A yeast strain with high yield of l-malic acid and application thereof
By mutagenesis of yeast strains, especially by loss or reduction of NADH ubiquinone reductase function, combined with mitochondrial respiration inhibitors and high-throughput screening, a high-yielding L-malic acid yeast strain TC-6 was obtained, solving the problems of low yeast strain yield and unclear genetic characteristics, and realizing efficient industrial production.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- HANGZHOU BIOKING BIOCHEM ENG
- Filing Date
- 2026-05-19
- Publication Date
- 2026-07-28
AI Technical Summary
Existing technologies show that yeast strains have low L-malic acid yields, and the genetic characteristics of high-yielding strains are unclear, making it difficult to meet the needs of industrial production. Traditional screening methods are inefficient, and the screening throughput and accuracy need to be improved.
By mutagenesis of yeast strains, particularly by loss or reduction of NADH ubiquinone reductase function, combined with mitochondrial respiration inhibitor screening and high-throughput deep-well plate fermentation, and secondary screening using the pH indicator methyl yellow, high-yielding L-malic acid yeast strains with distinct genetic characteristics were obtained.
The obtained Saccharomyces cerevisiae strain TC-6 achieved an L-malic acid yield of 38.9 g/L in shake-flask fermentation and 258.4 g/L in a 5 L fermenter. It has clear genetic characteristics, which facilitates industrial application, and the screening method significantly improves efficiency.
Smart Images
Figure CN122465735A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbial technology, and in particular to a yeast strain that produces high levels of L-malic acid and its applications. Background Technology
[0002] L-malic acid (C4H6O5) is an important organic acid and a major component of fruits such as apples, grapes, and lemons. It has been widely used in synthetic materials, cosmetics, feed additives, food modifiers, and pharmaceutical synthesis. In recent years, the demand for L-malic acid has been steadily increasing. Currently, malic acid is mainly produced through chemical synthesis. The chemical synthesis of malic acid uses maleic anhydride as a raw material, which is hydrated in an aqueous solution under high temperature and pressure to form maleic acid. Subsequently, the maleic anhydride is isomerizes to form maleic acid, which is then finally hydrated to form a racemic mixture of DL-malic acid. While the chemical method has advantages in production efficiency, the synthesized product is a racemic mixture, and only L-malic acid can be used in food and pharmaceuticals. Furthermore, the separation cost of the DL-racemic malic acid is high, limiting the chemical synthesis of malic acid. Microbial fermentation for the production of L-malic acid has advantages such as renewable raw materials, mild reaction conditions, and environmental friendliness, making it a current research hotspot.
[0003] Yeast, as a recognized safe model microorganism, has a solid foundation for industrial production and is widely used in food, medicine, and biofuel industries. However, wild-type Saccharomyces cerevisiae has a low L-malic acid yield, making it difficult to meet the demands of industrial production. Therefore, increasing the L-malic acid yield of yeast has significant application value.
[0004] Currently, the main method for increasing L-malic acid production in yeast includes mutagenesis breeding. Mutagenesis breeding involves treating strains with physical or chemical mutagens and then screening to obtain high-yielding mutants. This method is simple to operate and does not require knowledge of the strain's metabolic network, but it has significant limitations: First, mutagenesis is random, with a low positive mutation rate, requiring extensive screening; second, the genetic characteristics of the mutants obtained through mutagenesis are unclear, making further rational modification difficult; third, traditional screening methods (such as plate color development and shake-flask fermentation verification) are inefficient and cannot achieve high-throughput screening. For example, although there are reports of using pH indicators for screening malic acid-producing bacteria, the selection of indicators, the addition ratio, and detection conditions lack systematic optimization, and the screening throughput and accuracy need to be improved.
[0005] In summary, there is an urgent need in the existing technology for a yeast strain with well-defined genetic characteristics, high malic acid yield, and good prospects for industrial application, as well as a universal method that can stably increase the malic acid yield of yeast. Summary of the Invention
[0006] This invention provides a yeast strain that produces high levels of L-malic acid and its applications, as well as a method for increasing the yield of L-malic acid in yeast, in order to solve the problems of low L-malic acid yield and unclear genetic characteristics of high-yielding strains in the prior art.
[0007] In a first aspect, the present invention provides a yeast strain that produces high levels of L-malic acid, wherein the function of NADH ubiquinone reductase (EC 1.6.5.9) is lost or reduced in the strain.
[0008] Preferably, the loss or reduction of function of the NADH ubiquinone reductase is caused by mutation of its encoding gene.
[0009] Preferably, the yeast strain is selected from Saccharomyces cerevisiae (Saccharomyces cerevisiae). Saccharomyces cerevisiae ), Kudria zweipichia yeast ( Pichia kudriavzevii ) or Yersinia lipophila ( Yarrowia lipolytica ).
[0010] More preferably, the gene encoding the NADH ubiquinone reductase is: (a) The Nde1 and / or Nde2 genes in Saccharomyces cerevisiae; (b) The C5L36_0A09630 gene (Uniprot database search number: A0A1V2LH13) and / or the C5L36_0B04540 gene (Uniprot database search number: A0A099P4E1) in *Pichia kudrica*; or (c) YALI1_F32476g gene (Uniprot database search number: A0A1H6PNF3) and / or YALI1_E06573g gene (Uniprot database search number: A0A1D8NH95) in Yersinia lipolytica.
[0011] More preferably, the Nde1 gene undergoes a single base insertion at position 656, causing a frameshift in the subsequent reading frame, prematurely generating a stop codon, and resulting in the loss of function of the encoded protein; and / or, the Nde2 gene undergoes a single base insertion at position 791 and / or position 804, causing a frameshift in the subsequent reading frame, prematurely generating a stop codon, and resulting in the loss of function of the encoded protein.
[0012] In one specific embodiment of the present invention, the strain is a brewer's yeast with preservation number CGMCC No. 35988 ( Saccharomyces cerevisiae TC-6. This strain was deposited on September 24, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCCNo.35988.
[0013] Experiments have verified that the L-malic acid yield of the Saccharomyces cerevisiae TC-6 strain is no less than 38.9 g / L after 48 h of shake-flask fermentation; no less than 258.4 g / L after fermentation in a 5 L fermenter; and no less than 326.6 g / L after fermentation in a 50 L fermenter, with a conversion rate of 1.27 g / g.
[0014] Secondly, the present invention further provides the application of the above-mentioned Saccharomyces cerevisiae strain in any one or more of the following: (1) Production of L-malic acid; (2) Prepare reagents or kits for the production of L-malic acid; (3) Construct genetically engineered strains that produce high levels of L-malic acid; (4) Prepare malic acid downstream products, wherein the downstream products include at least succinic acid and fumaric acid.
[0015] Thirdly, the above-mentioned high-L-malic acid-producing Saccharomyces cerevisiae strains can be obtained through the following screening methods: S1: The starting strain cultured in seed culture medium will be subjected to mutagenesis treatment; S2: The bacterial suspension after mutagenesis treatment was spread on a solid culture medium containing mitochondrial respiration inhibitors for initial screening; S3: Select strains with relatively small colonies for fermentation in high-throughput deep-well plates; S4: A pH indicator with a color change range of 1.4-4.0 was added to the fermentation supernatant for re-screening, and the OD value was selected. 520 Strains with values higher than a set threshold are selected as the strains obtained through screening.
[0016] Optionally, the starting strain can be a naturally isolated strain, an artificially induced mutant strain, or a genetically engineered strain.
[0017] In one embodiment of the present invention, the starting strain is CEN.PK2-1C.
[0018] Optionally, the mutagenesis treatment is selected from one or more of the following methods: ultraviolet mutagenesis, chemical mutagenesis, room temperature and pressure plasma mutagenesis, microwave mutagenesis, or radiation mutagenesis.
[0019] In one embodiment of the present invention, the mutagenesis treatment is ultraviolet-induced LiCl mutagenesis.
[0020] Optionally, the mitochondrial respiration inhibitor is one or more of rotenone, cymoxanil, antimethonium A, acetaminophen, hydrogen sulfide, or azide.
[0021] Optionally, the mitochondrial respiration inhibitor is rotenone.
[0022] Optionally, the concentration of rotenone is 1.6-2.0 g / L.
[0023] Optionally, the solid culture medium does not contain a pH neutralizer.
[0024] Optionally, the high-throughput deep-hole plate is a 24-well plate, a 48-well plate, or a 96-well plate; preferably a 96-well plate.
[0025] In one embodiment of the present invention, the specific steps of fermentation in the high-throughput deep well plate are as follows: fermentation in a fermentation medium at 30°C and 220 rpm for 48 h.
[0026] In one embodiment of the present invention, the fermentation broth supernatant is obtained by centrifuging a high-throughput deep well plate in a centrifuge at 5000 rpm for 30 min.
[0027] Optionally, the pH indicator is methyl yellow or acidic eosin.
[0028] In one embodiment of the present invention, the pH indicator is methyl yellow.
[0029] Optionally, the amount of pH indicator added is 1 / 200 to 1 / 25 of the supernatant volume.
[0030] In one embodiment of the present invention, the amount of the pH indicator methyl yellow added is 1 / 25 of the supernatant volume.
[0031] In one embodiment of the present invention, the secondary screening involves adding the pH indicator methyl yellow and then measuring the absorbance value OD. 520 Absorbance OD 520 A value greater than 3.6 indicates a strain obtained from the secondary screening.
[0032] It should be noted that the above screening method is only an exemplary approach to obtaining the strain. Those skilled in the art can also use other mutagenesis methods or genetic engineering methods to obtain strains with the same functional characteristics (i.e., loss or reduction of NADH ubiquinone reductase function), and the present invention does not limit this.
[0033] In summary, the beneficial technical effects of the present invention are as follows: (1) A high-yielding L-malic acid-producing Saccharomyces cerevisiae strain with clear genetic characteristics is provided: The present invention obtains strain TC-6 through continuous mutagenesis screening, and gene sequencing analysis confirms that its Nde1 and Nde2 genes have frameshift mutations, resulting in the loss of NADH ubiquinone reductase function. The genetic characteristics of this strain are clear, which is convenient for industrial application and quality control.
[0034] (2) This invention reveals for the first time the mechanism by which the loss of NADH ubiquinone reductase function increases malic acid production by reducing pyruvate consumption: Through gene knockout experiments, this invention verifies that after disrupting the function of NADH ubiquinone reductase, mitochondrial electron transport is blocked, preventing pyruvate from entering the tricarboxylic acid cycle. Instead, pyruvate is reduced to L-malic acid by malate dehydrogenase in the cytoplasm, thereby significantly increasing production. This mechanism has been verified in *Saccharomyces cerevisiae*, *Pichia pastoris*, and *Yersinia lipolytica*, demonstrating its universality.
[0035] (3) It has industrial application prospects: The TC-6 strain of brewing yeast obtained in this invention has a yield of 38.9 g / L in shake flask fermentation, 258.4 g / L in 5 L fermenter, and 326.6 g / L in 50 L fermenter, with a conversion rate as high as 1.27 g / g, which has excellent industrial application prospects.
[0036] (4) A high-throughput screening method is provided: The methyl yellow indicator screening method provided by the present invention, combined with rotenone resistance screening, can effectively improve the screening efficiency and provide a technical means to obtain more superior strains. Attached Figure Description
[0037] Figure 1 The absorbance OD values of methyl yellow indicator (A) and acid eosin indicator (B) at different addition ratios are shown. 520 A linear relationship exists between the concentration of L-malic acid and the concentration of L-malic acid. Figure 2 The effects of UV mutagenesis time (A) and different concentrations of LiCl (B) on the lethality of the strain were shown. Figure 3 The number distribution of colony diameters in screening plates with different concentrations of rotenone is shown (A), and the relationship between single colonies of different diameters and L-malic acid concentration is shown (B). Figure 4 The shake-flask fermentation performance of the high-yielding L-malic acid strain screened in Example 4 of this application is shown; Figure 5 The shake-flask fermentation performance of the high-yielding L-malic acid strain screened in Example 5 of this application is shown; Figure 6 The L-malic acid production level of the high-yielding strain was shown during eight consecutive rounds of mutagenesis. Figure 7 The electrophoresis diagrams showing the PCR verification of gene knockout in each strain are displayed; Figure 8 The fermentation performance of the starting strain CEN.PK2-1C and the mutant strain TC-6 in a 5 L fermenter was shown; Figure 9 The fermentation performance of the mutant strain TC-6 in a 50 L fermenter was shown. Detailed Implementation
[0038] To provide a clearer understanding of the technical features, objectives, and beneficial effects of this application, the technical solution of the present invention will now be described in detail with reference to the following specific embodiments and accompanying drawings. However, this should not be construed as limiting the scope of implementation of the present invention.
[0039] Unless otherwise specified, the experimental methods in the following examples were performed according to standard procedures, and the materials and reagents used were all commercially available.
[0040] Required culture medium:
[0041] Seed culture medium (g / L): glucose 20, peptone 20, yeast extract 10; sterilized at 115℃ for 15 min.
[0042] Initial screening medium (g / L): glucose 20, peptone 20, yeast extract 10, rotenone 1.8; solid medium supplemented with 20 agar powder; sterilized at 115℃ for 15 min.
[0043] Secondary screening / fermentation medium (g / L): glucose 40, peptone 40, yeast extract 20; sterilized at 115℃ for 15 min.
[0044] Example 1: Selection of Indicator
[0045] Based on the pH change characteristics during the fermentation process of the selected strains, methyl yellow / acid eosin was chosen as the pH indicator. The fermentation medium was used as the solution, and L-malic acid was added at gradient concentrations of 20-160 g / L. Then, in 200 μL of fermentation medium, gradient proportions of the indicator (1 / 200, 1 / 100, 1 / 50, 1 / 25) were added. The reaction was carried out at room temperature for 30 min, and the absorbance (OD) was measured at the indicator's maximum visible light absorbance. 520 ,like Figure 1 As shown. The results indicate that when methyl yellow is used as an indicator, and the addition ratio is 1 / 25, there is a good linear relationship, OD 520 The linear equation for the presence of L-malic acid is y = 0.03331x + 2.2447.
[0046] Example 2: Lethality of strains induced by ultraviolet mutagenesis, LiCl mutagenesis, and combined mutagenesis
[0047] 2.1 Ultraviolet Mutagenesis
[0048] Single colonies from the agar plates were transferred to test tubes containing seed culture medium and incubated at 30°C with a shaker at 220 rpm for 16-20 hours. Then, 2% of the inoculum was transferred to shake flasks containing 50 mL of seed culture medium and incubated for 4-6 hours to prepare the bacterial suspension for mutagenesis. An 18W UV lamp was preheated for 20-30 minutes. After stabilization, 5 mL of the activated bacterial suspension was placed on each sterile agar plate. Under magnetic stirring, the bacterial suspension was irradiated with UV light at a distance of approximately 20 cm for 0 s, 10 s, 15 s, and 20 s. The irradiated bacterial suspension was then diluted to a specific concentration under a red light, and 100 μL was spread onto the agar plates. After incubation at 30°C in the dark for 3 days, single colonies on the plates were counted. The results are as follows: Figure 2 As shown in Figure A, when the UV irradiation time is greater than 20 s, the lethality exceeds 90%. Lethality = (number of colonies in the blank control group - number of colonies in the experimental group) / number of colonies in the blank control group * 100%.
[0049] 2.2 LiCl mutagenesis
[0050] Single colonies from the agar plates were transferred to test tubes containing seed culture medium and incubated at 30°C with a shaker at 220 rpm for 16-20 hours. Then, a 2% inoculum was transferred to shake flasks containing 50 mL of seed culture medium and incubated for 4-6 hours to prepare the bacterial suspension for mutagenesis. 100 μL of each diluted bacterial suspension was spread onto LiCl plates containing concentrations of 0, 0.2, 0.4, 0.6, 0.8, 1.0, and 1.2 g / L, respectively. After incubation at 30°C for 3 days, single colonies on the plates were counted. The results are shown below. Figure 2 As shown in B, when the LiCl concentration reaches 0.8 g / L, its lethality exceeds 90%.
[0051] 2.3 Composite Mutagenic Strains
[0052] Single colonies from the agar plates were transferred to test tubes containing seed culture medium and incubated at 30°C with a shaker at 220 rpm for 16-20 hours. Then, a 2% inoculum was transferred to a shake flask containing 50 mL of seed culture medium and incubated for 4-6 hours to prepare the bacterial suspension for mutagenesis. An 18W UV lamp was preheated for 20-30 minutes. After stabilization, 5 mL of the activated bacterial suspension was placed on each sterile agar plate. Under magnetic stirring, the bacterial suspension was irradiated with UV light at a distance of approximately 20 cm for 15-20 seconds. The irradiated bacterial suspension was then diluted to a certain concentration under red light and inoculated onto agar plates containing 0.8 g / L LiCl. After incubation at 30°C in the dark for 3 days, single colonies on the plates were counted, and the lethality of the combined mutagenesis was calculated. The lethality of the combined mutagenesis was 96.54%.
[0053] Example 3 Positive mutagenicity of rotenone screening
[0054] Rotenone, as a specific inhibitor of the mitochondrial electron transport chain, targets the inner membrane complex I. This compound competitively binds to the active site of NADH dehydrogenase, thereby blocking the transfer of electrons from NADH to ubiquinone. This inhibition leads to: 1) impaired electron transport and disintegration of the proton transmembrane gradient; 2) a significant decrease in the rate of ATP synthesis; and 3) the inability of pyruvate, a product of glycolysis, to enter the tricarboxylic acid cycle due to mitochondrial dysfunction, resulting in its reduction to L-malate in the cytoplasm by malate dehydrogenase.
[0055] Single colonies from the agar plates were transferred to test tubes containing seed culture medium and incubated at 30°C with a shaker at 220 rpm for 16-20 hours. Then, 2% of the inoculum was transferred to shake flasks containing 50 mL of seed culture medium and incubated for 4-6 hours to prepare the experimental bacterial suspension. After diluting the suspension by a certain factor, 100 μL of each suspension was spread onto agar plates containing 0, 0.6, 1.2, 1.8, and 2.4 g / L rotenone, respectively. After incubation at 30°C for 3 days, the size of the single colonies on the plates was counted. Three larger diameter colonies and three relatively smaller diameter colonies were randomly selected from each plate for shake-flask fermentation to verify the L-malic acid production. The results are as follows: Figure 3 As shown, the L-malic acid production of smaller-diameter colonies is greater than that of larger-diameter colonies. The increase in L-malic acid production is most significant when the rotenone concentration is 1.8 g / L compared to other rotenone concentrations.
[0056] Example 4: Screening Method for High-Yielding L-Malic Acid Strains
[0057] The bacterial suspension after UV-LiCl mutagenesis treatment for 15-20 s was diluted to 10... -2 10 -3 Two gradients were prepared, with 80-100 μL of each culture medium spread onto plates containing the initial screening medium. The plates were incubated at 30 °C for 3 days. Strains with relatively small colonies were then transferred to 96-well plates containing fermentation medium and incubated at 220 rpm and 30 °C for 48 h. After centrifugation at 5000 rpm for 30 min, 200 μL of the supernatant was transferred to an ELISA plate. 8 μL of methyl yellow indicator was added, and the reaction was carried out for 30 min. The absorbance (OD) at 520 nm was then measured using an ELISA reader. 520 The result is as follows Figure 4 As shown, strains with absorbance values greater than 3.6 were selected for shake-flask fermentation verification in this batch, and strain H9 was found to produce 6.36 g / L of L-malic acid, which is at least 160% higher than the starting strain.
[0058] Example 5: Screening Method Two for High-Yielding L-Malic Acid Strains
[0059] Single colonies from the agar plate were transferred to test tubes containing seed culture medium and incubated at 30°C with a shaker at 220 rpm for 16-20 h. Then, 2% of the culture was inoculated into shake flasks containing 50 mL of seed culture medium and incubated for 24 h. An additional 40-60 g / L of L-malic acid was added to the seed culture medium (the concentration was gradually increased as L-malic acid production increased). The bacterial suspension after UV-LiCl mutagenesis treatment for 15-20 s was diluted to 10... -2 10 -3 Two gradients were prepared, with 80-100 μL of each culture medium spread onto plates containing the initial screening medium. The plates were incubated at 30 °C for 3 days. Strains with relatively small colonies were then transferred to 96-well plates containing fermentation medium and incubated at 220 rpm and 30 °C for 48 h. After centrifugation at 5000 rpm for 30 min, 200 μL of the supernatant was transferred to an ELISA plate. 8 μL of methyl yellow indicator was added, and the reaction was carried out for 30 min. The absorbance (OD) at 520 nm was then measured using an ELISA reader. 520 Strains with absorbance values greater than 4.8 were selected for shake-flask fermentation verification. The results are as follows: Figure 5 As shown, strain F7 produced 12.3 g / L of L-malic acid, which was at least 98.7% higher than that of the original strain.
[0060] Example 6: Serial Mutagenesis of High-Yielding L-Malic Acid Strains
[0061] Using the high-yielding strain F7 obtained in Examples 4 and 5 as the target for compound mutagenesis, the operation method for compound mutagenesis was the same as in Examples 4 and 5, and eight rounds of mutagenesis were performed continuously. Finally, a high-yielding Saccharomyces cerevisiae strain producing L-malic acid was obtained, named TC-6. After being cultured in fermentation medium for 48 h, its L-malic acid yield reached 38.9 g / L (e.g., ...). Figure 6 (As shown).
[0062] Example 7 Sequencing analysis of mitochondrial respiratory chain-related genes in mutant strains
[0063] Given that *Saccharomyces cerevisiae* mitochondria lack the typical electron transport chain complex I, and its functional portion is mediated by the non-proton pump NADH dehydrogenase, to investigate the mechanism of mitochondrial functional changes in the mutant strain TC-6, the Nde1, Nde2, and Ndi1 genes in strain TC-6 were sequenced. The specific sequences obtained are shown in SEQ ID NO: 1-SEQ ID NO: 3, respectively. Sequence alignment with the wild-type control strain CEN.PK2-1C revealed a single-base insertion at position 656 in the coding region of the Nde1 gene. This mutation caused a frameshift in the subsequent reading frame, resulting in premature generation of a stop codon and loss of protein function. Single-base insertions were also detected at positions 791 and 804 in the coding region of the Nde2 gene. This mutation caused a frameshift in the subsequent reading frame, resulting in premature generation of a stop codon and loss of protein function. The Ndi1 gene sequence was completely identical to the wild-type, with no mutations found.
[0064] Example 8: Knockout of the NADH ubiquinone reductase encoding gene in Saccharomyces cerevisiae and verification of malate production To verify that the disruption of NADH ubiquinone reductase (EC 1.6.5.9) has a significant impact on malic acid production in Saccharomyces cerevisiae, this enzyme is encoded by the genes Nde1 (Uniprot database search number: P40215), Nde2 (Uniprot database search number: Q07500), and Ndi1 (Uniprot database search number: P32340). Since Nde1 and Nde2 were mutated in the mutagenesis of the TC-6 strain mentioned above, Nde1 and Nde2 were knocked out.
[0065] 1. Construction of the knockout box Using the genome of the wild-type control strain CEN.PK2-1C as a template, the upstream homologous fragment 1 of Nde1 was amplified using primers Nde1-1-F and Nde1-1-R (see primer sequence listing), and the downstream homologous arm fragment 2 of the Nde1 gene was amplified using primers Nde1-2-F and Nde1-2-R (see primer sequence listing). Using fragment 1 and fragment 2 as templates, the Nde1 knockout cassette was obtained by fusion PCR using primers Nde1-1-F and Nde1-2-R. The upstream homologous fragment 3 of Nde2 was amplified using primers Nde2-1-F and Nde2-1-R (see primer sequence listing), and the downstream homologous arm fragment 4 of the Nde1 gene was amplified using primers Nde2-2-F and Nde2-2-R (see primer sequence listing). Using fragment 3 and fragment 4 as templates, the Nde2 knockout cassette was obtained by fusion PCR using primers Nde2-1-F and Nde2-2-R. The amplification system and procedure were performed in accordance with the Novizan P505 product manual.
[0066] 2. Gene knockout and positive transformant screening The Nde1 site was knocked out via homologous recombination. Following yeast chemical transformation, the Nde1 knockout cassette was transformed into CEN.PK2-1C strain. Positive transformants were obtained by screening with primers YZ-Nde1-F and YZ-Nde1-R (see primer sequence listing). The control band was 2808 bp, and the positive transformant band was 1185 bp (results are shown in the figure). Figure 7 A), named SC-1. The Nde2 site was knocked out via homologous recombination. Following yeast transformation methods, the Nde2 knockout cassette was transformed into the SC-1 strain. Positive transformants were obtained by screening with primers YZ-Nde2-F and YZ-Nde2-R (see primer sequence listing). The control band was 2826 bp, and the positive transformant band was 1171 bp (results are shown in Figure 1). Figure 7 B), named SC-2.
[0067] 3. Fermentation verification The starting strain CEN.PK2-1C and the knockout strain SC-2 were inoculated and subjected to shake-flask fermentation at 30℃, 220 rpm, and for 48 h. The malic acid yield of SC-2 reached 8.2 g / L, which was 256.5% higher than that of the starting strain CEN.PK2-1C (2.3 g / L).
[0068] Example 9: Knockout of the NADH ubiquinone reductase encoding gene and verification of malate production in Pichia pastoris kudrica. To verify the effect of NADH ubiquinone reductase (EC 1.6.5.9) disruption on malic acid production in other strains, this case study uses *Pichia pastoris* (Kudela spp.) as an example. Pichia kudriavzevii The enzyme was validated for the model strain. In *Saccharomyces cerevisiae*, it is encoded by the genes Nde1, Nde2, and Ndi1, while in *Pichia kudrica* it is encoded by the genes C5L36_0A09630 (Uniprot database search number: A0A1V2LH13) and C5L36_0B04540 (Uniprot database search number: A0A099P4E1).
[0069] The starting strain was *Pichia kudrica* (CICC33524), purchased from the China Industrial Microbial Culture Collection Center, and named PK.
[0070] 1. Construction of the knockout box Using PK genomic DNA as a template, the upstream homologous arm fragment 5 of the C5L36_0A09630 gene was amplified using primers A-1-F and A-1-R (see primer sequence listing); the downstream homologous arm fragment 6 of the C5L36_0A09630 gene was amplified using primers A-2-F and A-2-R (see primer sequence listing); using fragments 5 and 6 as templates, the C5L36_0A09630 knockout cassette was obtained by fusion PCR using primers A-1-F and A-2-R. The upstream homologous arm fragment 7 of the C5L36_0B04540 gene was amplified using primers B-1-F and B-1-R (see primer sequence listing); the downstream homologous arm fragment 8 of the C5L36_0B04540 gene was amplified using primers B-2-F and B-2-R (see primer sequence listing); using fragments 7 and 8 as templates, the C5L36_0B04540 knockout cassette was obtained by fusion PCR using primers B-1-F and B-2-R. The amplification system and procedure followed the Novizan P505 product instructions.
[0071] 2. Gene knockout and positive transformant screening The C5L36_0A09630 site was knocked out via homologous recombination. Following yeast chemical transformation methods, the C5L36_0A09630 knockout cassette was transformed into PK strain. Positive transformants were obtained by screening with primers YZ-AF and YZ-AR (see primer sequence listing). The control band size was 3460 bp, and the positive transformant band size was 1023 bp (results are shown in the figure). Figure 7 C), named PK-1. The C5L36_0B04540 site was knocked out via homologous recombination. Following yeast transformation methods, the C5L36_0B04540 knockout was cascaded and transformed into the PK-1 strain. Positive transformants were obtained by screening with primers YZ-BF and YZ-BR (see primer sequence listing). The control band size was 2983 bp, and the positive transformant band size was 1257 bp (results are shown in the figure). Figure 7 D), named PK-2.
[0072] 3. Fermentation verification The starting strain PK and the knockout strain PK-2 were inoculated and fermented in shake flasks at 30 ℃, 220 rpm, for 48 h. The malic acid concentration of PK-2 reached 6.13 g / L, an increase of 217.5% compared to the starting strain PK (1.89 g / L).
[0073] Example 10: Knockout of the NADH ubiquinone reductase encoding gene in Yersinia lipolytica and verification of malate production To verify the effect of NADH ubiquinone reductase (EC 1.6.5.9) disruption on malic acid production in other strains, this case study uses *Yarrowia lipolytica* (…). Yarrowia lipolytica The model strain was validated. In Yersinia lipophila, it is encoded by the genes YALI1_F32476g (Uniprot database search number: A0A1H6PNF3) and YALI1_E06573g (Uniprot database search number: A0A1D8NH95).
[0074] The starting strain was YL, which was purchased from the China Industrial Microbial Culture Collection Center and named YL.
[0075] 1. Construction of the knockout box Using YL genomic DNA as a template, the upstream homologous arm fragment 9 of the YALI1_F32476g gene was amplified using primers C-1-F and C-1-R (see primer sequence listing); the downstream homologous arm fragment 10 of the YALI1_F32476g gene was amplified using primers C-2-F and C-2-R (see primer sequence listing); using fragments 9 and 10 as templates, the YALI1_F32476g knockout cassette was obtained by fusion PCR using primers C-1-F and C-2-R. The upstream homologous arm fragment 11 of the YALI1_E06573g gene was amplified using primers D-1-F and D-1-R (see primer sequence listing); the downstream homologous arm fragment 12 of the YALI1_E06573g gene was amplified using primers D-2-F and D-2-R (see primer sequence listing); using fragments 11 and 12 as templates, the YALI1_E06573g knockout cassette was obtained by fusion PCR using primers D-1-F and D-2-R. The amplification system and procedure were performed according to the Novizan P505 product instructions.
[0076] 2. Gene knockout and positive transformant screening The YALI1_F32476g site was knocked out via homologous recombination. Following yeast chemical transformation methods, the knockout YALI1_F32476g was cascaded and transformed into the YL strain. Positive transformants were obtained by screening with primers YZ-CF and YZ-CR (see primer sequence listing). The control band size was 3172 bp, and the positive transformant band size was 1423 bp (results are shown in the figure). Figure 7The YALI1_E06573g site was knocked out via homologous recombination. Following yeast transformation methods, the knockout YALI1_E06573g was cascaded and transformed into YL-1. Positive transformants were obtained by screening with primers YZ-DF and YZ-DR (see primer sequence listing). The control band was 3205 bp, and the positive transformant band was 1189 bp (results are shown in the figure). Figure 7 F), named YL-2.
[0077] 3. Fermentation verification The starting strain YL and the knockout strain YL-2 were inoculated and fermented in shake flasks at 30 ℃, 220 rpm, for 48 h. The malic acid concentration of YL-2 reached 5.84 g / L, an increase of 253.9% compared to the starting strain YL (1.65 g / L).
[0078] Example 11 Validation of mutant strain TC-6 in a 5L fermenter At a 4% inoculum rate, overnight mutant strain TC-6 culture was inoculated into a 500 mL flask containing 100 mL of seed culture medium and cultured for 36 h (30℃, 220 rpm). Subsequently, at a 10% inoculum rate, the seed culture was inoculated into a 5 L fermenter containing 2.7 L of fermentation medium, resulting in a total fermentation volume of approximately 3 L. The stirring speed was 400–500 rpm, the aeration rate was 1.0 vv / m, and the culture temperature was 30℃. During fermentation, a total of 120 g / L of glucose was fed, and the final fermentation volume was approximately 3.4 L. The L-malic acid content in the fermentation products was quantitatively determined using high-performance liquid chromatography (HPLC), and the results are as follows: Figure 8 As shown, the highest L-malic acid yield of the starting strain CEN.PK2-1C was 12.6 g / L, while the highest L-malic acid yield of the mutant strain TC-6 was 258.4 g / L, with a conversion rate of 1.22 g / g.
[0079] Example 12 Validation of mutant strain TC-6 in a 50 L fermenter At a 4% inoculum rate, overnight mutant strain TC-6 culture was inoculated into five 1000 mL flasks containing 300 mL of seed culture medium and cultured for 36 h (30℃, 220 rpm). Subsequently, at a 5% inoculum rate, the seed culture was inoculated into a 50 L fermenter containing 28.5 L of fermentation medium, for a total fermentation volume of approximately 30 L. The stirring speed was 300–400 rpm, the aeration rate was 1.0 vv / m, and the culture temperature was 30℃. During fermentation, a total of 150 g / L of glucose was fed, and the final fermentation volume was 35 L. The L-malic acid content in the fermentation products was quantitatively determined using high-performance liquid chromatography (HPLC), and the results are as follows: Figure 9 As shown, the mutant strain TC-6 produced the highest yield of L-malic acid at 326.6 g / L, with a conversion rate of 1.27 g / g.
[0080] Primer sequence listing Nde1-1-F GCATTACTCTGGCCTCAGCGG Nde1-1-R TGAATCTCTACAGTTAGCCCACACTGTTTTC Nde1-2-F GTGTGGGCTAACTGTAGAGATTCATCTATCTA Nde1-2-R ACCAAATACTAAAGATGAG YZ-Nde1-F ATCCCGTCGATCGCATTTG YZ-Nde1-R GGAGTTGGAAATTACGTGC Nde2-1-F GTTGGTATTGCTAGAAATGCTTC Nde2-1-R TGGAACAATGCTATACGAATGGCAAGTACG Nde2-2-F ATTCGTATAGCATTGTTCCAATTCAAATTG Nde2-2-R AGGAACCTTTCTTGTCGCCAG YZ-Nde2-F GTCTCTTTGATTACCTCTAG YZ-Nde2-R TCAATGATGGCTCTTGATA C-1-F cgcacggttacagtattacctcaa C-1-R gtttatgcgcgtttgcgggtcgaagaggt C-2-F acccgcaaacgcgcataaacctatacaataa C-2-R gaatcttgtgtttggcgttga YZ-CF atggaccaaggcgtcaagt YZ-CR cgcatccacttgtcgacat D-1-F tgctcaagccgtttggagtcct D-1-R cattctatgggttgtggatgatgcagaa D-2-F catccacaacccatagaatgatgattcat D-2-R ctcagatgtcgctgatagta YZ-DF aaccgcggtccactcca YZ-DR ctatgtcgacttgctaaac
[0081] Of course, the above description is only a specific embodiment of this application and is not intended to limit the scope of the invention. All equivalent changes or modifications made in accordance with the features and principles described in the claims of this invention should be included in the claims of this invention.
Claims
1. A yeast strain that produces high levels of L-malic acid, characterized in that, The yeast strain exhibits loss or reduction of NADH ubiquinone reductase function.
2. The yeast strain according to claim 1, characterized in that, The loss or reduction of function of the NADH ubiquinone reductase is caused by mutations in its encoding gene.
3. The strain according to claim 1, characterized in that, The yeast strain is selected from Saccharomyces cerevisiae (Saccharomyces cerevisiae). Saccharomyces cerevisiae ), Kudria zweipichia yeast ( Pichia kudriavzevii ) or Yersinia lipophila ( Yarrowia lipolytica ).
4. The yeast strain according to claim 2, characterized in that, The encoding gene includes: (a) The Nde1 and / or Nde2 genes in Saccharomyces cerevisiae; (b) The C5L36_0A09630 gene and / or the C5L36_0B04540 gene in *Pichia kudrica*; or (c) YALI1_F32476g and / or YALI1_E06573g genes in Yersinia lipolytica.
5. The yeast strain according to claim 4, characterized in that, The mutations include: a single base insertion at position 656 in the Nde1 gene; and / or a single base insertion at position 791 and / or position 804 in the Nde2 gene.
6. The strain according to claim 1, characterized in that, The yeast strain is classified as Saccharomyces cerevisiae TC-6 and is deposited at the China General Microbiological Culture Collection Center with accession number CGMCC No. 35988.
7. The use of the brewing yeast as described in any one of claims 1-6 in any one or more of the following: A1: Production of L-malic acid; A2: Reagents or kits for preparing L-malic acid; A3: Constructing a genetically engineered strain that produces high levels of L-malic acid; A4: Production of downstream products of malic acid, including at least succinic acid and fumaric acid.