A method of assessing microplastic reproductive toxicity
The use of the FXR1 protein phase separation reporter system and fluorescence microscopy to assess the reproductive toxicity of microplastics solves the problems of long assessment cycles, high costs, and inability to reflect early molecular events in existing technologies, and enables rapid, mechanism-related, and high-throughput assessment of reproductive toxicity.
Patent Information
- Application Number
- CN202610672623.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-15
- Publication Date
- 2026-08-25
AI Technical Summary
Existing technologies lack rapid, mechanism-related, visualized, and high-throughput methods for assessing the reproductive toxicity of microplastics, especially failing to reflect the reproductive toxicity effects of early molecular events.
The FXR1 protein phase separation reporter system was used to observe the effect of microplastics on the phase separation phenomenon of FXR1 protein through fluorescence microscopy, either in an in vitro phase separation system or an intracellular reporter system, and the reproductive toxicity risk was assessed by fluorescence recovery rate.
It enables rapid, mechanism-related, visualized, and high-throughput assessment of microplastic reproductive toxicity within 24 hours, reflecting early molecular events without animal ethics issues.
Smart Images

Figure CN122631602A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a method for assessing the reproductive toxicity of microplastics. Background Technology
[0002] Microplastics, as an emerging environmental pollutant, have been proven to cross biological barriers and enter various tissues and organs. Polystyrene microplastics have been detected in human testicular tissue, and their concentration is negatively correlated with testicular weight. Studies have shown that microplastics can lead to decreased sperm count, reduced sperm motility, and DNA damage, but currently, there is still a lack of rapid methods for screening the reproductive toxicity of microplastics.
[0003] Currently, the standard methods for assessing the reproductive toxicity of microplastics mainly include:
[0004] Animal exposure experiments: Mice are exposed to microplastics via gavage or inhalation, followed by testing of sperm count, motility, morphology, and testicular tissue pathological changes. Disadvantages of this technique: long cycle (more than 4 weeks), high cost; low throughput - the number of samples that can be evaluated in a single animal experiment is limited, and animal ethics are involved; it detects terminal phenotypes and cannot reflect early molecular events.
[0005] In vitro cytotoxicity assays: Sperm or germ cells are co-incubated with microplastics to detect indicators such as cell viability, DNA damage, and oxidative stress. These assays detect terminal phenotypes such as sperm morphology and count, but cannot reflect early molecular events. Summary of the Invention
[0006] The main objective of this invention is to provide a method for assessing the reproductive toxicity of microplastics.
[0007] The technical solution adopted by this invention to solve its technical problem is:
[0008] A method for assessing the reproductive toxicity of microplastics using FXR1 protein phase separation includes the following steps:
[0009] (1) Provide an FXR1 protein phase separation reporter system, wherein the reporter system is selected from an in vitro phase separation system or an intracellular reporter system;
[0010] (2) Contact the microplastic sample to be tested with the FXR1 protein phase separation and reporting system;
[0011] (3) Using fluorescence microscopy, observe and detect the effect of the microplastic sample to be tested on the FXR1 protein phase separation phenomenon in the reporting system. The effect includes the morphological changes of the FXR1 protein phase separation droplets and / or the fluidity changes of the FXR1 protein phase separation droplets.
[0012] (4) Based on the detection results of step (3), assess the reproductive toxicity risk level of the microplastic sample to be tested.
[0013] Further, in step (1), the construction of the in vitro phase separation system includes: incubating the purified FXR1 protein or its functional fragment in a phase separation buffer to induce liquid-liquid phase separation of the FXR1 protein, forming phase-separated condensate droplets. Preferably, the FXR1 protein is an FXR1 protein containing a phase separation functional domain (preferably mouse FXR1) or a fragment thereof, preferably FXR1d protein, and has a purity greater than 90%; the phase separation buffer contains 10-30 mM HEPES, pH 7-8, 100-200 mM NaCl, and 15-25% (w / v) polyethylene glycol PEG8000. Preferably, the phase separation buffer contains 20 mM HEPES, pH 7.5, 150 mM NaCl, and 20% (w / v) polyethylene glycol PEG8000.
[0014] Further, in step (1), the construction of the intracellular reporter system includes: introducing a recombinant expression vector encoding the sfGFP-FXR1a fusion protein into mammalian cells via transfection or viral infection, and expressing the fusion protein in the cells, so that the FXR1 protein undergoes liquid-liquid phase separation in the cytoplasm to form phase-separated condensates with green fluorescent labels; preferably, the mammalian cells are HEK293T cells, and the recombinant expression vector is selected from the pcDNA3.1(+) eukaryotic transient expression vector or the PCDH-CMV-MCS-EF1-Puro lentiviral stable expression vector.
[0015] Further, in step (2), the contact conditions are as follows: when using an in vitro phase separation system, the microplastic sample is directly added to the system at a final concentration of 0.1-2 mg / mL and incubated at 36.5-37.5℃ for 5-30 minutes; when using an intracellular reporter system, the microplastic sample is added to the cell culture medium at a final concentration of 10-100 μg / mL and co-incubated with the cells at 36.5-37.5℃ and 4-6% CO2 for 24-48 hours.
[0016] Further, in step (3), the detection of morphological changes includes: observing and comparing the number, size, shape and distribution of FXR1 protein phase separation droplets between the treatment group and the control group using fluorescence microscopy or time-lapse photography; if the treatment group shows a significant reduction in the number of droplets, a reduction in volume, an irregular shape or abnormal aggregation, then the microplastic sample is determined to have a potential reproductive toxicity risk that interferes with FXR1 protein phase separation.
[0017] Furthermore, in step (3), the detection of the change in fluidity employs fluorescence bleaching recovery technology, specifically including the following steps:
[0018] a) Select a cell expressing the sfGFP-FXR1a fusion protein and containing clear droplets under a confocal microscope;
[0019] b) Use a laser to perform targeted bleaching of a single intracellular droplet; preferably, use a 488nm laser to perform targeted bleaching of a single FXR1 protein phase-separated droplet with a diameter of 1-2μm for 1.5 seconds.
[0020] c) Immediately after bleaching, continuously acquire fluorescence recovery images of the bleached area, preferably at a frequency of one frame every 5 seconds, for 4-5 minutes;
[0021] d) Analyze the acquired image sequence, perform background subtraction and photobleaching correction on the fluorescence intensity of the bleached area, and normalize the fluorescence recovery rate. The formula for calculating the recovery rate is: Recovery rate (%) = (maximum fluorescence intensity after bleaching / initial fluorescence intensity before bleaching) × 100%.
[0022] Furthermore, in step (4), the specific criteria for quantitatively assessing reproductive toxicity risk based on fluorescence recovery rate are as follows:
[0023] When the fluorescence recovery rate is greater than or equal to 70%, it is judged as negative, indicating that the microplastic sample to be tested has no significant reproductive toxicity risk;
[0024] When the fluorescence recovery rate is between 50% and 70%, it is considered weakly positive, indicating that the microplastic sample to be tested has a potential reproductive toxicity risk.
[0025] A fluorescence recovery rate between 30% and 50% is considered positive, indicating that the microplastic sample being tested poses a risk of reproductive toxicity.
[0026] When the fluorescence recovery rate is less than 30%, it is considered a strong positive result, indicating that the microplastic sample to be tested has a high risk of reproductive toxicity.
[0027] Furthermore, the method is used to evaluate the differences in reproductive toxicity of microplastics of different particle sizes or their biotransformed products, wherein the microplastics are preferably polystyrene microplastics, and the particle sizes include 80 nm and 5 μm.
[0028] The present invention also provides a microplastic reproductive toxicity detection kit for implementing the aforementioned evaluation method, comprising:
[0029] (a) An FXR1 protein phase separation reporter system, selected from components of an in vitro phase separation system or a cell line expressing the sfGFP-FXR1a fusion protein;
[0030] (b) Buffer or cell culture medium used to induce or maintain phase separation of FXR1 protein.
[0031] Preferably, the kit further includes (c) an instruction manual for performing fluorescence bleaching recovery experiments or image acquisition.
[0032] This invention also provides the application of the phase separation state of the FXR1 protein or a functional fragment thereof in the preparation of detection products or systems for assessing the reproductive toxicity of microplastics, wherein the phase separation state is characterized by the morphological integrity of the FXR1 protein phase-separated droplets or the dynamic mobility of the protein molecules within them, and the dynamic mobility is quantified by fluorescence bleaching recovery rate; the application includes: rapidly screening and assessing the potential reproductive toxicity risk of microplastics by detecting the degree of interference of microplastics on the phase separation state of the FXR1 protein.
[0033] Liquid-liquid phase separation refers to the physicochemical process in which biomolecules form a high-concentration liquid phase within cells through multivalent interactions, and spontaneously separate from the surrounding low-concentration liquid phase. In recent years, phase separation has been shown to be involved in various biological processes such as RNA metabolism, stress granule assembly, and spermatogenesis.
[0034] FXR1 protein (FMR1 autosomal homolog 1, also known as Fragile X-related protein 1) is a member of the Fragile X-related protein family. Recent studies have found that it mediates translational reactivation during sperm metamorphosis through liquid-liquid phase separation, making it a key regulator of sperm development and maturation (Kang JY et al., Science, 2022). Studies have shown that FXR1 phase separation defects can lead to abnormal sperm morphology, motility disorders, and male infertility. This invention is the first to discover that exposure to polystyrene microplastics can significantly interfere with the liquid-liquid phase separation of FXR1 protein, leading to decreased droplet fluidity and even abnormal solidification. This effect is particle size-dependent and exhibits enhanced biotransformation characteristics. Therefore, the FXR1 phase separation state can serve as a sensitive molecular indicator for assessing the reproductive toxicity of microplastics.
[0035] Compared with the prior art, this technical solution has the following advantages:
[0036] (1) Rapid: Test results can be obtained within 24 hours, much faster than animal experiments (more than 4 weeks);
[0037] (2) Mechanism-related: Direct detection of the key molecular event of FXR1 phase separation reflects the reproductive toxicity mechanism of microplastics;
[0038] (3) Visualization: The morphology and dynamic changes of phase-separated droplets are directly observed using a fluorescence microscope;
[0039] (4) Quantifiable: FRAP technology is used to quantitatively assess changes in droplet flowability;
[0040] (5) High throughput: It can complete the evaluation of a large number of samples in a short time, making it suitable for large-scale screening;
[0041] (6) No animal ethics issues: Purified proteins and in vitro cell models are used. Attached Figure Description
[0042] The present invention will be further described below with reference to the accompanying drawings and embodiments.
[0043] Figure 1 SDS-PAGE image of purified FXR1d protein.
[0044] Figure 2 FXR1d in vitro phase separation system.
[0045] Figure 3 80 nm microplastics affect FXR1 phase separation.
[0046] Figure 4 Transiently transfect sfGFP-FXR1a into HEK293T cells.
[0047] Figure 5 A stable HEK293T cell line expressing sfGFP-FXR1a was constructed.
[0048] Figure 6 Treatment with 80 nm microplastics caused the phase separation droplets in the sfGFP-FXR1a stable cell line to dissipate.
[0049] Figure 7 The effect of 80 nm microplastics on the flowability of FXR1 protein phase separation droplets.
[0050] Figure 8 The effects of 5 μm microplastics and 5 μm biotransformation microplastics on the flowability of FXR1 protein phase separation droplets. Detailed Implementation
[0051] This invention provides a method for assessing the reproductive toxicity of microplastics using protein phase separation, comprising the following steps:
[0052] (1) Construct a reporter system for the in vitro and intracellular phase separation of FXR1 protein;
[0053] (2) Contact the microplastic sample to be tested with the reporting system;
[0054] (3) Observe the effect of the microplastic sample to be tested on the phase separation phenomenon of FXR1 protein;
[0055] (4) Detect changes in the fluidity of the FXR1 protein phase separation droplets;
[0056] (5) Assess the reproductive toxicity risk of microplastics based on the degree of change in fluidity.
[0057] Example 1: Construction of an in vitro phase separation system and microplastic toxicity assessment
[0058] 1. Expression and purification of FXR1 protein
[0059] The plasmid used in this invention to purify the FXR1d protein was obtained from the Center for Excellence in Cell Biology, Chinese Academy of Sciences. The FXR1d coding sequence (SEQ ID NO: 1) was obtained through BLAST analysis on the NCBI website. The expression vector used was PET51(b). The plasmid expressing the FXR1d protein was transformed into E. coli BL21(DE3) competent cells. Positive single clones were picked and seeded in LB medium containing ampicillin (final concentration 100 μg / mL), cultured at 37°C with shaking until the OD600 reached 0.6-0.8, then IPTG was added to a final concentration of 0.2 mM, and expression was induced at 18°C for 16 hours.
[0060] Bacterial cells were collected and resuspended in pre-chilled PBS lysis buffer. The cells were then sonicated on ice (300W, 5 seconds sonication followed by 5-second intervals, total time 20 minutes). The lysis buffer was centrifuged at 12000 rpm for 2 hours at 4°C. The supernatant was collected, filtered through a 0.22 μm filter, and then purified as FXR1d protein by His-Tag affinity chromatography and Strep-Tag II affinity chromatography. The purified protein was verified by SDS-PAGE electrophoresis and Coomassie brilliant blue staining, showing a purity >90% (see Appendix). Figure 1 The purified protein was concentrated, aliquoted, flash-frozen in liquid nitrogen, and stored at -80°C for later use.
[0061] 2. Construction of in vitro phase separation system
[0062] The purified FXR1d protein was removed from -80°C, thawed on ice, and diluted with protein storage buffer (500 mM NaCl, 20 mM HEPES, pH 7.5). The protein was added to in vitro phase separation buffer to make the final reaction system contain 20 mM 4-hydroxyethylpiperazine ethanesulfonic acid (HEPES), 150 mM sodium chloride (NaCl), 20% polyethylene glycol (PEG8000), pH 7.5, and 30 μM protein. After thorough mixing, the mixture was incubated at 37°C for 5 minutes. 10 μL of the reaction solution was added to a glass slide, and a coverslip was gently placed on top to avoid air bubbles. The slide was then observed under an upright differential interference fluorescence microscope. The FXR1d protein formed spherical droplets with a diameter of approximately 1-3 μm, exhibiting typical phase separation characteristics (see...). Figure 2 ).
[0063] 3. Microplastic treatment and observation
[0064] The microplastics used in this invention are as follows: 80 nm red fluorescent monodisperse polystyrene microspheres (CAT#Lumisphere 7-1-0008, Ex 620 nm, Em 680 nm) and 5 μm blue fluorescent monodisperse polystyrene microspheres (CAT#Lumisphere 7-5-0500, Ex 400 nm, Em 450 nm) were purchased from BaseLine Chromatography Technology Development Center (BaseLine, Tianjin, China), with a stock solution concentration of 10 mg / mL. The rotifer biotransformed microplastics used were collected from 5 μm blue fluorescent monodisperse polystyrene microspheres (CAT# Lumisphere 7-5-0500, Ex 400 nm, Em 450 nm) after rotifer biotransformation.
[0065] Take 10 mg / mL of 80 nm polystyrene microplastic stock solution and dilute it to the working concentration with in vitro phase separation buffer. To explore the phase separation of proteins at different salt concentrations and the effect of microplastics on phase separation, the diluted microplastics were added to the above in vitro phase separation system: 20 mM 4-hydroxyethylpiperazine ethanesulfonic acid (HEPES), 20% polyethylene glycol (PEG8000), pH 7.5, NaCl salt concentration of 100-1200 mM (100, 150, 300, 600, 1200 mM), protein concentration of 1-50 μM (1, 10, 20, 30, 50 μM), and a final microplastic concentration of 1 mg / mL. Mix gently and incubate at 37°C for 5 minutes. Add 10 μL of the mixture to a glass slide, cover with a coverslip, and observe the morphology, number, and distribution changes of the FXR1d protein phase separation droplets under an upright differential interference fluorescence microscope. Set up a control group without microplastics (add an equal volume of in vitro phase separation buffer).
[0066] 4. Result Determination
[0067] The morphological changes of FXR1d protein phase separation droplets were observed under a bright-field microscope. If the microplastic sample caused a decrease in the number, size, irregularity, or aggregation of FXR1d phase separation droplets, the microplastic sample was determined to have a potential reproductive toxicity risk that interfered with FXR1 phase separation.
[0068] In the control group, FXR1d protein under low salt concentrations (100-150 mM) and low protein concentrations (10 μM) exhibited phase separation; under medium salt concentrations (300-600 mM), higher protein concentrations (20 μM and above) were required for phase separation; and under high salt concentrations (1200 mM), no phase separation occurred at any protein concentration. Overall, FXR1d protein formed uniformly sized, well-defined spherical droplets within a salt concentration range of 100-600 mM and a protein concentration range of 20-50 μM.
[0069] After the addition of 80 nm polystyrene microplastics (final concentration 1 mg / mL), the phase separation range was significantly reduced. Phase separation droplets were observed only in a limited combination of higher protein concentrations (30-50 μM) and lower salt concentrations (100-300 mM), while no phase separation occurred in other combinations. Compared with the control group, the range of salt and protein concentrations in the microplastic-treated group where phase separation could occur was significantly narrowed, the number of droplets decreased or even disappeared, and protein aggregation occurred in some areas. This indicates that 80 nm microplastics significantly interfered with the in vitro phase separation of FXR1d protein and have certain reproductive toxicity. Figure 3 ).
[0070] Example 2: Construction of an intracellular phase separation system and microplastic toxicity assessment
[0071] 1. Construction of transient and stable cell lines
[0072] (1) Construction of transient transfection cell lines
[0073] The coding sequences of FXR1a and sfGFP (SEQ ID NO: 2 and SEQ ID NO: 3) were obtained by BLAST analysis on the NCBI website. Using mouse testicular tissue cDNA as a template, PCR amplification was performed using FXR1a_S1 (SEQ ID NO: 5) and FXR1a_AS1 (SEQ ID NO: 6) as primers (Table 2) to obtain fragment FXR1a (SEQ ID NO: 2). Using plasmid Psra-7:sfGFP (from the Environmental Health and Public Health Research Team of Hainan University) as a template, PCR amplification was performed using sfGFP_S1 (SEQ ID NO: 7) and sfGFP_AS1 (SEQ ID NO: 8) as primers (Table 2) to obtain fragment sfGFP (SEQ ID NO: 3). Subsequently, using the above two fragments as templates, sfGFP_S1_with_pcDNA3.1_OL (SEQ ID NO: 9) and FXR1a_AS1_with_pcDNA3.1_OL (SEQ ID NO: 3) were amplified using primers. Bridge PCR was performed using primer NO: 10 (Table 3) to obtain the sfGFP-FXR1a fusion protein fragment (SEQ ID NO: 4). Finally, using the pcDNA3.1(+) eukaryotic expression vector as the backbone, the coding sequence of the sfGFP-FXR1a fusion protein was inserted downstream of the CMV promoter, and the pcDNA3.1-sfGFP-FXR1a expression plasmid was constructed by seamless cloning (Gibson ligation method, Table 4). The sequence was verified to be correct by Sanger sequencing. The pcDNA3.1(+) eukaryotic expression vector was obtained from the Environmental Health and Public Health Research Team of Hainan University. Primer information is shown in Table 1.
[0074] One day before transfection, HEK293T cells in logarithmic growth phase were seeded in confocal microplates and incubated in complete culture medium (high glucose DMEM + 10% fetal bovine serum + 1% penicillin and streptomycin) at 37°C in a 5% CO2 incubator until the cell density reached 70-90% at transfection. For transfection, 1 μg of pcDNA3.1-sfGFP-FXR1a plasmid DNA and 2.5 μg of PEI transfection reagent were diluted to 50 μL with Opti-MEM serum-free medium. The diluted PEI was added dropwise to the diluted DNA, immediately vortexed, and incubated at room temperature for 20 minutes to form the DNA-PEI complex. The complex was then added dropwise to the cell culture dish, gently agitated to ensure even distribution. Five hours after transfection, the medium was replaced with fresh complete culture medium, and the cells were cultured for another 24-48 hours. The transfection efficiency of sfGFP-FXR1a and the formation of phase-separated droplets were observed under a fluorescence microscope (488 nm excitation). The results showed that transiently transfected cells expressed green fluorescent protein intracellularly, forming spherical fluorescent droplets with a diameter of approximately 0.5-2 μm (see attached image). Figure 4Transiently transfected cells were used for subsequent FRAP experiments.
[0075] (2) Construction of stable cell lines
[0076] Using the lentiviral expression vector PCDH-CMV-MCS-EF1-Puro as the backbone, and sfGFP_S1_pCDH_OL (SEQ ID NO: 11) and FXR1a_AS1_pCDH_OL (SEQ ID NO: 12) as primers, the coding sequence of the sfGFP-FXR1a fusion protein (SEQ ID NO: 4) obtained in (1) was inserted downstream of the CMV promoter after adding a sticky end. The PCDH-CMV-sfGFP-FXR1a-EF1-Puro expression plasmid was constructed using the seamless cloning method (Gibson ligation, Table 4). The sequence was verified to be correct by Sanger sequencing. The lentiviral expression vector PCDH-CMV-MCS-EF1-Puro was obtained from the School of Pharmaceutical Sciences, Tsinghua University. Primer information is shown in Table 1.
[0077] One day before transfection, HEK293T cells in logarithmic growth phase were seeded in 10cm culture dishes to achieve a cell density of 70-80% at transfection. PCDH-CMV-sfGFP-FXR1a-EF1-Puro plasmid (6μg), helper packaging plasmid psPAX2 (4.5μg), and pMD2.G (1.5μg) were mixed at a mass ratio of 4:3:1 and added to Opti-MEM medium to a final volume of 500μL. Separately, 36μg of PEI transfection reagent was diluted with 500μL of Opti-MEM and incubated at room temperature for 5 minutes. The diluted PEI was added dropwise to the diluted DNA mixture, and the mixture was immediately vortexed and incubated at room temperature for 15 minutes. The transfection complex was then added dropwise to the cell culture dish and gently shaken to mix. The culture medium was replaced with fresh complete culture medium 6-8 hours after transfection. At 48 and 72 hours post-transfection, cell supernatants containing viral particles were collected, filtered through a 0.45 μm PVDF membrane to remove cell debris, and the filtrates were combined to obtain lentivirus stock solution.
[0078] One day before infection, HEK293T cells were seeded in 6-well plates to achieve a cell density of 30-40%. At infection, the cell culture medium was discarded, and a mixed medium containing lentivirus stock solution (virus stock solution to fresh complete culture medium volume ratio 1:1) was added, along with polybrene (final concentration 8 μg / mL) to promote infection. Twenty-four hours post-infection, the medium was replaced with fresh complete culture medium. Seventy-two hours post-infection, sfGFP expression was observed under an inverted fluorescence microscope to preliminarily assess infection efficiency. Subsequently, the medium was replaced with complete selection medium containing puromycin (selection concentration 2 μg / mL), and the selection medium was changed every 2-3 days for 14 days until all uninfected control cells died, obtaining a stable HEK293T cell line expressing sfGFP-FXR1a. Under a fluorescence microscope, green fluorescent protein expression was observed in the cells, with green fluorescent droplets forming within the cells. Figure 5 The stabilized cell lines were used for subsequent time-lapse photography experiments.
[0079] After digestion, the selected stable cell lines were resuspended in cryopreservation medium containing 10% dimethyl sulfoxide and 90% fetal bovine serum, and then aliquoted into cryovials (1×10⁶). 6 Cells / tubes were placed in a programmed cooling box and frozen overnight at -80°C, then transferred to liquid nitrogen for long-term storage the next day.
[0080] 2. Cell Culture and Microplastic Treatment
[0081] The cells were seeded in confocal microplates or well plates and cultured at 37°C in a 5% CO2 incubator until 70-80% confluence. The culture medium was discarded, and complete culture medium containing the microplastic sample was added. The following treatment groups were established: 80nm polystyrene microplastics (concentration 100 μg / mL), 5μm polystyrene microplastics (concentration 10 μg / mL), and 5μm polystyrene microplastics biotransformed by rotifers (concentration 10 μg / mL). A negative control group was established by adding an equal volume of complete culture medium free of microplastics. All cells were incubated at 37°C in a 5% CO2 incubator for 24 hours.
[0082] 3. Time-lapse photography to observe phase separation phenomenon
[0083] Stable cells (80nm PS, 100μg / mL) treated 24 hours after the procedure in step 2 above were placed in an Agilent Cytation 6 microplate reader. Under conditions of 37°C and 5% CO2, time-lapse photography was performed on fixed positions in each well for 24–48 hours using a 20× objective lens and a GFP fluorescence channel with excitation light at 488nm, with a frame-per-hour interval. After acquisition, image analysis software was used to observe the changes in the number, morphology, and distribution of green fluorescent droplets within the cells over time.
[0084] 4. Fluorescent Recovery After Bleaching (FRAP) Detection
[0085] Transfected cells (80nm / 5μm / biotransformation 5μm PS, same treatment concentration as above) treated 24 hours after the procedure in step 2 above were placed on a confocal microscope stage and kept at a constant temperature of 37°C and a 5% CO2 environment. Single cells with uniform expression, a large number of droplets, and good cell condition were selected. Single droplets with a diameter of approximately 1-2μm were bleached using a 488nm laser. The bleaching parameters were set as follows: The confocal microscope used in this invention was a Nikon AXNIS-Elements 6.0 confocal microscope, with a laser wavelength of 488nm, a bleaching intensity of 20%, a bleaching time of 1.5 seconds, and the bleaching was repeated 3 times. Immediately after bleaching, images were acquired, one frame every 5 seconds, for 4-5 minutes, recording the process of fluorescence intensity recovery in the bleached area over time.
[0086] The term "bleaching" refers to the process of irradiating a fluorescently labeled area with high-intensity excitation light, causing an irreversible photochemical reaction in the fluorescent molecules within that area, resulting in the loss of their luminescence ability. After bleaching, fluorescent molecules from the surrounding unbleached areas can diffuse or actively transport into the bleached area, gradually restoring the fluorescence intensity of that area. By measuring the fluorescence recovery rate, the dynamic exchange capacity and mobility of protein molecules within the droplet can be quantitatively analyzed. "Bleaching intensity 20%" means that the laser power used for photobleaching is set to 20% of the maximum output power (100%) of the confocal fluorescence microscope laser used in the experiment.
[0087] After data acquisition, the fluorescence intensity of the bleached area was quantitatively analyzed using NIS-Viewer or ImageJ image analysis software. The fluorescence intensity of the bleached area was normalized after background subtraction and photobleaching correction, and a fluorescence recovery curve was plotted. The fluorescence recovery rate was calculated using the following formula: Fluorescence recovery rate (%) = (Maximum fluorescence intensity after bleaching / Initial fluorescence intensity before bleaching) × 100%
[0088] 5. Result Determination
[0089] (1) Results of time-lapse photography
[0090] The results of time-lapse photography observation of stable cells showed that ( Figure 6 In the control group, the droplets in sfGFP-FXR1a stable cells maintained their morphology, and the number and size of the droplets increased with cell proliferation. In the 80 nm microplastic treatment group, the green fluorescent droplets in the cells dissipated, and the number and size of the droplets decreased. The results indicate that 80 nm polystyrene microplastics can interfere with the phase separation steady state of sfGFP-FXR1a stable cells and induce droplet dissipation.
[0091] (2) FRAP testing criteria
[0092] The results are determined based on the fluorescence recovery rate measured by the fluorescence bleaching recovery experiment: when the fluorescence recovery rate is ≥70%, it is considered negative, indicating that the microplastic sample has no significant reproductive toxicity risk; when the fluorescence recovery rate is 50%-70%, it is considered weakly positive, indicating a potential reproductive toxicity risk; when the fluorescence recovery rate is 30%-50%, it is considered positive, indicating a reproductive toxicity risk; and when the fluorescence recovery rate is <30%, it is considered strongly positive, indicating a high reproductive toxicity risk.
[0093] (3) FRAP test results
[0094] The results of fluorescence recovery after bleaching (FRAP) experiments on transiently transfected cells showed that, in the control group, the fluorescence intensity in the bleached area recovered to more than 80% of the initial level within 3 minutes. Figure 7 This indicates that the protein molecules inside the FXR1 phase-separated droplets possess excellent dynamic exchange capabilities, consistent with the typical characteristics of liquid-phase condensates. In the 80nm PS treatment group, the droplet fluorescence recovery rate decreased to 50-60%. Figure 7 The recovery rate slowed significantly, indicating that exposure to 80nm microplastics weakened the dynamic exchange capacity of protein molecules inside the FXR1 phase-separated droplets, affecting droplet mobility to some extent, and was thus classified as weakly positive. In the 5μm PS treatment group, the droplet fluorescence recovery rate dropped to below 10%. Figure 8 The 5μm microplastics almost completely lost their fluorescence recovery ability, and some droplets showed signal attenuation after bleaching, indicating that the droplets suffered a sharp loss of fluidity and abnormal solidification due to the 5μm microplastics, thus indicating a strong positive result. In the 5μm PS treatment group transformed by rotifers, the droplet fluorescence recovery rate was less than 5%. Figure 8 The faster signal decay rate after bleaching indicates that the biotransformation process modifies the surface of microplastics with biomolecules, enhancing their interaction with the FXR1 protein and exacerbating the disruption of the phase separation dynamic equilibrium, thus indicating a strong positive result.
[0095] The above results indicate that polystyrene microplastics can interfere with the liquid-liquid phase separation dynamic equilibrium of the FXR1 protein, manifested as droplet dissipation in stable cells and decreased fluorescence recovery rate in transiently transformed cells, exhibiting significant reproductive toxicity with particle size dependence and enhanced biotransformation characteristics. This demonstrates that the morphological integrity and flowability of FXR1 phase-separated droplets can serve as sensitive indicators for detecting the reproductive toxicity of microplastics. By observing changes in droplet morphology or measuring fluorescence recovery rate, the interference effect of microplastics on FXR1 phase separation can be rapidly assessed, thereby determining their potential reproductive toxicity risk.
[0096] FXR1d (SEQ ID NO: 1):
[0097]
[0098] FXR1a(SEQ ID NO:2):
[0099]
[0100] sfGFP(SEQ ID NO:3):
[0101] CGTAAAGGCGAAGAGCTGTTCACTGGTGTCGTCCCTATTCTGGTGGAACTGGATGGTGATGTCAACGGTCATAAGTTTTCCGTGCGTGGCGAGGGTGAAGGTGACGCAACTAATGGTAAACTGACGCTGAAGTTCATCTGTACTACTGGTAAACTGCCGGTACCTTGGCCGACTCTGGTAACGACGCTGACTTATGGTGTTCAGTGCTTTGCTCGTTATCCGGACCATATGAAGCAGCATGACTTCTTCAAGTCCGCCATGCCGGAAGGCTATGTGCAGGAACGCACGATTTCCTTTAAGGATGACGGCACGTACAAAACGCGTGCGGAAGTGAAATTTGAAGGCGATACCCTGGTAAACCGCATTGAGCTGAAAGGCATTGACTTTAAAGAAGACGGCAATATCCTGGGCCATAAGCTGGAATACAATTTTAACAGCCACAATGTTTACATCACCGCCGATAAACAAAAAAATGGCATTAAAGCGAATTTTAAAATTCGCCACAACGTGGAGGATGGCAGCGTGCAGCTGGCTGATCACTACCAGCAAAACACTCCAATCGGTGATGGTCCTGTTCTGCTGCCAGACAATCACTATCTGAGCACGCAAAGCGTTCTGTCTAAAGATCCGAACGAGAAACGCGATCATATGGTTCTGCTGGAGTTCGTAACCGCAGCGGGCATCACGCATGGTATGGATGAACTGTACAAA
[0102] sfGFP-FXR1a(SEQ ID NO:4):
[0103]
[0104] Table 1 Primer Information
[0105]
[0106] Table 2 PCR reaction system
[0107]
[0108] Table 3 Bridge PCR reaction system
[0109]
[0110] Table 4 Gibson Connection System
[0111]
[0112] The above description is merely a preferred embodiment of the present invention, and therefore should not be construed as limiting the scope of the present invention. All equivalent changes and modifications made in accordance with the scope of the patent and the contents of the specification should still fall within the scope of the present invention.
Claims
1. A method for assessing the reproductive toxicity of microplastics, characterized in that, Includes the following steps: (1) Provide an FXR1 protein phase separation reporter system, wherein the reporter system is selected from an in vitro phase separation system or an intracellular reporter system; (2) Contact the microplastic sample to be tested with the FXR1 protein phase separation and reporting system; (3) Using fluorescence microscopy, observe and detect the effect of the microplastic sample to be tested on the FXR1 protein phase separation phenomenon in the reporting system. The effect includes the morphological changes of the FXR1 protein phase separation droplets and / or the fluidity changes of the FXR1 protein phase separation droplets. (4) Based on the detection results of step (3), assess the reproductive toxicity risk level of the microplastic sample to be tested.
2. The method according to claim 1, characterized in that, In step (1), the construction of the in vitro phase separation system includes: incubating the purified FXR1 protein or its functional fragment in a phase separation buffer to induce liquid-liquid phase separation of the FXR1 protein and form phase separation condensate droplets.
3. The method according to claim 2, characterized in that, The FXR1 protein is an FXR1 protein or a fragment thereof containing a phase separation functional domain; the phase separation buffer contains 10-30 mM HEPES, pH 7-8, 100-200 mM NaCl and 15-25% polyethylene glycol PEG8000 by weight / volume.
4. The method according to claim 1, characterized in that, In step (1), the construction of the intracellular reporter system includes: introducing a recombinant expression vector encoding the sfGFP-FXR1a fusion protein into mammalian cells by transfection or viral infection, and expressing the fusion protein in the cells, so that the FXR1 protein undergoes liquid-liquid phase separation in the cytoplasm to form a fluorescently labeled phase-separated condensate.
5. The method according to claim 4, characterized in that, In step (1), the mammalian cell is HEK293T cell, and the recombinant expression vector is selected from pcDNA3.1(+) eukaryotic transient expression vector or PCDH-CMV-MCS-EF1-Puro lentiviral stable expression vector.
6. The method according to claim 1, characterized in that, In step (2), the contact conditions are as follows: when using an in vitro phase separation system, the microplastic sample is directly added to the system at a final concentration of 0.1-2 mg / mL and incubated at 36.5-37.5℃ for 5-30 minutes; when using an intracellular reporter system, the microplastic sample is added to the cell culture medium at a final concentration of 10-100 μg / mL and co-incubated with the cells at 36.5-37.5℃ and 4-6% CO2 for 24-48 hours.
7. The method according to claim 1, characterized in that, In step (3), the detection of morphological changes includes: observing and comparing the number, size, shape and distribution of FXR1 protein phase separation droplets between the treatment group and the control group using fluorescence microscopy or time-lapse photography; if the treatment group shows a significant reduction in the number of droplets, a reduction in volume, an irregular shape or abnormal aggregation, then the microplastic sample is determined to have a potential reproductive toxicity risk that interferes with FXR1 protein phase separation.
8. The method according to claim 1, characterized in that, In step (3), the detection of the change in fluidity employs fluorescence bleaching recovery technology, specifically including the following steps: a) Select a cell expressing the sfGFP-FXR1a fusion protein and containing clear droplets under a confocal microscope; b) Use lasers to bleach individual droplets within cells at specific points; c) After bleaching, continuously acquire fluorescence recovery images of the bleached area for 4-5 minutes; d) Analyze the acquired image sequence, perform background subtraction and photobleaching correction on the fluorescence intensity of the bleached area, and normalize the fluorescence recovery rate. The formula for calculating the recovery rate is: Recovery rate (%) = (maximum fluorescence intensity after bleaching / initial fluorescence intensity before bleaching) × 100%.
9. The method according to claim 1 or 8, characterized in that, In step (4), the specific criteria for quantitatively assessing reproductive toxicity risk based on fluorescence recovery rate are as follows: When the fluorescence recovery rate is greater than or equal to 70%, it is judged as negative, indicating that the microplastic sample to be tested has no significant reproductive toxicity risk; When the fluorescence recovery rate is between 50% and 70%, it is considered weakly positive, indicating that the microplastic sample to be tested has a potential reproductive toxicity risk. A fluorescence recovery rate between 30% and 50% is considered positive, indicating that the microplastic sample being tested poses a risk of reproductive toxicity. When the fluorescence recovery rate is less than 30%, it is considered a strong positive result, indicating that the microplastic sample to be tested has a high risk of reproductive toxicity.
10. A microplastic reproductive toxicity test kit for implementing the evaluation method of claim 1, characterized in that, It comprises: (a) an FXR1 protein phase separation reporter system selected from the in vitro phase separation system components of claim 2 or cells expressing the sfGFP-FXR1a fusion protein of claim 4; and (b) a buffer or cell culture medium for inducing or maintaining FXR1 protein phase separation.