siCAD, active nanoparticles, drugs, preparation and application for anti-colorectal cancer

CN122542541APending Publication Date: 2026-08-11XIANGYA HOSPITAL CENT SOUTH UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-16
Publication Date
2026-08-11

AI Technical Summary

Technical Problem

这些局限性凸显了单纯靶向单一通路的不足,亟需开发具有多功能调控作用的新型治疗靶点

Benefits of technology

[0043] This invention demonstrates that the siCAD described herein can achieve effective treatment of colorectal cancer based on the CAD inhibition mechanism.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122542541A_ABST
    Figure CN122542541A_ABST
Patent Text Reader

Abstract

This invention belongs to the field of anticancer drugs, specifically relating to siCAD for colorectal cancer, active nanoparticles, drugs, preparation, and applications. The siCAD for colorectal cancer is an siRNA having at least one sequence from SEQ ID NO.1 to SEQ ID NO.3; SEQ ID NO.1: GTATGAGGGTCTCTTCTTA; SEQ ID NO.2: GCTTCTAGCGTTGAATTTGA; SEQ ID NO.3: GTGATCGACTCTACTTTGA. This invention also includes active nanoparticles containing the siCAD for colorectal cancer. Research in this invention shows that the siCAD can effectively inhibit and treat colorectal cancer based on the inhibition of CAD.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of pharmaceuticals, specifically relating to pharmaceuticals for treating colorectal cancer. Background Technology

[0002] Colorectal cancer (CRC) is a common malignant tumor, and its incidence continues to rise, especially among young people, highlighting its importance as a global health problem.

[0003] Although early-stage colorectal cancer can usually be treated with surgical resection, with a five-year survival rate exceeding 90%, more than half of patients are diagnosed at an advanced stage, significantly increasing the difficulty of treatment. Treatment for advanced colorectal cancer primarily relies on systemic therapy, but this approach has significant limitations. Standard chemotherapy regimens such as FOLFOX / FOLFIR are often accompanied by significant off-target toxicities, while targeted biologics (such as bevacizumab and cetuximab) are limited by tumor heterogeneity and acquired resistance. Immune checkpoint inhibitors are only effective in approximately 5% of patients with microsatellite instability-high (MSI-H) tumors, leaving most microsatellite stable (MSS) cases without effective immunotherapy options.

[0004] These limitations highlight the urgent need to develop novel targeted therapies. Nanotechnology offers a highly promising solution. Nanoparticles (NPs), with their unique physicochemical properties and tunable structures, have become ideal carriers for precision oncology. Their 1-1000 nanometer size enables preferential accumulation at tumor sites through enhanced permeation and retention (EPR) effects. Surface modifications (such as hyaluronic acid, HA) to bind to the overexpressed CD44 receptor in colorectal cancer can significantly improve passive targeting, promote receptor-mediated endocytosis, and thus enhance tumor specificity. The combined use of passive and active strategies can significantly improve intratumoral accumulation and cellular uptake efficiency. Furthermore, nanocarrier technology can also achieve simultaneous delivery of chemotherapeutic drugs and gene therapy, overcoming the pharmacokinetic limitations of traditional therapies and producing synergistic effects. Crucially, the clinical application value of nanotherapeutic drugs depends on the precise identification and validation of suitable molecular targets.

[0005] Current molecularly targeted therapies for colorectal cancer (CRC) still face efficacy bottlenecks. The KRAS gene has a high mutation rate of 30%-40%, encodes a compact and conformationally stable protein with limited binding sites, leading to resistance to traditional inhibitors. While KRAS G12C inhibitors are effective in certain subtypes, their applicability is still limited by mutation type. Similarly, EGFR-targeted therapy is constrained by compensatory feedback mechanisms—including HER2 amplification, MET dysregulation, and mutations in downstream PI3K / AKT / mTOR pathways—which can trigger resistance. For CRC patients carrying the BRAF V600E mutation, inhibitor efficacy is often transient due to MAPK pathway reactivation. These limitations highlight the inadequacy of simply targeting a single pathway, necessitating the development of novel therapeutic targets with multifunctional regulatory functions. Summary of the Invention

[0006] In view of the shortcomings in the treatment of colorectal cancer, the primary objective of this invention is to provide a siCAD for treating colorectal cancer, which aims to achieve the treatment of colorectal cancer based on a novel mechanism of action.

[0007] A second objective of this invention is to provide the application of the aforementioned siCAD in the preparation of anti-colon cancer drugs.

[0008] A third objective of this invention is to provide active nanoparticles containing the siCAD for colorectal cancer treatment, aiming to synergistically enhance the therapeutic effect against colorectal cancer based on the combination of components and structure.

[0009] The fourth objective of this invention is to provide a method for preparing the aforementioned active nanoparticles and their application in the preparation of anti-colon cancer drugs.

[0010] The fifth objective of this invention is to provide an anti-colon cancer drug comprising the siCAD and the active nanoparticles.

[0011] A siCAD for colorectal cancer is an siRNA having at least one sequence from SEQ ID NO.1 to SEQ ID NO.3;

[0012] SEQ ID NO.1: GTATGAGGGTCTCTTCTTA;

[0013] SEQ ID NO.2: GCTCTAGCGTTGAATTTGA;

[0014] SEQ ID NO. 3: GTGATCGACTCTACTTTGA.

[0015] This invention demonstrates that the siCAD described herein can effectively inhibit and treat colorectal cancer based on the inhibition of CAD.

[0016] Preferably, the siCAD is the sequence of SEQ ID NO.2. This invention demonstrates that the siCAD of SEQ ID NO.2 can unexpectedly further enhance the therapeutic effect against colorectal cancer based on the inhibition of CAD.

[0017] The present invention also provides the application of the siCAD described herein in the preparation of anti-colorectal cancer drugs.

[0018] This invention demonstrates that the siCAD described herein can achieve effective treatment of colorectal cancer based on the CAD inhibition mechanism.

[0019] The present invention also provides an active nanoparticle for resisting colorectal cancer, comprising a substrate loaded with an active ingredient and an HA (hyaluronic acid) layer coated on the surface of the substrate; the active ingredient includes component A; component A is siCAD as described in 1.

[0020] This invention provides nanoparticles carrying siCAD, which, based on the combination of nanoparticles and structure, can adapt to the microenvironment of colorectal cancer and further synergistically improve the therapeutic effect of colorectal cancer.

[0021] In this invention, the substrate is nickel-copper composite sulfide nanoparticles with a particle size of 5-100 nm; the molar ratio of nickel to copper is 1:3-5.

[0022] In this invention, the copper and nickel in the nickel-copper composite nanoparticles are adapted to the microenvironment of colorectal cancer cells, facilitating the reaction with H2O2 in the tumor microenvironment to generate ROS and metal ions. The metal ions, after accumulating in the mitochondria of colorectal cancer tumor cells, bind to lipacylases (FDX1, DLAT), leading to iron-sulfur cluster dysregulation and copper death responses due to protein toxicity stress, inducing apoptosis and inhibiting autophagy flux to alleviate pyroptosis inhibition.

[0023] The combination of the substrate and the active ingredient described in this invention can further achieve synergy and enhance the therapeutic effect of colorectal cancer.

[0024] In this invention, the active ingredient further includes component B; component B is a compound having the structure of Formula 1 and its pharmaceutically acceptable salt, crystal or solvate.

[0025] Formula 1

[0026] In Formula 1, R1 and R2 are C1 to C4 alkyl groups; X is a halogen.

[0027] This invention demonstrates that the innovative combination of components A and B, along with the combined control of the substrate and HA coating structure, can further achieve synergistic effects of the components and structures, thereby enhancing the anti-cancer effect on colorectal cancer.

[0028] In this invention, the content of the components can be reasonably adjusted as needed. For example, in the active nanoparticles, the loading of component A is 1~30%; the loading of component B is 10~20 wt.%; and the loading of HA is 1~60%. The HA coating rate (encapsulation rate) of the active nanoparticles is 50~80%, and the D50 is 100~120 nm.

[0029] Furthermore, in the active nanoparticles, the content of component A can be 0.05~0.5 μmol / mg; preferably 0.1~0.2 μmol / mg. The content of component B is 10~20 wt.%.

[0030] The present invention also provides a method for preparing the active nanoparticles for anti-colorectal cancer, wherein water-soluble nickel salt, water-soluble copper salt, reducing agent, water-soluble sulfide and HA are mixed and reacted to obtain HA / substrate; the HA / substrate and active ingredients are composite loaded to obtain the product.

[0031] In this invention, the water-soluble nickel salt and the water-soluble copper salt are at least one of the sulfate, chloride, and nitrate salts of their respective metals.

[0032] Preferably, the elemental molar ratio of Cu / Ni in the water-soluble copper salt and water-soluble nickel salt can be 3~5:1.

[0033] Preferably, the reducing agent can be hydrazine hydrate.

[0034] Preferably, the ratio of the total molar amount of (Ni+Cu) in the reducing agent and the water-soluble nickel salt and water-soluble copper salt is 0.1~10:1; more preferably 1:3~5.

[0035] Preferably, the total molar ratio of (Ni+Cu) in the water-soluble sulfide, water-soluble nickel salt, and water-soluble copper salt is 10~50:1; more preferably, it can be 35~45:1.

[0036] Preferably, the ratio of HA to the total weight of water-soluble nickel salt and water-soluble copper salt is 10~30:1; more preferably, it is 20~25:1.

[0037] The weight ratio of HA / base and active ingredient is 1:0.01~1.

[0038] Furthermore, the weight ratio of HA / substrate to Formula 1 is 1~10:1, and can be further 4~6:1;

[0039] The molar ratio of siCAD to the weight of HA / substrate / Formula 1 is 0.05~0.5 μmol / mg; preferably 0.1~0.2 μmol / mg.

[0040] The present invention also provides the application of the aforementioned active nanoparticles for treating colorectal cancer in the preparation of drugs for treating colorectal cancer.

[0041] The present invention also provides an anti-colorectal cancer drug comprising a pharmaceutically effective amount of an anti-colorectal cancer component, wherein the anti-colorectal cancer component comprises at least one of the aforementioned siCAD and the aforementioned active nanoparticles.

[0042] Beneficial effects

[0043] This invention demonstrates that the siCAD described herein can achieve effective treatment of colorectal cancer based on the CAD inhibition mechanism.

[0044] This invention provides nanoparticles carrying siCAD, which, based on the combination of nanoparticles and structure, can adapt to the microenvironment of colorectal cancer and further synergistically improve the therapeutic effect of colorectal cancer. Attached Figure Description

[0045] Figure 1 CAD is highly expressed in CRC and has clinical significance;

[0046] A) Using RNA-seq data from TCGA, compare the differential expression levels of CAD in tumor tissues and normal tissues of COAD and READ (Wilcoxon rank-sum test, asterisks). (a) Numbers 1 to 4 represent p-values ​​less than 0.05, 0.01, 0.001, and 0.0001, respectively); B) Kaplan-Meier analysis showing the prognostic value of coronary artery disease (CAD); C) Relative mRNA levels of CAD in 34 pairs of colorectal cancer (CRC) samples; D) Representative expression of CAD in human CRC tissue compared to normal intestinal tissue in tissue microarrays (D) and IHC analysis (E) (n=90 pairs); F) Relative protein levels of adjacent normal tissue (CAD) in four pairs of colorectal cancer (CRC) samples. pa: adjacent normal tissue; ca: cancerous tissue; G) Relative protein levels of CAD in normal intestinal cells and colorectal cancer (CRC) cell line samples.

[0047] Figure 2 Validation of CAD as a target for the treatment of colorectal cancer (CRC) based on a nanoplatform;

[0048] A) Representative images from the colorectal cancer cell colony formation assay (n=3); B) Representative images from the colorectal cancer cell migration assay (n=3); C) Representative images from the colorectal cancer cell invasion assay (n=3); D) Representative images from the EdU detection assay in colorectal cancer cells (n=3); E) Representative images from the colorectal cancer cell apoptosis assay (n=3). (F) Changes in the expression of CAD, Bcl-2, and Bax in colorectal cancer cells transfected with shNC or shCAD (n=3). Data are expressed as mean ± standard deviation; data without significant differences are labeled as ns. P < 0.05, P < 0.01, P < 0.001.

[0049] Figure 3 CAD promotes tumor development and metastasis in the body

[0050] A) Tumor growth, tumor weight, and tumor volume in mice injected with shNC or shCAD CRC cells (n = 4); B) Tumor growth, tumor weight, and tumor volume in mice injected with vector or OE-CAD colorectal cancer cells (n = 4). Stable CRC cell lines were injected into nude mice via tail vein (n = 4 per group); C) Lung tumors were collected immediately after euthanasia, and the number of tumor nodules was counted. In representative images, HE-stained images show tumor nodules and statistical quantification results. Data are expressed as mean ± standard deviation; no significant difference is indicated as ns. P < 0.05, P < 0.01, P < 0.001.

[0051] Figure 4 Design and validate material effectiveness

[0052] A) TEM micrographs showing morphological changes in samples with different sodium sulfide concentrations; B) TEM micrographs elucidating the morphological changes of NCSH-3; C) XRD pattern of NCSH-3; D) XPS spectrum of NCSH-3; E) FTIR spectrum of NCSH-3; F) Four CAD-targeting siRNAs and siNC were packaged into lentiviral vectors and transduced into HCT116 cells. CAD protein levels were detected by Western blotting; G) UV-Vis absorption spectroscopy and standard curve analysis of NCSH@Formula 1A & siRNA to determine the encapsulation efficiency of Formula 1A and siRNA; H) TEM micrographs elucidating the morphological changes of NCSH@Formula 1A & siRNA biodegradation at different pH values ​​triggered by simulated CRC TME; I) Fluorescence images of hydrogen sulfide in HCT116 cells of different treatment groups using WSP-1. Data are expressed as mean ± standard deviation; no significant difference is indicated as ns. P < 0.05, P < 0.01, P < 0.001.

[0053] Figure 5 Evaluation of TME responsiveness and drug release in nanoplatforms

[0054] AB) TEM images and zeta analysis of NCSH@Formula 1A (A) and NCSH@Formula 1A&siCAD (B); C) EDX analysis of NCSH@Formula 1A&siCAD; DE) DLS analysis of NCSH, NCSH@Formula 1A and NCSH@Formula 1A&siCAD; F) Nitrogen adsorption-desorption analysis of NCSH and NCSH@Formula 1A&siCAD; G) Stability of NCSH@Formula 1A&siCAD in DMEM (10% FBS); HI) Hemolysis analysis (H) and representative images (I) of NCSH@Formula 1A&siCAD; JK) In vitro release analysis of Ni (J) and Cu (K) in NCSH@Formula 1A&siCAD; LM) TMB reagent colorimetric analysis of NCSH@Formula 1A&siCAD; N) DTNB reagent decolorization analysis of NCSH@Formula 1A&siCAD.

[0055] Figure 6 Detection of cellular uptake and in vitro antitumor mechanisms

[0056] A) Representative CLSM images of HCT116 cells stained with Cy7-labeled NCSH@Formula 1A & siCAD; B) Comparative fluorescence images of 293T cells and HCT116 cells stained with Cy7-labeled NCSH@Formula 1A & siCAD; C) Proliferation experiments of HCT116 cells after different treatments; D) Live / dead staining results of HCT116 cells after different treatments. Green and red fluorescence represent live and dead cells, respectively; E) Mitochondrial membrane potential of HCT116 cells after different treatments, measured using the JC-1 method; F) Intracellular ROS levels observed by DCFH-DA after treatment; G) Scanning electron microscopy images of mitochondria in HCT116 cells treated with PBS or NCSH@Formula 1A and siCAD; H) ATP secretion of HCT116 cells after different treatments (n=3); I) GSH content in HCT116 cells after different treatments (n=3). (J). Changes in the expression of DLAT and FDX1 in HCT116 cells after different treatments; K) Representative CLSM images of HCT116 cells stained with different treatments. Data are expressed as mean ± standard deviation, and no significant difference is indicated as ns. P < 0.05, P < 0.01, P < 0.001.

[0057] Figure 7 Evaluation of antitumor activity and biodistribution in subcutaneous tumor models

[0058] A) Schematic diagram of subcutaneous tumor model establishment and treatment; BD) Representative whole-body bioluminescence images and ex vivo images of mice in different treatment groups measured using the IVIS imaging system (B), quantitative results are expressed as mean ± SD (n = 4 independent experiments) (CD); E) Representative quantitative results of ex vivo tumor images captured using the IVIS imaging system are expressed as mean ± standard deviation (n = 4 independent experiments); FG) Representative images of subcutaneous tumor (F) and tumor weight (G). Data are expressed as mean ± standard deviation, and no significant difference is indicated as ns. P < 0.05, P < 0.01, P < 0.001.

[0059] Figure 8 Assessment of antitumor activity and biodistribution in in situ models

[0060] A) Schematic diagram of in situ model establishment and processing; B) Representative images of in situ tumors; C) Representative images of CAD H&E staining (top) and immunofluorescence (bottom).

[0061] Figure 9 Biosafety assessment – ​​complete blood count, blood biochemistry

[0062] A) Routine blood tests in mice after intravenous injection of NCSH@Formula 1A & siCAD (n=3 independent experiments); B) Biochemical tests in mice after intravenous injection of NCSH@Formula 1A & siCAD (n=3 independent experiments). Data are expressed as mean ± standard deviation; data with no significant difference are labeled as ns. P < 0.05, P < 0.01, P < 0.001.

[0063] Figure 10 Biosafety assessment – ​​H&E staining of organs.

[0064] Figure 11 Biosafety assessment – ​​ICP-MS analysis of blood. Detailed Implementation

[0065] Part 1: Material Preparation

[0066] Formula 1A (also known as AVT-18A) is a formula where R1 / R2 are both methyl groups and X is F.

[0067] Preparation Example 1

[0068] 1) Mix 12.5 mL of an aqueous solution containing 2.0 mM CuCl2 and 0.5 mM NiCl2 with 100 mg of hyaluronic acid (molecular weight 5w); stir and mix.

[0069] 2) Then add 100 μL of 1M N2H4 solution (hydrazine hydrate) to the solution and stir for 20 minutes;

[0070] 3) Immediately afterwards, 320 mg / mL of Na2S·9H2O solution was added to the solution, and the mixture was heated at 60 °C for 2.5 hours to obtain NCSH nanoparticles;

[0071] 4) The obtained NCSH nanoparticles were centrifuged and washed three times at 10,000 rpm before being stored;

[0072] 5) Mix 5.0 mL of NCSH nanoparticle dispersion (5.28 mg / mL) with 5.0 mL of Formula 1A cryopreservation solution (1.0 mg / mL) by sonication (100 W, 40 kHz);

[0073] 6) Perform mechanical stirring at room temperature for 24 hours;

[0074] 7) After the reaction is complete, the sample is centrifuged at 20,000 xg for 15 minutes at 4℃. The precipitate is washed three times with deionized water to obtain NCSH@1A nanocomposite material.

[0075] 8) NCSH® 1A nanoparticles were filtered through a 0.22 μm filter membrane;

[0076] 9) After filtration through a 0.22 μm filter membrane, the mixture was ultrasonically dispersed (100 W, 40 kHz) in DEPC (diethyl pyrocarbonate) treated water to a concentration of 2.5 mg / mL (NCSH@1A nanoparticle suspension).

[0077] 10) Prepare siRNA working solution (0.25 μM) using DEPC water;

[0078] 11) Mix an equal volume of NCSH@1A nanoparticle suspension with siRNA working solution and sonicate (100 W, 40 kHz, 30 min).

[0079] 12) Place the mixture on a shaker (200 rpm) and incubate at 37°C for 12 hours;

[0080] 13) The complex NCSH@siCAD&Formula 1A is formed under capillary adsorption and van der Waals interaction. NCSH@siCAD&Formula 1A (also known as NCSH@Formula 1A&siRNA) is separated by centrifugation, resuspended in DEPC water and stored at -20°C.

[0081] In NCSH@Formula 1A & siRNA, Formula 1A has a drug loading of 12.8% and an encapsulation efficiency of 67.5%; in addition, siCAD has a loading efficiency of 100%.

[0082] Preparation Example 2: Preparation of NCSH @siCAD

[0083] Compared to Preparation Example 1, the main difference is that steps 5 to 9 are omitted. The main difference lies in the following steps:

[0084] NCSH nanoparticles were filtered through a 0.22 μm filter membrane and then ultrasonically dispersed (100 W, 40 kHz) in DEPC-treated water to a concentration of 2.5 mg / mL.

[0085] Prepare siRNA working solution (0.25 μM) with DEPC water;

[0086] Equal volumes of NCSH nanoparticle suspension were mixed with siRNA working solution and sonicated (100 W, 40 kHz, 30 min).

[0087] The mixture was placed on a shaker (200 rpm) and incubated at 37°C for 12 hours;

[0088] The complex NCSH@siCAD was formed by capillary adsorption and van der Waals interaction. The NCSH@siCAD was separated by centrifugation, resuspended in DEPC water, and stored at -20°C.

[0089] Part Two: Research on Anti-Colorectal Cancer

[0090] Example 1: CAD is highly expressed in CRC and has clinical significance.

[0091] To investigate the pathological significance of CAD in colorectal cancer, this invention conducted a comprehensive multi-database bioinformatics analysis. RNA-seq data from the Cancer Genome Atlas (TCGA, https: / / www.cancer.gov / ccg / research / genome-sequencing / tcga / using-tcga-data / citing) (Gene ID: 790; Ensembl: ENSG00000084774) showed that, compared with normal colon tissue, the transcriptional level of CAD in colorectal cancer tumor tissue was significantly increased (p < 0.0001). Figure 1 A). Kaplan-Meier survival analysis using the KM Plotter database showed that higher CAD expression was associated with lower overall survival (HR = 1.37; 95% CI: 1.12–1.68; p = 0.0013). Figure 1 B). To verify these bioinformatics findings, this invention performed qPCR analysis on 34 pairs of colorectal cancer and adjacent non-tumor tissues from the Xiangya Hospital Biobank. The results showed that the CAD mRNA level was significantly higher in tumor samples (p < 0.01). Figure 1 C). Immunohistochemical staining (IHC) was performed on tissue microarrays (n = 90 pairs), followed by quantitative analysis using ImageJ software, which confirmed elevated CAD protein expression in CRC tissues. Figure 1 DE). Western blotting of 34 matched CRC patients and adjacent normal tissues also showed a significant increase in CAD protein levels in the tumor (p < 0.01). Figure 1 F). In vitro analysis further supports these results, showing that CAD expression levels in CRC cell lines were significantly higher than in normal colonic epithelial cells (F). Figure 1G). These findings collectively highlight the carcinogenic potential of CAD in CRC, associating its upregulation with increased malignancy and poor prognosis, thus supporting its potential as a therapeutic target.

[0092] Example 2: Validating CAD as a target for nanoplatform-based therapy of colorectal cancer

[0093] To evaluate the functional role of CAD in tumor progression, this invention selected HCT116 cells with relatively high CAD expression and DLD-1 cells with relatively low CAD expression. CAD knockdown and overexpression cell lines were constructed in these cells using lentiviral and plasmid transfection techniques, respectively. Functional experiments showed that CAD knockdown significantly reduced cell proliferation, as demonstrated by colony formation assays. Figure 2 A) and 5-ethynyl-2′-deoxyuridine (EdU) incorporation experiment ( Figure 2 D) was confirmed, while CAD overexpression had the opposite effect on DLD-1 and HT29 cells. Transwell migration and Matrigel invasion assays showed that CAD silencing significantly reduced the number of migrating and invading cells. Conversely, CAD overexpression significantly increased cell invasion (D). Figure 2 B) and migration ( Figure 2 C). Apoptosis assays showed that HCT116 and HCT8 cells transfected with shRNA exhibited lower apoptosis rates compared to the control group. Conversely, overexpression of CAD in HT29 and DLD-1 cells led to a significant increase in apoptosis. Figure 2 E). Western blotting further validated these results, showing that CAD knockdown reduced the expression of the anti-apoptotic marker Bcl-2, while increasing the expression of the pro-apoptotic protein Bax. Figure 2 These results indicate that CAD plays a multifunctional oncogene role in colorectal cancer by promoting cell proliferation, enhancing motility, and inhibiting apoptosis. To evaluate the tumor-suppressive effect of CAD silencing in vivo, stable cell lines with CAD knockdown or overexpression were constructed using the methods described above. Compared with the control group, tumor volume and weight derived from CAD-silenced cells were significantly reduced, with a growth inhibition rate as high as 70% (F). Figure 3 A); however, CAD overexpression produces the opposite effect ( Figure 3 B). In a lung metastasis model, mice injected with CAD-silenced colorectal cancer cells showed a 57% reduction in lung nodules (HCT116, p < 0.001). Figure 3 C); Overexpression of CAD produces the opposite effect ( Figure 3 D). These findings further confirm the crucial role of CAD in promoting colorectal cancer growth and metastasis in vivo.

[0094] Example 3: Synthesis and Characterization of Targeted Nanoparticles

[0095] This invention also describes a multifunctional nanoplatform based on nickel-copper sulfides for the co-delivery of siCAD and formula 1A. This system aims to leverage the acidic and redox-sensitive conditions of the tumor microenvironment (TME) to achieve site-specific gene silencing and hydrogen sulfide (H2S) release, thereby disrupting the combined metabolic processes of colorectal cancer cells. Through hyaluronic acid surface functionalization, the platform can selectively take up tumor cells via CD44-mediated endocytosis, thereby improving tumor targeting accuracy and reducing off-target toxicity.

[0096] NCSH nanoparticles were synthesized using CuCl2, NiCl2, and sodium hyaluronate (NaHA) via a Kirkhandel diffusion-based method (synthesis steps are described in Preparation Example 1). Transmission electron microscopy (TEM) revealed that the nanoparticle size increased with increasing Na2S concentration, with the NCSH3 variant exhibiting a distinct hollow core and an optimal size (<100 nm) suitable for tumor penetration (Figure 4A). Inductively coupled plasma atomic emission spectrometry (ICP-OES) analysis showed that NCSH3 contained 36.7% copper and 13.2% nickel. Scanning electron microscopy (SEM) confirmed its uniformly porous surface, which is beneficial for drug loading (Figure 4B).

[0097] In the specific implementation examples of this invention, unless otherwise stated, NCSH3 is used as the carrier to load siCAD and Formula 1A.

[0098] X-ray diffraction (XRD) confirmed the formation of the heterojunction composed of copper sulfide and NiS, while X-ray photoelectron spectroscopy (XPS) detected characteristic peaks corresponding to Cu, Ni, S, F, and O, confirming the success of hyaluronic acid modification. Figure 4 CD). Fourier transform infrared (FTIR) spectroscopy further supports HA anchoring via coordination bonding (CD). Figure 4 E).

[0099] Three human siRNAs were designed and synthesized according to design principles, and the most effective siRNA was selected through screening.

[0100] Take 10 μL of the synthesized siRNA solution (100 nM) and transfect it into human HCT116 cells using the Lipo-3000 transfection kit. Change the medium after 6-8 hours, and culture continuously for 48 hours. Collect the cells, add SDS loading buffer to lyse the cells, and freeze them at -20°C for Western blotting to detect USP33 expression.

[0101] siCAD#1:GTATGAGGGTCTCTTCTTA

[0102] siCAD#2:GCTCTAGCGTTGAATTTGA

[0103] siCAD#3:GTGATCGACTCTACTTTGA

[0104] Of the three siCAD sequences screened, siCAD-2 achieved the highest silencing efficiency (>50%) and was used in formulation ( Figure 4 F). Formula 1A and siCAD-2 were loaded into NCSH3 via ultrasonic and magnetic stirring. UV-Vis spectroscopy determined that the loading efficiency of Formula 1A was 12.8%, the encapsulation efficiency was 67.5%, and the siRNA incorporation rate was 100%. Figure 4 G). After loading, transmission electron microscopy (TEM) images showed that the nanoparticles retained their spherical morphology and had a more compact core. Figure 5 AB). Energy-dispersive X-ray spectroscopy (EDX) detected elemental signatures in nanocarriers (Cu, Ni, S), Formula 1A(F), and siRNA (N, O). Figure 5 C). Dynamic light scattering (DLS) analysis showed that the hydrodynamic diameter increased after each loading step, consistent with transmission electron microscopy (TEM) observations. Figure 5 DE). The gradual decrease in zeta potential confirmed the sequential attachment of the load, while nitrogen adsorption-desorption analysis showed a reduction in both specific surface area and pore volume due to the occupancy of mesoporous channels. Figure 5 F).

[0105] Example 4: Evaluation of TME responsiveness and drug release of the nanoplatform

[0106] This engineered inorganic nanocomposite provides potent protection against enzymatic degradation of Formula 1A and siCAD, while simultaneously enabling precise release within the TME. After being complexed with NCSH@Formula 1A & siRNA, the colloid maintained stability for 7 days at 37°C in DMEM containing 10% fetal bovine serum, attributed to the strong electrostatic repulsion generated by its highly negative surface charge. Figure 5 G). Within a concentration range of 25 to 200 μg / mL, the hemolysis rate remained below 2.0%, confirming its excellent blood compatibility. Figure 5 HI). Transmission electron microscopy revealed that the nanoparticle core remained structurally intact at pH 7.4, began to degrade at pH 6.7, and completely disintegrated at pH 6.0, demonstrating a reliable pH-triggered degradation mechanism designed for acidic TME. Figure 4 H). This nanoplatform exhibits dual stimulation sensitivity to acidic pH and high GSH levels. In a simulated colorectal cancer microenvironment (pH 6.7), Ni2+ and Cu 2+ The cumulative release of ions reached 62.3 ± 3.8% and 65.1 ± 4.2% within 24 hours, respectively, significantly higher than the release under physiological pH conditions (4.7 ± 0.9% and 3.2 ± 0.6%). Figure 5 JK). To detect synergistic function, seven experimental groups were evaluated: PBS (I), free 1A (II), naked siCAD (III), NCSH@siNC (IV), NCSH@1A (V), NCSH@siCAD (VI), and NCSH@siCAD&1A (VII); NCSH in each group referred to NCSH3. The WSP 1 probe confirmed the production of H2S in groups II and IV-VII. Figure 4 I). In an acidic buffer solution containing H₂O₂, strong TMB (tetramethylbenzidine) absorption at 652 nm indicates Fenton-like catalytic activity. Figure 5 L). Kinetic measurements showed that the absorbance at 650 nm gradually increased with time and increasing nanomedicine dosage, confirming that metal ion release drove ROS generation (L). Figure 5 M). Further analysis of 5,5'-dithiobis(2-nitrobenzoic acid) (DTNB) showed that, under pH 6.7 conditions, NCSH@formula 1A & siRNA effectively depleted GSH, as evidenced by a significant decrease in absorbance at 412 nm (p < 0.01). Figure 5 These results collectively confirm that pH-triggered ion release is closely coordinated spatiotemporally with the disruption of the ROS / GSH pathway. These data demonstrate the system's high loading capacity and its selective targeting and controlled release characteristics under TME conditions.

[0107] Example 5: Detection of cellular uptake and in vitro antitumor mechanisms

[0108] CY7-labeled NCSH@1A & siRNA exhibited increasing fluorescence intensity over time in treated cells, confirming the effectiveness of cytoplasmic delivery. Figure 6 A). Comparison of fluorescence imaging between CD44-deficient 293T cells and CD44-overexpressing HCT116 cells revealed selective accumulation in HCT116 cells—validating HA-CD44-mediated uptake. Figure 6 B). The optimal working concentration was determined by CCK-8 ( Figure 4 IK). Functional experiments showed that group VII exhibited the most significant proliferation inhibition (CCK8). Figure 6 C) The highest PI-positive cell count (calcein AM / PI) Figure 6D) Significant mitochondrial membrane depolarization (JC-1) Figure 6 E), Increased reactive oxygen species (DCFH DA) Figure 6 F) Severe mitochondrial damage (TEM) Figure 6 G), maximum ATP depletion (Figure 56H), and hydrogen sulfide (supplementary) Figure 3 N). GSH depletion was most pronounced in group VII among the treatment groups ( Figure 6 I). Western blot analysis showed decreased levels of the copper death markers DLAT and FDX1 ( Figure 6 J). Immunofluorescence (IF) of treated cells showed significant accumulation of lipoxygenated DLAT (J). Figure 6 These observations confirm that nanomaterials induce intracellular acidification and copper-dependent cell death through H2S and copper ion release, while simultaneously inhibiting CAD expression and polarizing macrophages toward a more anti-inflammatory phenotype.

[0109] Example 6: Evaluation of in vivo antitumor activity and biodistribution

[0110] In subcutaneous tumor-bearing mice, CY7-labeled NCSH@siNC and NCSH@siCAD & Formula 1A exhibited peak tumor fluorescence 12–24 hours post-injection, exceeding the fluorescence intensity of free CY7. Figure 7 AD. In vitro fluorescence analysis confirmed that the nanomedicine group exhibited higher tumor fluorescence levels (AD). Figure 7 E). The NCSH@siCAD&Form 1A group showed the strongest antitumor effect ( Figure 7 F). Similar results were also observed in terms of tumor weight and volume ( Figure 7 G). Furthermore, the in vivo safety of this compound was comprehensively assessed by collecting blood and organ samples from healthy mice at 1, 4, and 7 days post-injection. Long-term safety was assessed by collecting organ samples from healthy mice at 28 days post-injection. Figure 9-10 Quantitative analysis of copper (Cu) and nickel (Ni) levels in the aforementioned key organs on days 1, 7, and 28 was performed using ICP-MS, revealing that both metals were cleared from the organs over time within 28 days. These ICP-MS data provide crucial insights into the biodistribution and elimination kinetics of nanomedicines. Figure 11 ).

[0111] The orthotopic colorectal cancer (CRC) model further validated the treatment efficacy: drug-treated groups II-VII showed stronger tumor suppression than the PBS control group, with group VII exhibiting the most significant treatment response. Figure 8AB). Histological evaluation (H&E staining) confirmed increased tumor cell necrosis in the treatment group. Safety studies (including major organ assessment and serum biochemical marker detection) showed no significant tissue damage or biochemical abnormalities, confirming excellent in vivo biocompatibility. Figure 8 C, Figure S5A-B).

[0112] 1. H&E staining and immunohistochemical analysis

[0113] Lungs from infected and uninfected mice were first fixed in 4% paraformaldehyde for 24 hours. The samples were then dehydrated and embedded in paraffin. Thin sections (4-5 μm) were cut and stained with hematoxylin and eosin for tissue morphology observation. For immunohistochemistry, paraffin-embedded sections were deaffinity-treated, dehydrated, and antigen extracted. Before primer blocking, the tissues were incubated with a SARS-CoV-2 nucleoprotein-specific primary antibody, followed by incubation with an HRP-labeled secondary antibody and DAB (peroxidase) to visualize antigen localization and expression levels in the tissues.

[0114] 2. Cryotransmission electron microscopy (CREM)

[0115] The sample preparation and imaging process for cryo-transmission electron microscopy (Cryo-TEM) was as follows: First, 5 μL of sample was carefully coated onto a glow discharge-treated mesh (R1.2 / 1.3 Au, 300 mesh, GiG). Then, the mesh was subjected to a 4-second water absorption process at 100% humidity and 4°C. Immediately afterwards, the mesh was rapidly immersed in liquid ethane using a Mark IV vitrobot (ThermoFisher). Imaging was performed using a Talos Glacios transmission electron microscope (ThermoFisher). The magnification was set to 92,000× and the pixel size to 1.57 Å.

[0116] 3. In vivo imaging software imaging

[0117] Lipid nanoparticles (LNPs) containing CY5-modified siRNA were injected into C57BL / 6 mice via retroretinal intravenous injection (dose: 0.5 mg / kg). Fluorescence imaging of the entire body and major organs (heart, liver, spleen, lungs, and kidneys) was then performed using the IVIS Lumina XR system and Living Image Software v.4.3.1 (Caliper Life Science).

Claims

1. A siCAD for colorectal cancer, characterized in that, The siRNA is a sequence having at least one of SEQ ID NO.1 to SEQ ID NO.3; SEQ ID NO.1: GTATGAGGGTCTCTTCTTA; SEQ ID NO.2: GCTCTAGCGTTGAATTTGA; SEQ ID NO. 3: GTGATCGACTCTACTTTGA.

2. The use of the siCAD of claim 1 in the preparation of an anti-colorectal cancer drug.

3. An active nanoparticle for resisting colorectal cancer, comprising a substrate loaded with an active ingredient, and an HA layer coated on the surface of the substrate; characterized in that, The active ingredient includes component A; component A is siCAD as described in claim 1.

4. The active nanoparticles for anti-colorectal cancer as described in claim 3, characterized in that, The substrate is nickel-copper composite sulfide nanoparticles with a particle size of 5-100 nm; the molar ratio of nickel to copper is 1:3-5.

5. The active nanoparticles for anti-colorectal cancer as described in claim 3, characterized in that, The active ingredients also include component B; component B is a compound having the structure of Formula 1 and its pharmaceutically acceptable salt, crystal or solvate. Formula 1 In Formula 1, R1 and R2 are C1 to C4 alkyl groups; X is a halogen.

6. A method for preparing the active nanoparticles for resisting colorectal cancer according to any one of claims 3 to 5, characterized in that, A mixture of water-soluble nickel salt, water-soluble copper salt, reducing agent, water-soluble sulfide, and HA is reacted to obtain HA / substrate; the HA / substrate is then combined with the active ingredient for further processing.

7. The use of the active nanoparticles for treating colorectal cancer according to any one of claims 3 to 5 in the preparation of drugs for treating colorectal cancer.

8. An anti-colorectal cancer drug, comprising a pharmaceutically effective amount of an anti-colorectal cancer component, characterized in that, The anti-colorectal cancer component comprises at least one of the siCAD of claim 1 and the active nanoparticles of any one of claims 3 to 5.