30, 1.30~1.63, 1.30~1.60, 1.30~1.55, 1.30~1.50, 1.30~1.45, 1.30~1.40, 1.30~1.35, 1.35~1.63, 1.35~1.60, 1.35~1 0.55, 1.35~1.50, 1.35~1.45, 1.35~1.40, 1.40~1.63, 1.40~1.60, 1.40~1.55, 1.40~1.50, 1.40~1.45, 1.45~1.63, 1.45~1.60, 1.45~1.55, 1.45~1.50, 1.50~1.63, 1.50~1.60, 1.50~1.55, 1.55~1.63, 1.55~1.60 or 1.60~1.63 mg / kg body weight. According to a preferred embodiment of the invention, the effective dose of brevidin A or its derivatives or pharmaceutically acceptable salts for humans is 0.98~1.46 mg / kg body weight.

[0169] In some optional embodiments, the effective dose of colchicine or its derivatives or pharmaceutically acceptable salts is 0.0081~0.0243 mg / kg body weight. For example, the effective doses of colchicine or its derivatives or pharmaceutically acceptable salts in humans are 0.0081, 0.0085, 0.0090, 0.0095, 0.0100, 0.0105, 0.0110, 0.0115, 0.0120, 0.0125, 0.0130, 0.0135, 0.0140, and 0.0145 mg / kg body weight. 0.0150, 0.0155, 0.0160, 0.0165, 0.0170, 0.0175, 0.0180, 0.0185, 0.0190, 0.0195, 0.0200, 0.0205, 0.0210, 0.0215, 0.0220, 0.0225, 0.0230, 0.0235, 0.0240 or 0.0243 mg / kg body weight, or a range between any two of the above values, for example: 0.0081~0.0240, 0.0081~0.0243, 0.0081~0.0240, 0.0081~0.0235, 0.0081~0.0230, 0.0081~0.0225, 0.0081~0.0220, 0.0081~ 0.0215, 0.0081~0.0210, 0.0081~0.0205, 0.0081~0.0200, 0.0081~0.0195, 0.0081~0.0190, 0.0081~0.0185, 0.0081~0.0180, 0.0081~0.0175, 0.0081~0.0170 0.0081~0.0165, 0.0081~0.0160, 0.0081~0.0155, 0.0081~0.0150, 0.0081~0.0145, 0.0081~0.0140, 0.0081~0.0135, 0.0081~0.0130, 0.0081~0.0125, 0.0081~ 0.0120, 0.0081~0.0115, 0.0081~0.0110, 0.0081~0.0105, 0.0081~0.0100, 0.0081~0.0095, 0.0081~0.0090, 0.0081~0.0085, 0.0120~0.0235, or 0.0120~0.0215. According to a preferred embodiment of the present invention, the effective dose of colchicine or its derivatives or pharmaceutically acceptable salts for humans is 0.0122~0.0203 mg / kg body weight.

[0170] In some optional embodiments, the concentration of brevidin A or its derivatives or pharmaceutically acceptable salts used is 0.2 to 1.0 μM. Exemplarily, the concentration of brevidin A or its derivatives or pharmaceutically acceptable salts used is 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0 μM, or a range between any two of the above values, such as: 0.2 to 1.0, 0.2 to 0.9, 0.2 to 0.8, 0.2 to 0.7, 0.2 to 0.6, 0.2 to 0.5, 0.2 to 0.4, 0.2 to 0.3, 0.3 to 1.0, 0.3 to 0.9, 0.3 to 0.8, 0.3 to 0.7, 0.3 to 0.6, 0.3 to 0.5, 0.3 to 0.4, 0.4 to 1.0. 0.4~0.9, 0.4~0.8, 0.4~0.7, 0.4~0.6, 0.4~0.5, 0.5~1.0, 0.5~0.9, 0.5~0.8, 0.5~0.7, 0.5~0.6, 0.6~1.0, 0.6~0.9, 0.6~0.8, 0.6~0.7, 0.7~1.0, 0.7~0.9, 0.7~0.8, 0.8~1.0, 0.8~0.9 μM or 0.9~1.0 μM. In some preferred embodiments, the concentration of brevidin A or its derivatives or pharmaceutically acceptable salts is 0.3~0.8 μM.

[0171] In some optional embodiments, the concentration of colchicine or its derivatives or pharmaceutically acceptable salts used is 5-20 μM. Exemplarily, the concentration of colchicine or its derivatives or pharmaceutically acceptable salts used is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 μM, or a range between any two of the above values, for example: 5-20, 5-19, 5-18, 5-17, 5-16, 5-15, 5-14, 5-13, 5-12, 5-11, 5-10, 5-9, 5-8, 5-7, 5-6, 6-20, 6-19, 6-18, 6-17, 6-16, 6-15, 6-14, 6-13, 6-12, 6-11, 6-10, 6-9, 6-8, 6-7, 7-20. 7~19, 7~18, 7~17, 7~16, 7~15, 7~14, 7~13, 7~12, 7~11, 7~10, 7~9, 7~8, 8~20, 8~19, 8~18, 8~17, 8~16, 8~15, 8~14, 8~13, 8~12, 8~11, 8~10, 8~9, 9~20, 9~19, 9~18, 9~17, 9~16, 9~15, 9~14, 9~13, 9~12, 9~ 11, 9~10, 10~20, 10~19, 10~18, 10~17, 10~16, 10~15, 10~14, 10~13, 10~12, 10~11, 11~20, 11~19, 11~18, 11~17, 11~16, 11~15, 11~14, 11~13, 11~12, 12~20, 12~19, 12~18, 12~17, 12~16, 12~15, 12~14, 1 2~13, 13~20, 13~19, 13~18, 13~17, 13~16, 13~15, 13~14, 14~20, 14~19, 14~18, 14~17, 14~16, 14~15, 15~20, 15~19, 15~18, 15~17, 15~16, 16~20, 16~19, 16~18, 16~17, 17~20, 17~19, 17~18, 18~20, 18~19 μM or 19~20 μM. In some preferred embodiments, the concentration of colchicine or its derivatives or pharmaceutically acceptable salts used is 8~15 μM.

[0172] In some alternative embodiments, the derivatives include tautomers, mesosomes, racemates, enantiomers, diastereomers, nitrides, or hydrates.

[0173] In some alternative embodiments, the pharmaceutically acceptable salt includes one or more of the following: hydrochloride, p-toluenesulfonate, sodium salt, methanesulfonate, sulfate, succinate, maleate, fumarate, acetate, phosphate, citrate, hydrobromide, benzoate, benzenesulfonate, tartrate, carbonate, citrate, gluconate, lactate, malate, stearate, valerate, nitrate, calcium salt, potassium salt, zinc salt, and meglumine salt.

[0174] In embodiments of the present invention, a method for preventing and / or treating flavivirus infection in embryos and / or fetuses and related diseases caused by flavivirus infection is provided. The method comprises administering a pharmaceutically acceptable dose of a compound or its derivative or a pharmaceutically acceptable salt thereof to the embryo and / or fetus and / or its mother; wherein the compound includes a transcytosis pathway inhibitor. This application has unexpectedly discovered that while the transcytosis pathway inhibitor or its derivative or its salt cannot significantly reduce the flavivirus load in the mother, they can specifically reduce the flavivirus load in the unborn fetus and pre-fetal embryo, preventing and / or treating developmental disorders and malformations in the fetus or embryo, reducing the probability of miscarriage, and effectively ensuring pregnancy safety.

[0175] In some alternative implementations, the prevention and / or treatment are used to reduce the amount of flavivirus in the embryo and / or fetus.

[0176] In some alternative implementations, the prevention and / or treatment are used to reduce the flavivirus content in the embryo and / or fetus by 60% to 90%.

[0177] In some alternative embodiments, the flavivirus includes at least one of the following: Zika virus, dengue virus, yellow fever virus, or West Nile virus. In some specific embodiments, the virus is Zika virus. According to specific embodiments of the present invention, the compound or its derivatives or pharmaceutically acceptable salts thereof exhibit superior efficacy against Zika virus.

[0178] In some alternative embodiments, the compound comprises at least one of the following: brefidobacterium A, colchicine, chlorpromazine, nystatin, amiloride, pembrolizumin III, methyl-β-cyclodextrin, flubendiazole, itraconazole, vinblastine, imidazole, genistein, chloroquine, hydroxychloroquine, and nocodazole.

[0179] In some preferred embodiments, the compound comprises at least one of the following: brevidin A, colchicine, chlorpromazine, or nystatin. Based on verification of this invention, brevidin A, colchicine, chlorpromazine, and nystatin, or their respective derivatives or pharmaceutically acceptable salts, can specifically reduce the flavivirus load in unborn fetuses and pre-fetal embryos, prevent and / or treat fetal or embryonic developmental disorders and malformations, and reduce the probability of miscarriage.

[0180] In some preferred embodiments, the compound is preferably at least one of the following: brevidin A or colchicine. This application has unexpectedly discovered that, compared to other virus-targeting transcytosis inhibitors, brevidin A and colchicine, or their respective salts, can specifically reduce Zika virus load in unborn fetuses and pre-fetal embryos, preventing and / or treating fetal or embryonic developmental disorders and malformations, and reducing the probability of miscarriage.

[0181] In some alternative embodiments, the effective dose of brevidin A or its derivatives or pharmaceutically acceptable salts is 0.81 to 1.63 mg / kg body weight. Exemplarily, the effective dose of brevidin A or its derivatives or pharmaceutically acceptable salts in humans is 0.81, 0.85, 0.90, 0.95, 1.00, 1.05, 1.10, 1.15, 1.20, 1.25, 1.30, 1.35, 1.40, 1.45, 1.50, 1.55, 1.60, or 1.63 mg / kg body weight. mg / kg body weight, or any range of values ​​above, such as 0.81~1.60, 0.81~1.55, 0.81~1.50, 0.81~1.45, 0.81~1.40, 0.81~1.35, 0.81~1.30, 0.81~1.25, 0.81~1.20, 0.81~1.15, 0.81~1.10, 0.81~1.05, 0.81~1.00, 0.81~0.95, 0.81~0.90, 0.81~0.85, 0.85~1.63, 0.85~1.6 0, 0.85~1.55, 0.85~1.50, 0.85~1.45, 0.85~1.40, 0.85~1.35, 0.85~1.30, 0.85~1.25, 0.85~1.20, 0.85~1.15, 0.85~1.10, 0.85~1.05, 0.85~1.00, 0.85~0.95, 0.85~0.90, 0.90~1.63, 0.90~1.60, 0.90~1.55, 0.90~1.50, 0.90~1.45, 0.90~1.40, 0 0.90~1.35, 0.90~1.30, 0.90~1.25, 0.90~1.20, 0.90~1.15, 0.90~1.10, 0.90~1.05, 0.90~1.00, 0.90~0.95, 0.95~1.63, 0.95~1.60, 0.95~1.55, 0.95~1.50, 0.95~1.45, 0.95~1.40, 0.95~1.35, 0.95~1.30, 0.95~1.25, 0.95~1.20, 0.95~1.15, 0.95 ~1.10, 0.95~1.05, 0.95~1.00, 1.00~1.63, 1.00~1.60, 1.00~1.55, 1.00~1.50, 1.00~1.45, 1.00~1.40, 1.00~1.35, 1.00~1.30, 1.00~1.25, 1.00~1.20, 1.00~1.15, 1.00~1.10, 1.00~1.05, 1.05~1.63, 1.05~1.60, 1.05~1.55, 1.05~1.50, 1.05~1.45, 1.05~1.40, 1.05~1.35, 1.05~1.30, 1.05~1.25, 1.05~1.20, 1.05~1.15, 1.05~1.10, 1.10~1.63, 1.10~1.60, 1.10~1.55, 1.10~1.50, 1.10~1.45, 1.10~1.40, 1.10~1.35, 1.10~1.30, 1.10~1.25, 1.10~1.20, 1.10~1.15 1.15~1.63, 1.15~1.60, 1.15~1.55, 1.15~1.50, 1.15~1.45, 1.15~1.40, 1.15~1.35, 1.15~1.30, 1.15~1.25, 1.15~1.20, 1.20~1.63, 1.20~1.60, 1.20~1.55, 1.20~1.50, 1.20~1.45, 1.20~1.40, 1.20~1.35, 1.20~1.30, 1.2 0~1.25, 1.25~1.63, 1.25~1.60, 1.25~1.55, 1.25~1.50, 1.25~1.45, 1.25~1.40, 1.25~1.35, 1.25~1.30, 1.30~1.63, 1.30~1.60, 1.30~1.55, 1.30~1.50, 1.30~1.45, 1.30~1.40, 1.30~1.35, 1.35~1.63, 1.35~1.60, 1.35~1 0.55, 1.35~1.50, 1.35~1.45, 1.35~1.40, 1.40~1.63, 1.40~1.60, 1.40~1.55, 1.40~1.50, 1.40~1.45, 1.45~1.63, 1.45~1.60, 1.45~1.55, 1.45~1.50, 1.50~1.63, 1.50~1.60, 1.50~1.55, 1.55~1.63, 1.55~1.60 or 1.60~1.63 mg / kg body weight. According to a preferred embodiment of the invention, the effective dose of brevidin A or its derivatives or pharmaceutically acceptable salts for humans is 0.98~1.46 mg / kg body weight.

[0182] In some optional embodiments, the effective dose of colchicine or its derivatives or pharmaceutically acceptable salts is 0.0081~0.0243 mg / kg body weight. For example, the effective doses of colchicine or its derivatives or pharmaceutically acceptable salts in humans are 0.0081, 0.0085, 0.0090, 0.0095, 0.0100, 0.0105, 0.0110, 0.0115, 0.0120, 0.0125, 0.0130, 0.0135, 0.0140, and 0.0145 mg / kg body weight. 0.0150, 0.0155, 0.0160, 0.0165, 0.0170, 0.0175, 0.0180, 0.0185, 0.0190, 0.0195, 0.0200, 0.0205, 0.0210, 0.0215, 0.0220, 0.0225, 0.0230, 0.0235, 0.0240 or 0.0243 mg / kg body weight, or a range between any two of the above values, for example: 0.0081~0.0240, 0.0081~0.0243, 0.0081~0.0240, 0.0081~0.0235, 0.0081~0.0230, 0.0081~0.0225, 0.0081~0.0220, 0.0081~ 0.0215, 0.0081~0.0210, 0.0081~0.0205, 0.0081~0.0200, 0.0081~0.0195, 0.0081~0.0190, 0.0081~0.0185, 0.0081~0.0180, 0.0081~0.0175, 0.0081~0.0170 0.0081~0.0165, 0.0081~0.0160, 0.0081~0.0155, 0.0081~0.0150, 0.0081~0.0145, 0.0081~0.0140, 0.0081~0.0135, 0.0081~0.0130, 0.0081~0.0125, 0.0081~ 0.0120, 0.0081~0.0115, 0.0081~0.0110, 0.0081~0.0105, 0.0081~0.0100, 0.0081~0.0095, 0.0081~0.0090, 0.0081~0.0085, 0.0120~0.0235, or 0.0120~0.0215. According to a preferred embodiment of the present invention, the effective dose of colchicine or its derivatives or pharmaceutically acceptable salts for humans is 0.0122~0.0203 mg / kg body weight.

[0183] In some optional embodiments, the concentration of brevidin A or its derivatives or pharmaceutically acceptable salts used is 0.2 to 1.0 μM. Exemplarily, the concentration of brevidin A or its derivatives or pharmaceutically acceptable salts used is 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0 μM, or a range between any two of the above values, such as: 0.2 to 1.0, 0.2 to 0.9, 0.2 to 0.8, 0.2 to 0.7, 0.2 to 0.6, 0.2 to 0.5, 0.2 to 0.4, 0.2 to 0.3, 0.3 to 1.0, 0.3 to 0.9, 0.3 to 0.8, 0.3 to 0.7, 0.3 to 0.6, 0.3 to 0.5, 0.3 to 0.4, 0.4 to 1.0, 0.4 to 0.5. 0.9, 0.4~0.8, 0.4~0.7, 0.4~0.6, 0.4~0.5, 0.5~1.0, 0.5~0.9, 0.5~0.8, 0.5~0.7, 0.5~0.6, 0.6~1.0, 0.6~0.9, 0.6~0.8, 0.6~0.7, 0.7~1.0, 0.7~0.9, 0.7~0.8, 0.8~1.0, 0.8~0.9, or 0.9~1.0 μM. In some preferred embodiments, the concentration of brevidin A or its derivatives or pharmaceutically acceptable salts is 0.3~0.8 μM.

[0184] In some optional embodiments, the colchicine or its derivatives or pharmaceutically acceptable salts are used at a concentration of 5-20 μM. Exemplarily, the concentrations of colchicine or its derivatives or pharmaceutically acceptable salts used are 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 μM. μM, or a range between any two of the above values, for example: 5~20, 5~19, 5~18, 5~17, 5~16, 5~15, 5~14, 5~13, 5~12, 5~11, 5~10, 5~9, 5~8, 5~7, 5~6, 6~20, 6~19, 6~18, 6~17, 6~16, 6~15, 6~14, 6~13, 6~12, 6~11, 6~10, 6~9, 6~8, 6~7, 7~20. 7~19, 7~18, 7~17, 7~16, 7~15, 7~14, 7~13, 7~12, 7~11, 7~10, 7~9, 7~8, 8~20, 8~19, 8~18, 8~17, 8~16, 8~15, 8~14, 8~13, 8~12, 8~11, 8~10, 8~9, 9~20, 9~19, 9~18, 9~17, 9~16, 9~15, 9~14, 9~13, 9~12, 9~11 9~10, 10~20, 10~19, 10~18, 10~17, 10~16, 10~15, 10~14, 10~13, 10~12, 10~11, 11~20, 11~19, 11~18, 11~17, 11~16, 11~15, 11~14, 11~13, 11~12, 12~20, 12~19, 12~18, 12~17, 12~16, 12~15, 12~14, 12~13 13~20, 13~19, 13~18, 13~17, 13~16, 13~15, 13~14, 14~20, 14~19, 14~18, 14~17, 14~16, 14~15, 15~20, 15~19, 15~18, 15~17, 15~16, 16~20, 16~19, 16~18, 16~17, 17~20, 17~19, 17~18, 18~20, 18~19, or 19~20 μM. In some preferred embodiments, the concentration of colchicine or its derivatives or pharmaceutically acceptable salts used is 8~15 μM.

[0185] In some alternative embodiments, the associated diseases caused by the flavivirus infection include at least one of the following: miscarriage, embryonic and / or fetal malformation, embryonic and / or fetal developmental disorders.

[0186] In some alternative embodiments, the associated diseases caused by the flavivirus infection include at least one of the following: miscarriage, microcephaly, developmental delay, intellectual disability, hearing loss, visual impairment, joint contractures, and congenital Zika syndrome.

[0187] In some alternative embodiments, the derivatives include tautomers, mesosomes, racemates, enantiomers, diastereomers, nitrides, or hydrates.

[0188] In some alternative embodiments, the pharmaceutically acceptable salt includes one or more of the following: hydrochloride, p-toluenesulfonate, sodium salt, methanesulfonate, sulfate, succinate, maleate, fumarate, acetate, phosphate, citrate, hydrobromide, benzoate, benzenesulfonate, tartrate, carbonate, citrate, gluconate, lactate, malate, stearate, valerate, nitrate, calcium salt, potassium salt, zinc salt, and meglumine salt.

[0189] Biological models and their applications In an embodiment of this invention, a pregnancy biological model is proposed, wherein the pregnancy biological model carries a flavivirus carrying a variant protein, the variant protein having a mutation at amino acid position 21 compared to the wild-type flavivirus prM protein. This invention discovers that amino acid position 21 of the flavivirus prM protein is a conserved site; mutation of this site significantly enhances the vertical transmission ability of the flavivirus and its pathogenicity to the newborn fetus. Mechanistic studies show that this mutation significantly increases the efficiency of flavivirus crossing the placental barrier via transcytosis, leading to a significant increase in viral load in the fetus of pregnant mice after viral infection, thereby causing serious consequences such as impaired embryonic and / or fetal development, miscarriage, and developmental disorders of the newborn fetus's brain. Therefore, this pregnancy biological model can effectively simulate the symptoms and developmental mechanisms of flavivirus infection in pregnant individuals, which is of great significance for the prevention and treatment of related diseases and scientific research.

[0190] According to embodiments of the present invention, the above-described biological model of pregnancy may further include at least one of the following: In some alternative embodiments, the variant protein has a mutation at amino acid E at position 21 compared to the wild-type flavivirus prM protein. According to specific embodiments of the invention, when the mutant protein has a mutation at amino acid E at position 21 compared to the wild-type flavivirus prM protein, this mutation can significantly enhance the efficiency of flavivirus crossing the placental barrier via transcytosis, resulting in a significantly increased viral load in pregnant mice after viral infection, thereby causing symptoms such as impaired embryonic development, miscarriage, and developmental disorders in newborn fetuses.

[0191] In some alternative embodiments, the variant protein has a mutation at amino acid residue E at position 21, compared to the wild-type flavivirus prM protein, to a basic amino acid. In some alternative embodiments, the variant protein has an E21K, E21R, or E21H mutation compared to the wild-type flavivirus prM protein.

[0192] In some preferred embodiments, the variant protein has an E21K mutation compared to the wild-type flavivirus prM protein. According to specific embodiments of the present invention, compared to other mutation methods, when the mutant protein has an E21K mutation compared to the wild-type flavivirus prM protein, this mutation most significantly enhances the efficiency of flavivirus crossing the placental barrier via transcytosis, leading to a significant increase in viral load in pregnant mice after viral infection, thereby causing serious consequences such as impaired embryonic development, miscarriage, and brain development disorders in newborn mice. Therefore, a pregnancy biological model with this mutation can better simulate the symptoms and developmental mechanisms of flavivirus infection in pregnant individuals. In some specific embodiments, the variant protein has the amino acid sequence shown in SEQ ID NO:3, or an amino acid sequence with at least 80% identity to it.

[0193] In some alternative embodiments, the wild-type flavivirus prM protein has the amino acid sequence shown in SEQ ID NO:2, or an amino acid sequence that is at least 80% identical to it.

[0194] In some optional embodiments, the flavivirus includes at least one selected from the following: Zika virus, dengue virus, yellow fever virus, or West Nile virus. In some specific embodiments, the virus is Zika virus. According to specific embodiments of the present invention, compared with other flaviviruses, when the virus is Zika virus, the above-mentioned mutations most significantly enhance the efficiency of Zika virus crossing the placental barrier via transcytosis. After Zika virus infection of pregnant mice, the viral load in the fetuses is significantly increased, followed by symptoms such as impaired embryonic development, miscarriage, and brain development disorders in newborn fetuses. Therefore, a pregnancy biological model carrying Zika virus with the above-mentioned mutations can better simulate the symptoms and development mechanism of Zika virus infection in pregnant individuals, and has high application value in screening clinical therapeutic drugs and scientific research.

[0195] In an embodiment of the present invention, the application of the aforementioned pregnancy biological model in drug screening is proposed, comprising: applying the drug to be screened to the pregnancy biological model, determining the target drug based on the content of the flavivirus in the pregnancy biological model before and after application, wherein the drug is used for at least one of the following: (1) inhibiting and / or blocking the transmission of flavivirus from the mother to the embryo and / or fetus; (2) preventing and / or treating viral infection of the embryo and / or fetus, and related diseases caused by flavivirus infection. As mentioned above, in the pregnancy biological model of the present invention, the viral load in the fetal rats is significantly increased, and symptoms such as impaired embryonic development, miscarriage, and brain development disorders in newborn fetal rats appear. The vertical transmission ability of the virus and its pathogenicity to the newborn fetus are enhanced, which can well simulate the symptoms and development mechanism of pregnant individuals infected with flavivirus, especially after Zika virus infection. The present invention found that the biological model can effectively screen drugs that inhibit and / or block the transmission of flavivirus from the mother to the embryo and / or fetus and reduce the viral load in the embryo and / or fetus.

[0196] According to embodiments of the present invention, the application of the above-mentioned pregnancy biological model in drug screening may further include at least one of the following additional technical features: In some optional embodiments, the pregnancy biological model is a pregnancy mammalian model. Exemplarily, the mammal can be a rat, mouse, monkey, pig, sheep, cow, dog, cat, etc., and the specific animal species are not particularly limited. The gestation period of the pregnant animal is not particularly limited, i.e., it can be from the first day of gestation to full-term delivery. In a specific embodiment of the present invention, the animal is a pregnant female mouse, which is inoculated with 5 × 10⁵ g of 5 g of 5 g of 5 g of 10 ... 4 PFU carrying the aforementioned variant protein flavivirus, specifically, the inoculated virus is Zika virus.

[0197] In some alternative embodiments, the target drug is one in which, after administration, the content (and / or copy number) of the flavivirus in the embryonic and / or fetal samples of the pregnancy biomodel is significantly lower than that of the drug before administration.

[0198] In some alternative embodiments, the embryonic and / or fetal sample includes at least one of the following: bodily fluids, tissues, or cells. It should be noted that the bodily fluids, tissues, or cells are derived from the embryo and / or fetus. In some specific embodiments, the sample used is tissue.

[0199] The amino acid or nucleotide sequences involved in this invention are shown in Table 1.

[0200] Table 1

[0201] The following will explain the solution of this application with reference to embodiments. Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be considered as limiting the scope of this application. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0202] Example 1: Detection of the efficiency and mechanism of prM-E21K mutant Zika virus crossing the placental barrier 1.1 Detection of the efficiency of prM-E21K mutant Zika virus in crossing the placental barrier In this embodiment, glutamic acid at amino acid position 21 of the prM protein of the Asian Zika virus strain FSS13025 was replaced with lysine (SEQ ID NO: 1, prM-E21K, where lysine is a conserved amino acid at this site in African Zika virus strains). To evaluate the effect of the prM-E21K amino acid substitution on Zika virus crossing the placental barrier, this embodiment established... Figure 1 The in vitro placental barrier model based on Transwell chambers is shown. The specific steps are as follows: The day before infection, 2×10 5 10 Vero cells (purchased from ATCC) were seeded into 24-well plates, and 2 × 10⁶ cells were added. 5JEG-3 placental trophoblast cells (purchased from Wuhan Pronosei Life Sciences Co., Ltd.) were seeded in Transwell chambers. Vero and JEG-3 cells were cultured in DMEM and MEM culture media respectively at 37°C in an incubator containing 5% CO2. The next day, the upper layer of the Transwell medium was replaced with DMEM, and wild-type Zika virus Asian strain FSS13025 (FSS-WT group) or Zika virus with prM-E21K mutation (FSS-E21K group) was added for cell infection at MOI=1. During infection, the Transwell chambers were transferred to 24-well plates pre-seeded with Vero cells. Twenty-four hours after infection, the lower layer of culture medium in the Transwell chamber was collected, and the viral RNA copy number was detected by quantitative real-time PCR using the Takara One-Step TB Green PrimeScript™ RT-PCR Kit II. The forward primer sequence for qPCR was CATGGTAGCAGTGGGTCTTC (SEQ ID NO:4); the reverse primer sequence was CTCCTCTCTCCTTCCCATTAGA (SEQ ID NO:5). Specific experimental procedures were performed according to the kit's instructions. Furthermore, to rule out the possibility that viruses carrying the prM-E21K mutation might promote viral crossing by increasing cell permeability, 1 mg / mL of FITC-labeled dextran was added to the upper layer of the Transwell chamber 24 hours after infection. One hour later, the fluorescence intensity in the lower layer of culture medium in the Transwell chamber was measured (excitation wavelength 492 nm, emission wavelength 518 nm) to assess changes in placental barrier cell permeability. This experiment also included an uninfected group (Mock, without virus, other procedures the same as the experimental group).

[0203] Figure 2 In this context, LOD stands for limit of detection. The virus was obtained by performing the above qPCR on the cell supernatant of the uninfected group to demonstrate the detection sensitivity of the qPCR method. The results showed that the viral copy number (Viral RNA (Log copies)) in the lower culture medium of the FSS-E21K group was significantly higher than that of the FSS-WT group, indicating that the prM-E21K mutation significantly enhanced the ability of Zika virus to cross the placental barrier.

[0204] Figure 3The results showed that although the fluorescence intensity of the virus-infected FSS-WT or FSS-E21K groups was higher than that of the uninfected group (Mock), indicating that the cell permeability was higher in both groups, there was no significant difference between the FSS-WT and FSS-E21K groups. This suggests that the prM-E21K mutation promotes viral crossing of the placental barrier without being dependent on changes in cell permeability.

[0205] 1.2 Detection of the mechanism by which prM-E21K mutant Zika virus crosses the placental barrier Zika virus can cross the placental barrier through two mechanisms: bypass pathway and transcytosis. To distinguish between these two pathways, the following experiments were conducted in this embodiment: The day before infection, 2×10 5 Vero cells and JEG-3 cells were seeded in 24-well plates and Transwell chambers, respectively, and cultured in DMEM and MEM complete medium (purchased from Thermo) at 37°C in a 5% CO2 incubator. The next day, the upper layer of the Transwell medium was replaced with DMEM, and the aforementioned FSS-WT or FSS-E21K virus was added for infection (MOI=1). During infection, the Transwell chambers were transferred to 24-well plates pre-seeded with Vero cells and incubated at 37°C or 4°C for 3 hours (at 4°C, Zika virus cannot cross cells via transcytosis). Subsequently, the viral RNA in the lower layer was quantified using the aforementioned qPCR method.

[0206] Figure 4 The results showed that at 4℃ (where transcytosis is inhibited), there was no difference in the amount of viral RNA (copy number / ml) between the two groups, indicating that the mutation did not affect viral translocation via the cellular bypass pathway; while Figure 5 The results showed that, at 37°C, the amount of viral RNA (copy number / ml) in the lower layer of the FSS-E21K group was significantly higher than that in the FSS-WT group. In summary, the prM-E21K mutation specifically enhances the efficiency of Zika virus crossing the placental barrier via transcytosis.

[0207] Example 2: Screening of Zika virus crossing the placental barrier inhibitors 2.1 Effects of inhibitors on Zika virus crossing the placental barrier This embodiment uses the Transwell chamber in vitro placental barrier model constructed in Example 1 to evaluate the effects of a series of inhibitors targeting transcytosis on Zika virus crossing the placental barrier. The specific operational steps are as follows: The day before the experiment, 2×10 5Vero and JEG-3 cells were seeded in 24-well plates and Transwell chambers, respectively, and DMEM and MEM complete medium (purchased from Thermo) were added. The cells were then cultured in a 37°C incubator containing 5% CO2. The following day, compounds targeting transcytosis were added to the upper and lower layers of the Transwell chamber medium: 0.5 μM Brefeldin A, 10 μM Chlorpromazine, 10 μM Colchicine, or 10 μM Nystatin, respectively, for 1 h. A 0.1% DMSO treatment was used as a control. After treatment, the upper layer of the Transwell medium was removed, the cells were washed three times with PBS, and replaced with DMEM medium. Subsequently, wild-type Zika virus Asian strain FSS13025 (FSS-WT group) or Zika virus with the prM-E21K mutation (FSS-E21K group) were added at an MOI of 1 for cell infection. During infection, Transwell chambers were transferred to 24-well plates pre-coated with Vero cells. Twenty-four hours after infection, the lower culture medium was collected, and viral RNA copy number was detected by quantitative real-time PCR.

[0208] Figure 6 The results showed that, compared with the DMSO control group, treatments with brevidin A, chlorpromazine, colchicine, and nystatin significantly reduced the efficiency of Zika virus crossing the placental barrier. Among them, brevidin A and colchicine showed the most significant inhibitory effects on the crossing of FSS-WT and FSS-E21K viruses, reducing viral RNA copy numbers by approximately 60% and 90%, respectively.

[0209] 2.2 Cytotoxicity assay of the inhibitor This embodiment also tested the cytotoxicity of each compound under the above experimental conditions. The specific procedures are as follows: JEG-3 cells were loaded at a rate of 1×10 4 Cells were seeded into 96-well plates and incubated in MEM complete medium (Thermo) at 37°C with 5% CO2. The following day, the cells were treated with 0.5 μM brefidobacterium A, 10 μM chlorpromazine, 10 μM colchicine, or 10 μM nystatin for 1 hour, respectively. The solvent for each compound was DMSO. After treatment, the cells were washed with PBS and the medium was replaced with fresh medium for 24 hours. Cell viability was then assessed using a CCK-8 assay kit (Beyotime), following the kit's instructions for specific assay methods.

[0210] Figure 7The results showed that none of the above compounds exhibited significant cytotoxicity under the experimental conditions.

[0211] Example 3: Effects of brefildacin A and colchicine on vertical transmission of Zika virus in a mouse pregnancy model To further verify the inhibitory effects of brevidin A and colchicine on the vertical transmission of Zika virus, this example established a pregnancy infection model using A129 transgenic mice with type I interferon receptor deficiency (purchased from the Pasteur Institute of the Chinese Academy of Sciences), and detected the vertical transmission of the virus. The specific procedures are as follows: Thirty-two female and sixteen male A129 mice aged 8–10 weeks were housed together. The day a vaginal plug was detected was designated as day 0.5 of gestation (E0.5). On day E6.5, mice were injected with 5 × 10⁸ g of vaginal plug via footpad injection. 4 Zika virus (PFU) FSS-E21K was administered intraperitoneally daily from days E5.5 to E12.5, consisting of 0.3 ml / kg body weight of DMSO solvent, 15 mg / kg body weight of brefildacin A, or 0.2 mg / kg body weight of colchicine. Both brefildacin A and colchicine were dissolved in DMSO at a concentration of 50 mg / mL. Plasma from pregnant mice was collected daily from days 1 to 5 post-infection, and viremia was detected using a plaque assay, a procedure that is standard in the field and will not be described in detail here. Finally, on day E13.5, pregnant mice were dissected, and the morphology and structure of the uterus, placenta, and fetus were systematically observed. The abortion rate was calculated, and the viral RNA load in the placenta and fetal tissues was detected using the previously described qPCR method.

[0212] Figure 8 , 9 The results showed that, compared with the DMSO control group, brefiltrant A or colchicine treatment significantly alleviated uterine and placental and fetal developmental abnormalities caused by viral infection, increased fetal weight, and effectively reduced the incidence of miscarriage. Figure 10 (Mortality), it should be noted that uterine morphological abnormalities mainly depend on the developmental morphology of the fetus. Meanwhile, Figure 11 The results showed that both compounds significantly reduced viral load in fetal mice, with mean viral RNA (Log 10 copies / mg) copy numbers decreasing by approximately 50-fold and 20-fold, respectively. Surprisingly, Figure 12 , 13The results showed that treatment with brevidin A or colchicine had no significant effect on the viral titer (Log10 PFU / ml plasma) in the plasma of pregnant mice after infection, or on the viral RNA copy number in the placenta. This demonstrated that brevidin A and colchicine had no significant effect on maternal viremia or placental viral load in pregnant mice, but they could specifically block Zika virus from crossing the placenta and infecting fetal mice.

[0213] Therefore, the above results indicate that brefildacin A and colchicine can effectively block vertical transmission of Zika virus in vivo and improve pregnancy outcomes, suggesting their potential as candidate drugs for combating vertical transmission of Zika virus.

[0214] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., refer to specific features, structures, materials, or characteristics described in connection with that embodiment or example, which are included in at least one embodiment or example of this application. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0215] Although embodiments of this application have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting this application. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of this application.

Claims

1. Use of a compound or a pharmaceutically acceptable salt thereof in the preparation of a medicament for inhibiting and / or blocking the transmission of Zika virus from mother to embryo and / or fetus; in, The compound is at least one of brevidin A or colchicine.

2. The use according to claim 1, characterized in that, The pharmaceutically acceptable salts include one or more of the following: hydrochloride, p-toluenesulfonate, sodium salt, methanesulfonate, sulfate, succinate, maleate, fumarate, acetate, phosphate, hydrobromide, benzoate, benzenesulfonate, tartrate, carbonate, citrate, gluconate, lactate, malate, stearate, valerate, nitrate, calcium salt, potassium salt, zinc salt, and meglumine salt.

3. The use according to claim 1, characterized in that, The drug is administered in one or more of the following forms: injection, capsule, tablet, pill, powder, granule, paste, syrup, suspension, elixir, emulsion, ointment, plaster, mud, lotion, aerosol, and suppository.

4. The use according to claim 1, characterized in that, The drug is administered in one or more of the following forms: film-coated, fine granules, sublingual, transdermal, and liquid.

5. The use according to claim 1, characterized in that, The drug is administered in one or more of the following forms: Sublingual and inhaled preparations.

6. The use according to claim 1, characterized in that, The drug is applied in the following form: coating agent.

7. The use according to claim 1, characterized in that, The effective dose of the brevidin A or a pharmaceutically acceptable salt thereof is 0.81–1.63 mg / kg body weight; and / or The effective dose of colchicine or a pharmaceutically acceptable salt thereof is 0.0081 to 0.0243 mg / kg body weight.

8. The use according to claim 1, characterized in that, The concentration of the brefidobacterium A or its pharmaceutically acceptable salt is 0.2–1.0 μM; and / or The colchicine or its pharmaceutically acceptable salt is used at a concentration of 5–20 μM.

Images