Fatty acid oxidation promoters and their application as immunomodulators

Abstract

This invention provides a fatty acid oxidation promoter, which is a TERC inhibitor. The TERC inhibitor is a reagent that inhibits the expression of the TERC gene and / or a reagent that reduces or inactivates TERC activity. There are no existing reagents in the art that promote fatty acid oxidation by inhibiting TERC; therefore, this invention provides a novel fatty acid oxidation promoter.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and in particular to fatty acid oxidation promoters and their application as immunomodulators. Background Technology

[0002] Fatty acids (FAs) are essential lipids in cells, providing the main structural components for the formation of membrane lipids (including glycerophospholipids and sphingolipids). Mitochondrial fatty acid oxidation (FAO) is the main source of bioenergy in cells. Fatty acid oxidation, also known as fatty acid metabolism, can produce a large amount of reactive oxygen species (ROS), causing mitochondrial DNA damage and release, which in turn promotes T cell recruitment and a series of subsequent immune responses.

[0003] Studies have shown that various diseases, such as hypertension, dyslipidemia, obesity, insulin resistance, cardiovascular and cerebrovascular diseases, and tumors, are associated with abnormal fatty acid metabolism. Furthermore, abnormal fatty acid metabolism is also a characteristic feature of cancer, participating in the regulation of abnormal cell proliferation processes in malignant tumors. Therefore, researching the dependence of cancer cells on fatty acid metabolism will provide potential personalized treatment options for cancer patients.

[0004] However, the mechanisms by which fatty acid oxidation / metabolism and various diseases function still require further in-depth research, and related studies rely on the use of various fatty acid oxidation promoters. Simultaneously, for diseases with known interactions, it is necessary to develop a variety of fatty acid oxidation promoters to provide more treatment options. Currently, fatty acid oxidation promoters mainly include PPARs (peroxisome proliferator-activated receptor) agonists and AMPK (AMP-activated protein kinase) activators. However, the existing types of fatty acid oxidation promoters are still relatively limited, and their specific regulatory mechanisms in the complex immune microenvironment remain poorly understood. Developing more fatty acid oxidation promoters is crucial for further research into disease mechanisms and drug development. Summary of the Invention

[0005] Therefore, the purpose of this invention is to provide a novel fatty acid oxidation promoter, specifically a TERC inhibitor, which is a reagent that inhibits the expression of the TERC gene and / or a reagent that can reduce or inactivate TERC activity. This invention provides a novel fatty acid oxidation promoter that can regulate abnormal fatty acid metabolism and has the potential to treat various diseases, including tumors, related to abnormal fatty acid metabolism.

[0006] In one embodiment, the fatty acid oxidation promoter includes siRNA targeting the TERC gene and / or plasmids inhibiting TERC expression.

[0007] In one embodiment, the siRNA targeting the TERC gene includes si-TERC-1 and / or si-TERC-2; the sequence of si-TERC-1 is shown in SEQ ID NO:1, and the sequence of si-TERC-2 is shown in SEQ ID NO:2.

[0008] In one embodiment, the si-TERC-1 and / or si-TERC-2 promote fatty acid oxidation in cells by transfection.

[0009] Another object of the present invention is to provide a scheme for the application of the above-mentioned fatty acid oxidation promoter as an immunomodulator.

[0010] In one embodiment, the TERC inhibitor promotes the binding of ACAT1 to HuR by inhibiting the expression and / or activity of TERC, thereby enhancing the promoting effect of ACAT1 on fatty acid oxidation and generating a large amount of ROS to promote immunity.

[0011] Another object of the present invention is to provide a method for using TERC inhibitors in the preparation of drugs that promote fatty acid oxidation.

[0012] In one embodiment, the TERC inhibitor includes siRNA targeting the TERC gene and / or plasmids that inhibit TERC expression.

[0013] In one embodiment, the siRNA targeting TERC includes si-TERC-1 and / or si-TERC-2; the sequence of si-TERC-1 is shown in SEQ ID NO:1, and the sequence of si-TERC-2 is shown in SEQ ID NO:2.

[0014] In one embodiment, the TERC inhibitor enhances the promoting effect of ACAT1 on fatty acid oxidation by inhibiting TERC expression and promoting the binding of ACAT1 to HuR.

[0015] In one embodiment, the plasmids expressing si-TERC-1 and / or si-TERC-2 are packaged with lentivirus and transfected into cells to promote fatty acid oxidation in cells, thereby generating a large amount of ROS to induce an immune response.

[0016] To better understand and implement this invention, the following detailed description is provided in conjunction with the accompanying drawings. Attached Figure Description

[0017] Figure 1 The graph shows the effect of si-TERC-1 and si-TERC-2 on the downregulation of TERC gene expression.

[0018] Figure 2The figure shows the changes in the expression levels of various genes in A549 and H1299 cells after downregulation of TERC expression. Figure 3 Figure 1 shows the results of MDA detection experiments in A549 and H1299 cells overexpressing ACAT1. Figure 4 The image shows the results of Nile Red staining experiments on A549 cells overexpressing ACAT1. Figure 5 The image shows the results of Nile Red staining experiments on H1299 cells overexpressing ACAT1. Figure 6 The figure shows the experimental results of MDA detection in Example 3; Figure 7 The image shows the results of the Nile Red staining experiment on A549 cells in Example 3; Figure 8 The image shows the results of the Nile Red staining experiment on H1299 cells in Example 3. Figure 9 Figure showing the results of an immunoblotting experiment targeting HuR protein after downregulating TERC gene expression; Figure 10 Figure 1 shows the results of a RIP experiment to determine the binding of HuR to TERC and ACAT1 in cells with low TERC gene expression. Figure 11 Figure 1 shows the results of a RIP experiment to stabilize the binding of HuR to TERC and ACAT1 in cells overexpressing the TERC gene. Figure 12 Figure showing the results of flow cytometry detection of ROS content in ACAT1 knockdown cells in Example 5; Figure 13 The figure shows the results of flow cytometry analysis of ROS levels in cells overexpressing TERC and cells simultaneously overexpressing TERC and ACAT1 in Example 5. Figure 14 This is a graph showing the results of CD8+ T cell infiltration in mouse tumors detected by flow cytometry. Detailed Implementation

[0019] This invention unexpectedly discovered that the downregulation of the telomerase RNA component (TERC) is associated with the upregulation of the fatty acid oxidation pathway. The telomerase RNA component (TERC) is a long non-coding RNA (lncRNA) and an essential component of telomerase. Further mechanistic investigation revealed a negative correlation between TERC gene expression and the expression of acetyl-CoA acetyltransferase 1 (ACAT1)—downregulation of TERC gene expression leads to upregulation of ACAT1 expression. ACAT1 is a key enzyme in lipid metabolism β-oxidation, participating in the final step of fatty acid oxidation, and is primarily located in mitochondria; its upregulation promotes fatty acid oxidation. Since there are currently no fatty acid oxidation promoters that inhibit TERC expression to promote fatty acid oxidation, this invention conceives and designs TERC inhibitors as novel fatty acid oxidation promoters. Simultaneously, because fatty acid oxidation generates a large amount of ROS, which can further promote immune responses, the fatty acid oxidation promoter can also be used as an immunomodulator.

[0020] The present invention will now be described in detail with reference to the accompanying drawings.

[0021] This invention designs a TERC inhibitor for use as a fatty acid oxidation promoter. The TERC inhibitor is a siRNA targeting the TERC gene, specifically including si-TERC-1 and / or si-TERC-2, or an expression plasmid expressing si-TERC-1 and / or si-TERC-2. The sequence of si-TERC-1 is shown in SEQ ID NO:1 (GUCUAACCCUAACUGAGAAGG), and the sequence of si-TERC-2 is shown in SEQ ID NO:2 (CCGUUCAUUCUAGAGCAAAC). By transfecting si-TERC-1 and / or si-TERC-2, or a lentivirally packaged plasmid expressing si-TERC-1 and / or si-TERC-2, into cells, or by delivering it to animals using existing drug delivery vectors, the inhibitory effect of TERC can be exerted, thereby promoting fatty acid oxidation.

[0022] The efficacy is verified through test examples 1-5 below.

[0023] Example 1: Verification of the inhibitory effect of the TERC inhibitor provided by this invention on TERC and its upregulation effect on ACAT1.

[0024] By transfecting si-TERC-1 and si-TERC-2 into A549 and H1299 cells respectively, the effects of TERC and other gene expression, including ACAT1, on the expression of TERC in both cell types were verified by conventional RT-qPCR. The specific experimental methods are as follows: Step S11: The si-TERC-1 and si-TERC-2 were synthesized by GenePhrama in Guangzhou, and the corresponding negative control (NC) was provided by the company.

[0025] Step S12: Seeding cells. Digest A549 cells and H1299 cells separately and seed them into 6-well plates. When the cell density reaches 60%-80%, discard the supernatant culture medium and add 1 ml of serum-free culture medium for transfection.

[0026] Step S13: Prepare the siRNA transfection system. (1) Mix 120 μl serum-free medium with 5 μl siRNA (si-TERC-1 / si-TERC-2) or negative control, and let stand at room temperature for 5 minutes. (2) Mix 120 μl serum-free medium with 5 μl Lipofectamine™ 3000 Transfection Reagent, and let stand at room temperature for 5 minutes. (3) Mix the two liquids and let stand at room temperature for 15 minutes.

[0027] Step S13: Transfect siRNA into seeded A549 and H1299 cells. Add all liquid to the 6-well plates containing the cells, and replace with complete culture medium after 6-8 hours. After culturing for 48 hours, perform subsequent detection experiments. Specifically, this detection example uses routine RT-qPCR to detect the expression levels of the TERC gene and other genes, including ACAT1.

[0028] The results are as follows Figure 1 , 2 As shown. Figure 1 This indicates that both si-TERC-1 and si-TERC-2 can successfully inhibit TERC expression. Figure 2 This indicates that in both A549 and H1299 cell lines, both si-TERC-1 and si-TERC-2 inhibitors can upregulate ACAT1 expression, suggesting their potential to promote fatty acid oxidation.

[0029] Example 2: Verification that upregulation of ACAT1 expression can promote fatty acid oxidation and reduce lipid accumulation in cells.

[0030] To further verify that upregulation of ACAT1 expression can promote fatty acid oxidation, the following verification experiment was conducted.

[0031] Step S21: Construct an ACAT1 overexpression plasmid (referred to as ACAT1-o / e plasmid), wherein the plasmid backbone of the overexpression plasmid is specifically pLV-CMV-3Flag-PGK-Puro.

[0032] Step S22: The constructed overexpression plasmid was packaged with lentivirus and transfected into A549 and H1299 cells to construct A549 cell lines and H1299 cell lines that stably and highly express ACAT1, respectively. The specific steps are as follows: Step S221: Lentiviral packaging of the overexpression plasmid. HEK-293T cells were trypsinized and seeded in 6-well plates. When the cell density reached 50%-60%, lentivirus packaging was performed. The cell culture supernatant was aspirated and 2 ml of DMEM complete medium was added. 0.5 μg PIG plasmid, 1.0 μg pSA plasmid, and 1.5 μg ACAT1-o / e plasmid were added to a clean EP tube, along with 100 μl of serum-free DMEM medium. The mixture was thoroughly mixed, and 2 μl of Neofect DNA transfection reagent was added. The mixture was incubated for 20 minutes. The mixture was then added to 6-well plates and incubated in an incubator. After 48 hours, the supernatant viral solution was aspirated, filtered, and collected, and stored at -80°C. Meanwhile, as a negative control for this experiment, an empty vector pLV-CMV-3Flag-PGK-Puro (hereinafter referred to as ACAT1-vec) was used as a control group and the same operation as the ACAT1-o / e plasmid was performed for comparison.

[0033] Step S222: Constructing stable expression cell lines. Transfect A549 and H1299 cells with lentivirally packaged ACAT1-o / e or ACAT1-vec plasmids. Specifically, after digesting the cells to be treated, seed them in 6-well plates. When the cell density reaches 60%-70%, discard the culture supernatant, add 1 ml of complete culture medium, 350 μl of viral solution (i.e., lentivirally packaged ACAT1-o / e plasmid or ACAT1-vec empty vector plasmid), and 2 μl of polybrene. Incubate statically for 18-24 hours, then change the medium. Once the cells have reached confluence in the 6-well plates, replace the medium with complete culture medium containing puromycin (2 μg / ml) for cell selection. After selection, collect the cells for subsequent MDA detection and Nile Red staining experiments.

[0034] Step S23: MDA (malondialdehyde) detection experiment. MDA is a natural product of lipid oxidation in organisms; detecting the level of MDA can detect the level of lipid oxidation. Fatty acids are the most important component of lipids, therefore MDA can directly reflect the degree of fatty acid oxidation. This invention uses a commercially available lipid oxidation (MDA) detection kit (Shanghai Beyotime Co., Ltd.) according to the instructions for detection, and the results are as follows: Figure 3 As shown, overexpression of ACAT1 can increase the MDA content in cells, suggesting increased fatty acid oxidation.

[0035] Step S24: Nile Red Staining Assay. Nile red is a lipophilic dye that emits bright red fluorescence in nonpolar solvents, enabling the localization and quantification of intracellular lipids. The experimental procedure is as follows: (1) Cell plating and culture: After treatment, the cells were digested with trypsin and repeatedly pipetted to make the cells evenly distributed. They were then seeded in confocal culture dishes and placed in an incubator at 37°C for cell culture.

[0036] (2) Cell fixation: When the cell density reaches 60%-80%, discard the supernatant culture medium and wash the culture dish twice with PBS. Add 1 ml of 4% paraformaldehyde to fix the cells for 15-20 minutes.

[0037] (3) Nile Red Staining: Remove the paraformaldehyde fixative and wash twice with PBS. Dilute the Nile Red powder with ddH2O to a 1:1000 Nile Red solution (Solarbio, Beijing) and store at -20℃ in the dark. Then dilute the Nile Red solution with ddH2O to a 1:1000 Nile Red diluent. Add 1 ml of Nile Red diluent to each culture dish and stain in the dark for 30 minutes.

[0038] (4) Cell nuclear staining: Remove the Nile Red dilution solution, wash twice with PBS, add 100 μl of DAPI staining solution (Shanghai Beyotime Company) to each culture dish, and stain for 10 minutes in the dark.

[0039] (5) Fluorescence intensity analysis: Wash twice with PBS, remove all liquid, take pictures under a fluorescence microscope, select the stained area and calculate the average fluorescence intensity of Nile Red using ImageJ software.

[0040] The results of the Nile Red staining experiment are as follows Figure 4 , 5 As shown, the average fluorescence intensity of Nile Red was reduced in A549 and H1299 cells overexpressing ACAT1, suggesting a decrease in intracellular lipid content.

[0041] Both MDA and Nile Red assays indicate that ACAT1 expression promotes fatty acid oxidation, thereby reducing intracellular lipid accumulation.

[0042] Combining test examples 1 and 2, the TERC inhibitor provided by this invention can effectively inhibit TERC expression while upregulating ACAT1 expression. Furthermore, upregulation of ACAT1 expression promotes fatty acid oxidation, thereby reducing intracellular lipid accumulation. Therefore, the TERC inhibitor provided by this invention can also serve as a fatty acid oxidation promoter, further proving crucial for research on tumor immune mechanisms and the development of tumor-related drugs.

[0043] Example 3: Further verification that TERC can regulate cellular lipid metabolism through ACAT1.

[0044] In A549 and H1299 cell lines, ACAT1 and TERC were overexpressed. The results were compared with a negative control cell line that overexpressed only TERC and did not express either ACAT1, to observe whether TERC could regulate cellular lipid metabolism through ACAT1. The methods are as follows: First, ACAT1-o / e overexpression plasmid, ACAT1-vec empty vector plasmid, TERC-o / e overexpression plasmid, and TERC-vec empty vector plasmid were constructed. Then, according to the grouping, they were transfected into A549 and H1299 cell lines to construct stable expression cells with no expression of either plasmid (transfected with TERC-vec + ACAT1-vec), TERC overexpression only (transfected with TERC-o / e + ACAT1-vec), and simultaneous overexpression of TERC and ACAT1 (transfected with TERC o / e + ACAT1-vec). The plasmid construction and cell transfection methods were the same as described above.

[0045] Subsequently, MDA and Nile Red assays were performed on each group of cells. The results are as follows: Figure 6-8 As shown, overexpression of TERC significantly inhibited fatty acid oxidation and led to a significant increase in intracellular lipid accumulation. This suggests that inhibiting TERC expression promotes fatty acid oxidation and reduces lipid accumulation. These results confirm that TERC can regulate cellular lipid metabolism through ACAT1.

[0046] Furthermore, the experimental results also showed that overexpression of ACAT1 could reverse the downregulation of fatty acid oxidation by TERC and increase intracellular lipid accumulation. Based on the results of this test example, the present invention hypothesizes that there may be a competitive relationship between ACAT1 and TERC. To further verify the competitive relationship and mechanism between the two, and to ensure that the negative regulatory relationship between TERC and ACAT1 is not accidental, the present invention further analyzes and explores the regulatory mechanisms of TERC and ACAT1 as described in test example 4.

[0047] Example 4: Exploring the negative regulatory mechanism between TERC and ACAT1.

[0048] This invention uses the ENCORI database to explore RNA-binding proteins that interact with both the lncRNA expressed by TERC and the mRNA during ACAT1 expression. One of these proteins, HuR, was found to regulate gene expression by stabilizing mRNA. Therefore, this invention hypothesizes that TERC expression may competitively bind to ACAT1 mRNA, and further experiments were conducted to verify this hypothesis.

[0049] Step S41: Observe the changes in HuR protein content in cells during TERC knockdown and overexpression.

[0050] Collect A549 and H1299 cells prepared according to steps S11-S13 with si-TERC-1 and si-TERC-2 to knock down TERC expression. At the same time, prepare stable TERC-overexpressing cell lines according to the same steps as steps S21-S22, except that the ACAT1-o / e plasmid is replaced with the TERC-o / e plasmid. The plasmid backbone is also pLV-CMV-3Flag-PGK-Puro, and the target gene is TERC. The pLV-CMV-3Flag-PGK-Puro empty vector plasmid is used as a negative control and is denoted as TERC-vec plasmid.

[0051] The levels of HuR protein in A549 and H1299 cells with TERC knockdown and stable overexpression were detected using routine Western blot experiments, with β-tubulin as an internal control. The materials used were as follows: Primary antibodies: ACAT1 antibody (rabbit, catalog number: 16215-1-AP) (Proteintech, Wuhan); HuR antibody (rabbit, catalog number: 11910-1-AP) (Proteintech, Wuhan); β-tubulin antibody (mouse, catalog number: 66240-1-Ig) (Proteintech, Wuhan). Secondary antibodies: mouse secondary antibody (catalog number: SA00001-1) (Proteintech, Wuhan); rabbit secondary antibody (catalog number: SA00001-2) (Proteintech, Wuhan).

[0052] The results are as follows Figure 9 As shown, high or low TERC expression does not affect the protein content of HuR.

[0053] Step S42: Construct stable cell lines with stable low expression of TERC and stable cell lines with stable overexpression of TERC, and perform RNA immunoprecipitation (RIP) experiments using HuR antibodies.

[0054] Step S421: The construction method for stable cell lines expressing low levels of TERC is the same as in steps S21-S22, except that the ACAT1-o / e plasmid is replaced with sh-TERC-1 and sh-TERC-2 plasmids that knock down TERC expression, respectively. The plasmid backbones of sh-TERC-1 and sh-TERC-2 are also pLV-CMV-3Flag-PGK-Puro (the plasmids were synthesized and amplified by Beijing Ruiboxingke Biotechnology Co., Ltd., which also provided the corresponding empty vector plasmids). The empty vector plasmid backbone, also pLV-CMV-3Flag-PGK-Puro, is used as a negative control. Stable cell lines overexpressing TERC are as described in step S31.

[0055] Step S42: RNA immunoprecipitation (RIP) was performed using HuR's antibody. The specific steps were as follows: (1) Cell collection and fixation: Cells were collected from a 10 cm culture dish, digested, centrifuged, washed once with 1 ml PBS, and the liquid was transferred to a 15 ml centrifuge tube and centrifuged at 1000 rpm for 3 minutes. The supernatant was discarded, and the cells were resuspended in 9 ml PBS. Then 250 μl of 37% paraformaldehyde was added to fix the cells. The mixture was mixed evenly and placed on a shaker and shaken slowly at room temperature for 15 minutes. Then 1 ml of 2.5% glycine solution was added, mixed evenly, and shaken slowly at room temperature for 7 minutes. The cells were centrifuged at 5000 rpm for 5 minutes, the supernatant was discarded, and the cells were washed twice with PBS. The cell pellet was stored in a -80℃ freezer.

[0056] (2) Sample sonication: Add 1 ml of Western blot and IP cell lysis buffer + 20 μl of 100 mM PMSF + 20 μl of protease inhibitor + 5 μl of RNase inhibitor to each sample, mix well by pipetting, place in an ice box, and sonicate the sample using an ultrasonic homogenizer. The ultrasonic homogenization program was set as follows: start for 10 seconds, stop for 10 seconds, amplitude of 15, alarm temperature of 60℃, and the program was repeated 10 times for each sample. After lysis, centrifuge at 14000 ×g for 3 minutes, collect the supernatant, and take 50 μl of the supernatant as the sample input.

[0057] (3) Immunoprecipitation: Take an equal volume of sample from each tube, mix well, add 1 μl of IgG antibody as a negative control, add 4 μl of target antibody to each tube of the remaining RIP sample and mix by pipetting, place on a rotary mixer, and incubate overnight at 4°C. Take several new EP tubes, add 50 μl of magnetic bead protein G, then add 0.5 ml of Western and IP cell lysis buffer + 10 μl of 100 mM PMSF + 10 μl of protease inhibitor + 2.5 μl of RNase inhibitor, place on a rotary mixer at 4°C, and wash the magnetic beads for 30 minutes. Place the EP tubes in a magnetic rack, remove the supernatant, and resuspend the magnetic beads in 50 μl of Western and IP cell lysis buffer + 1 μl of 100 mM PMSF + 1 μl of protease inhibitor + 0.25 μl of RNase inhibitor. Add the IP sample to the EP tubes and rotate at 4°C for 1-2 hours.

[0058] (4) Washing: After removing the supernatant from the sample, add 900 μl of Western blotting and IP cell lysis buffer and wash the magnetic beads 5 times, 5 minutes each time. After the last wash, add 100 μl of Western blotting and IP cell lysis buffer + 1 μl of RNase inhibitor. At the same time, add 50 μl of Western blotting and IP cell lysis buffer to each input tube. Place the RIP sample and sample input in a 70°C water bath for 1 hour to obtain the RIP sample solution.

[0059] (5) RNA extraction: Beyotime animal RNA extraction kit was used.

[0060] (6) qPCR and result analysis: qPCR experiments were performed on TERC and ACAT1 according to standard methods. The relative expression level of the sample gene = the expression level of the sample gene / the expression level of the corresponding input gene. Among them, the upstream primer for detecting TERC is as shown in SEQ ID NO:3 (GTGGTGGCCATTTTTTGTCTAAC), and the downstream primer is as shown in SEQ ID NO:4 (TGCTCTAGAATGAACGGTGGAA); the upstream primer for ACAT1 is as shown in SEQ ID NO:5 (AAGGCAGGCAGTATTGGGTG), and the downstream primer is as shown in SEQ ID NO:6 (ACATCAGTTAGCCCGTCTTTTAC).

[0061] The results are as follows Figure 10 , 11 The results showed that knocking down TERC promoted the binding of ACAT1 mRNA to HuR, while overexpression of TERC significantly reduced the binding, suggesting that TERC and ACAT1 mRNA competitively bind to HuR protein.

[0062] The results of test example 4 indicate that TERC competes with ACAT1 for binding to HuR, thus exhibiting negative regulation between the two. That is, the inhibition of TERC leads to the upregulation of ACAT1, thereby promoting fatty acid oxidation, which has theoretical and mechanistic support.

[0063] Example 5: Verification that TERC can regulate fatty acid oxidation through ACAT1, thereby affecting ROS production and thus regulating the immune response.

[0064] Literature reports that fatty acid oxidation can generate large amounts of ROS, causing mitochondrial DNA damage and release, thereby triggering the cGAS-STING pathway, activating the expression and secretion of interferon-stimulated genes (ISGs) such as CCL5 and CXCL10 and type I interferon, promoting T cell recruitment, and thus enhancing anti-tumor immunity. Therefore, this invention hypothesizes that TERC / ACAT1-mediated fatty acid oxidation can affect the immune microenvironment. To verify this hypothesis, in Example 5, siRNAs that inhibit ACAT1 expression—si-ACAT1-1 (sequence as shown in SEQ ID NO:7, UAUUGUAGACAUCAGUUAGCCCGUC) and si-ACAT1-2 (sequence as shown in SEQ ID NO:8, GCCUUUAGUCUGGUUGUACUA), and the aforementioned negative control (NC)—were transfected into A549 and H1299 cells, respectively, to knock down ACAT1 expression. The specific method is the same as in Example 1 and will not be repeated here. Simultaneously, stable cell lines of A549 and H1299 cells overexpressing TERC were constructed using the TERC-o / e overexpression plasmid. In addition, stable cell lines of A549 / H1299 cells overexpressing both TERC and ACAT1 were constructed using TERC-o / e and ACAT1-o / e. The empty vector plasmid backbone pLV-CMV-3Flag-PGK-Puro was used as a negative control.

[0065] ROS levels in the cells with ACAT1 knockdown, TERC overexpression, and simultaneous TERC and ACAT1 overexpression were measured using flow cytometry. The results are as follows: Figure 12 , 13 As shown, knocking down ACAT1 or overexpressing TERC reduced intracellular ROS levels, while restoring ACAT1 gene expression in stably overexpressing TERC cell lines led to an increase in ROS levels. This suggests that the TERC / ACAT1 axis can regulate ROS production and has the ability to further influence the immune microenvironment.

[0066] Furthermore, to more accurately observe the immune-enhancing effect of TERC inhibitors through ACAT1-promoted fatty acid oxidation, this invention also constructed knockdown-expressing sh-TERC and sh-ACAT1 plasmids (pLKD-U6-CMV-puro plasmid backbone) and transfected them into A549 cells to construct stable cell lines with low TERC or ACAT1 expression. Subcutaneous tumorigenesis experiments were then conducted in mice. The suspension of these cell lines was mixed 1:1 with Matrigel and diluted to 1.2 × 10⁻⁶. 7 Cells / ml were injected subcutaneously into the left axilla of C57BL / 6 mice, 100 μl per mouse, until the subcutaneous tumor volume exceeded 2000 mm. 3 The animal experiment was terminated at that point. The mice were then euthanized, and subcutaneous xenografts were harvested via dissection. An empty pLKD-U6-CMV-puro plasmid was used as a negative control in this experiment.

[0067] Subsequently, flow cytometry was used to analyze immune cell infiltration in mouse tumors. The specific method is as follows.

[0068] (1) Preparation of dissociation working solution: Prepare the dissociation working solution according to the ratio of (RPMI1640: enzyme D: enzyme R: enzyme A = 2350: 100: 50: 12.5) and store it in a -20°C refrigerator.

[0069] (2) Tissue suspension preparation: Cut the tumor into 2-4 mm pieces with scissors, transfer them to C-tubes and mince them. Add 1 ml of dissociation working solution to each C-tube. Place the C-tubes in the automated sample processor, select program m_impTumor_02, and repeat the program twice. After the program terminates, remove the C-tubes and place them on a shaker at 37°C and 80 rpm for 40 minutes. Then place the C-tubes in the automated sample processor and select program m_impTumor_03. After dissociation, add PBS to the tissue suspension, mix well, and transfer it to a 50 ml centrifuge tube. Centrifuge at 500 × g for 5 minutes and discard the supernatant.

[0070] (3) Preparation of single-cell suspension: Add 1 ml of red blood cell lysis buffer to each tube and lyse at room temperature for 5 minutes. After lysis, add 1 ml of PBS, centrifuge at 500 × g for 5 minutes, and discard the supernatant. Then add 5 ml of PBS to resuspend and filter, centrifuge at 500 × g for 5 minutes, discard the supernatant, add PBS to resuspend, and count the cells. Aspirate two million cells from each flow cytometry tube.

[0071] (4) Cell surface staining. Cell viability staining: Add 500 μl of the viability stain system (PBS: zombie dye = 99:1) to each tube and stain for 12 minutes in the dark. Centrifuge at 500 × g for 5 minutes, discard the supernatant, add PBS to resuspend, centrifuge again, and finally add 100 μl of PBS to resuspend. Other surface antibody staining: Mix the recommended amount of surface antibody with PBS and add 100 μl to each full staining tube. Incubate at room temperature in the dark for 10-15 minutes, centrifuge to remove the supernatant, wash with PBS, centrifuge at 500 × g for 5 minutes, remove the supernatant, and resuspend in 100 μl of PBS.

[0072] 15.5 Flow Cytometry: After all samples are prepared, flow cytometry can be performed. The cell flow rate is usually low.

[0073] Flow cytometry analysis of subcutaneous xenografts in C57BL / 6 mice yielded the following results: Figure 14 As shown, compared with the control group, TERC knockdown promoted increased CD8+ T cell infiltration, while ACAT1 knockdown reduced CD8+ T cell infiltration. Furthermore, ACAT1 knockdown reversed the increased CD8+ T cell infiltration induced by TERC knockdown. These results suggest that the TERC / ACAT1 axis can affect the tumor immune microenvironment, and therefore TERC inhibitors, as fatty acid oxidation promoters, can also be used as immunomodulators.

[0074] The terminology used in the embodiments of this application is for the purpose of describing particular embodiments only and is not intended to limit the embodiments of this application. The singular forms “a,” “the,” and “the” used in the embodiments and claims of this application are also intended to include the plural forms unless the context clearly indicates otherwise. It should also be understood that, unless otherwise stated, the term “and / or” as used herein refers to and includes any or all possible combinations of one or more associated listed items. When the above description relates to drawings, the same numbers in different drawings represent the same or similar elements unless otherwise indicated. In the description of this application, those skilled in the art will be able to understand the specific meaning of the above terms in this application according to the specific circumstances.

[0075] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. A fatty acid oxidation promoter, characterized in that, The fatty acid oxidation promoter is a TERC inhibitor, which is a reagent that inhibits the expression of the TERC gene and / or a reagent that can reduce or inactivate TERC activity.

2. The fatty acid oxidation promoter according to claim 1, characterized in that, This includes siRNAs that target the TERC gene and / or plasmids that inhibit TERC expression.

3. The fatty acid oxidation promoter according to claim 2, characterized in that, The siRNA targeting the TERC gene includes si-TERC-1 and / or si-TERC-2; the sequence of si-TERC-1 is shown in SEQ ID NO:1, and the sequence of si-TERC-2 is shown in SEQ ID NO:

2.

4. The fatty acid oxidation promoter according to claim 3, characterized in that, The si-TERC-1 and / or si-TERC-2 promote fatty acid oxidation in cells by transfecting them.

5. The use of the fatty acid oxidation promoter according to any one of claims 1-4 as an immunomodulator.

6. The application according to claim 5, characterized in that, The TERC inhibitor enhances the promoting effect of ACAT1 on fatty acid oxidation by inhibiting the expression and / or activity of TERC, thereby promoting the binding of ACAT1 to HuR and generating a large amount of ROS to promote immunity.

7. The application of TERC inhibitors in the preparation of drugs that promote fatty acid oxidation, characterized in that, The TERC inhibitor is a reagent that inhibits the expression of the TERC gene and / or a reagent that can reduce or inactivate TERC activity.

8. The application according to claim 7, characterized in that, The TERC inhibitor comprises siRNA targeting the TERC gene and / or plasmids inhibiting TERC expression; the siRNA targeting the TERC gene comprises si-TERC-1 and / or si-TERC-2; the sequence of si-TERC-1 is shown in SEQ ID NO:1, and the sequence of si-TERC-2 is shown in SEQ ID NO:

2.

9. The application according to claim 8, characterized in that, The TERC inhibitor enhances the fatty acid oxidation-promoting effect of ACAT1 by inhibiting TERC expression and promoting the binding of ACAT1 to HuR, thereby generating a large amount of ROS to induce an immune response.

Images