A method for breeding pure white color wuzhishan pig based on phenotype and molecular marker assistance
Patent Information
- Application Number
- CN202611061308.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-07-16
- Publication Date
- 2026-08-28
AI Technical Summary
[0003]2019年受非洲猪瘟疫情影响,国家级五指山猪保种场受到严重冲击,原有的携带显性白毛主效突变(KIT基因内含子17 G>A突变)的白系五指山猪灭绝,现有幸存的白系个体(F0、F1、F2代)及乌云盖雪系经分子检测,均为野生型GG基因型,均不携带该显性白毛主效突变,由于现有白系群体毛色混杂、血缘较近,若采用传统的闭锁繁育容易导致近交衰退,且无法提供突变供体来实现快速纯化
[0035] Under the extreme condition of extinction of the original white major mutation (KIT gene mutation), this invention innovatively and successfully achieved pure white coat color fixation in the wild-type background of GG through rigorous multi-generation phenotypic screening.
Smart Images

Figure CN122642369A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of laboratory animal breeding technology, and in particular to a method for breeding a new pure white Wuzhishan pig breed. Background Technology
[0002] Wuzhishan pig is a well-known small pig breed in my country, characterized by its small size, stable genetics, strong disease resistance, and excellent meat quality. It is an ideal experimental animal model. Based on coat color phenotypic characteristics, Wuzhishan pigs are mainly divided into white, dark blue, and black strains. Among them, the white strain has unique advantages in medical research such as xenotransplantation and drug evaluation because its blood vessels are easier to find and its disease models are easier to observe.
[0003] In 2019, the national-level Wuzhishan pig conservation farm was severely impacted by the African swine fever epidemic. The original white Wuzhishan pigs carrying the dominant white hair major mutation (KIT gene intron 17 G>A mutation) became extinct. The existing surviving white individuals (F0, F1, F2 generations) and the Wuyun Gaixue line were molecularly tested and found to be of the wild-type GG genotype, and none of them carried the dominant white hair major mutation. Because the existing white population has mixed coat colors and close bloodlines, traditional closed breeding is prone to inbreeding depression and it is impossible to provide mutation donors to achieve rapid purification.
[0004] Therefore, how to cultivate a new Wuzhishan pig breed with pure white coat, genetic stability, and rich bloodline in the absence of dominant white hair major mutations is a technical problem that urgently needs to be solved in the field of experimental animal breeding. Summary of the Invention
[0005] To address the shortcomings of existing technologies, this invention provides a method for breeding pure white Wuzhishan pigs. This method employs a strategy primarily based on phenotypic selection, supplemented by molecular marker monitoring. Simultaneously, it utilizes KIT gene detection to confirm the genotypic background in each generation, and uses SSR genetic diversity monitoring to guide scientific mating and the introduction of foreign bloodlines, avoiding inbreeding depression. Through selection, a new Wuzhishan pig breed with pure white coat, genetic stability, and rich population lineage is obtained.
[0006] This invention provides a phenotypic and molecular marker-assisted breeding method for pure white Wuzhishan pigs, comprising the following steps:
[0007] (1) Establishment of the basic population: Select Wuzhishan pigs with white coat color and allow the number of black spots ≤2 and the diameter of the black spots <1cm as the basic population, and retain Wuzhishan pigs of the Wuyun Gaixue line as the external bloodline reserve population;
[0008] (2) Molecular genetic background monitoring: KIT genotyping was performed on selected individuals to monitor the dominant white hair major mutation background; at the same time, SSR microsatellite markers were used to detect genetic diversity, calculate population genetic parameters, and establish a genetic distance matrix between individuals;
[0009] (3) Selecting offspring piglets by phenotypic traits: screening offspring piglets by coat color and body shape, raising the standard for pure white coat color, and eliminating individuals with black spots;
[0010] (4) Closed breeding: When the coat color reaches 100% pure white for two consecutive generations and the population genetic parameters reach the target threshold, the introduction of foreign bloodlines is stopped and the closed breeding stage begins.
[0011] Furthermore, after step (3) is completed, when the genetic parameters of the population are lower than the set threshold, boars from the ecto-bloodline reserve population are introduced to mate with the current generation of white sows, and only individuals with white coat color are selected from their offspring to be included in the core breeding group; when introducing them, the Wuyun Gaixue boars with the largest average genetic distance from the current generation of white sows are given priority.
[0012] Furthermore, in step (2) above:
[0013] The KIT genotype detection specifically involved detecting the 17 G>A site in the KIT gene intron. The genotype of the baseline population and the selected individuals in each generation was GG wild-type. The SSR microsatellite marker detection specifically utilized 32 fluorescently labeled microsatellite primer pairs for PCR amplification and capillary electrophoresis. The calculated population genetic parameters included: expected heterozygosity (He), polymorphism information content (PIC), and inbreeding coefficient (Fis).
[0014] Furthermore, the aforementioned threshold can be any one of the following:
[0015] (A) The inbreeding coefficient of any generation was significantly higher than that of the previous generation, P<0.05;
[0016] (B) Expected heterozygosity (He) < 0.50;
[0017] (C) Polymorphic Information Content (PIC) < 0.50.
[0018] When there are many offspring, it is also possible to detect whether new alleles appear in subsequent generations. If new alleles appear, the introduction of foreign bloodlines can be initiated.
[0019] Furthermore, the specific steps for introducing the aforementioned external bloodline are as follows:
[0020] Boars with the KIT genotype GG and black coat color (top and bottom white) were selected from the Wuyun Gaixue strain. The average genetic distance between them and the current generation of white sows was calculated. Boars with the largest average genetic distance were selected to breed with the GG-type white sows selected in the current generation. After the offspring were born, only individuals with white coat color were selected, and those with the black coat color (top and bottom white) phenotype were culled. The selected individuals were then tested for KIT genotype and SSR before being included in the breeding population of the next generation.
[0021] Furthermore, in the above (3), the specific criteria for selecting representative types are as follows:
[0022] F1 generation selection: pure white coat color is preferred, with ≤2 black spots allowed and diameter <3cm;
[0023] F2 generation selection: The coat color must be pure white and no black spots are allowed;
[0024] F3 generation and beyond: 100% pure white coat color, without any black spots; and each generation must cull individuals with umbilical hernia, scrotal hernia or imperforate anus genetic defects and their entire litter of siblings.
[0025] Furthermore, in (4) above, the target threshold is specifically:
[0026] Expected heterozygosity (He) ≥ 0.60; polymorphic information content (PIC) ≥ 0.55; inbreeding coefficient (Fis) not significantly different from the previous generation (P > 0.05); and coat color 100% pure white.
[0027] Furthermore, the aforementioned basic population and all subsequent generations of offspring must meet the following body size standards: At 4 months of age, boars should weigh 15–20 kg, be 30–35 cm tall, 52–62 cm long, and have a chest circumference of 55–62 cm; sows should weigh 14–18 kg, be 30–35 cm tall, 53–63 cm long, and have a chest circumference of 53–65 cm.
[0028] At 6 months of age, boars should weigh 20-25 kg, be 33-40 cm tall, and be 62-67 cm long; sows should weigh 17-25 kg, be 33-39 cm tall, and be 62-67 cm long.
[0029] At 8 months of age, boars should weigh 30-40 kg, be 40-50 cm tall, and be 70-85 cm long; sows should weigh 25-35 kg, be 40-50 cm tall, and be 70-85 cm long; when they reach physical maturity at 24-36 months of age, their weight should be stable at 40-60 kg.
[0030] When children reach physical maturity between 24 and 36 months of age, their weight stabilizes at 40–60 kg.
[0031] Furthermore, the site names, allele regions, and upstream and downstream primer sequences of the above 32 fluorescently labeled microsatellite primer pairs are shown in the table below:
[0032]
[0033]
[0034] The present invention also provides pure white Wuzhishan pigs bred using any of the above methods.
[0035] Under the extreme condition of extinction of the original white major mutation (KIT gene mutation), this invention innovatively and successfully achieved pure white coat color fixation in the wild-type background of GG through rigorous multi-generation phenotypic screening.
[0036] This invention creatively introduces the "external bloodline introduction" step, which ensures that the population, regardless of the generation, is able to forcefully meet the threshold target of He ≥ 0.60 through this step.
[0037] This invention introduces 32 fluorescently labeled microsatellite primers (SSRs) to dynamically monitor the analysis and detection process, calculate genetic distance to guide mating, and accurately introduce extra-bloodlines from the *Syzygium buergerianum* line, thus ensuring the population viability of the experimental animal model.
[0038] The embodiments of this invention demonstrate that a clear family differentiation has emerged between the newly bred population and the original conservation population. The population has abundant effective alleles, no risk of inbreeding, and has formed stable new genetic population characteristics. In summary, the breeding method of this invention has successfully fixed new genetic population characteristics, and the breeding effect is significant. Attached Figure Description
[0039] Figure 1 Amplification electrophoresis gel image;
[0040] Figure 2 Principal coordinate analysis of 100 samples;
[0041] Figure 3 A graph showing the variation of K values plotted using the ΔK method in structure analysis;
[0042] Figure 4 Structure results of 100 samples when K=2. Detailed Implementation
[0043] To enable those skilled in the art to better understand the present application, the technical solutions in the embodiments of the present application will be clearly and completely described below with reference to examples. Obviously, the described embodiments are only some embodiments of the present application, and not all embodiments. Based on the embodiments in the present application, all other embodiments obtained in the art without creative effort should fall within the scope of protection of the present invention.
[0044] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0045] The molecular marker-assisted monitoring technology in this invention is described as follows:
[0046] KIT gene testing method:
[0047] The G>A mutation in intron 17 of the KIT gene is a major mutation in the dominant white hair of pigs. Previous testing indicated that all newly bred white lines (F0-F2 generations) and the Wuyun Gaixue line are GG wild-type, and the original white line is extinct. This protocol uses this mutation detection as a background monitoring tool, confirming the genotype of the population at each generation and observing for the occurrence of natural mutations, providing a basis for breeding decisions. The specific detection method is as follows: the upstream F primer sequence is CCGACTCTCCTAACAGTGTATTC, and the downstream R primer sequence is CGCCTAATTCTGAGCATTATCTTC. The PCR reaction system is 50 μL, containing 2 μL of template DNA, 2 μL each of upstream and downstream primers, 25 μL of 2×Taq PCR premix, and ddH2O to a final volume of 50 μL. The PCR program is: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 40 s, 36 cycles; 72℃ extension for 10 min. The PCR product was sent for sequencing, and the first base of intron 17 was analyzed. The result showed a single peak G, indicating the GG genotype.
[0048] SSR microsatellite marker detection method:
[0049] SSR microsatellite markers can quantitatively assess population genetic diversity, inbreeding levels, and pedigrees, scientifically guiding mating and the introduction of foreign bloodlines to avoid inbreeding depression. Detection sites: 32 pairs of fluorescently labeled microsatellite primers, including the following sites: P102, P114, P115, P133, P143, P96, S0007, S0008, S0026, S0062, S0087, S0090, S0091, S0101, S0143, S0155, S0225, S0226, S0355, S0386, SW1057, Sw2008, Sw240, Sw2410, Sw24, SW268, SW511, Sw632, Sw72, SW769, SW886. Sw911; Detection method: PCR amplification was performed using fluorescently labeled primers, with a gradient annealing program (62℃→52℃, 10 cycles followed by 25 cycles at 52℃). Fluorescent capillary electrophoresis (ABI 3730xl) was used for detection, and genotype analysis was performed using GeneMarker software. Calculated parameters included: observed allele count (Na), effective allele count (Ne), observed heterozygosity (Ho), expected heterozygosity (He), polymorphism information content (PIC), inbreeding coefficient (Fis), and inter-individual genetic distance (Nei).
[0050] If He < 0.50 or PIC < 0.50, or Fis is significantly higher than the previous generation (P < 0.05), it indicates that the risk of inbreeding is too high and foreign bloodlines need to be introduced.
[0051] Based on the molecular genetic verification results of the W-F1 generation in this embodiment of the invention, this population has successfully established independent genetic strain characteristics; those skilled in the art only need to continue to strictly follow the methods described in this invention in subsequent breeding:
[0052] After the W-F1 generation reaches physical maturity, they are bred to obtain the W-F2 generation;
[0053] More stringent phenotypic screening was performed on the W-F2 generation (all individuals with black spots were eliminated), and the population genetic parameters were continuously monitored using 32 pairs of SSR primers;
[0054] Similarly, if the threshold of the primer outer edge gene is triggered in a certain generation, then the outer bloodline of the Wuyungaixue lineage is introduced to correct the deviation.
[0055] Ultimately, after 3-4 generations or just one generation of selective breeding, the population will inevitably stabilize to achieve the following: desired heterozygosity (He) ≥ 0.60; polymorphic information content (PIC) ≥ 0.55; inbreeding coefficient (Fis) with no significant difference compared to the previous generation (P > 0.05); and 100% pure white coat color. At this point, the population meets the threshold described in claim 1 and officially enters the closed breeding stage.
[0056] Example 1: Breeding of pure white Wuzhishan pigs
[0057] 1.1 Basic Group Establishment
[0058] The base population (F0 generation) will consist of individuals from the newly bred white F2 generation (existing F2 generation) that meet the standards for body size, health, and coat color (a small number of black spots are allowed), with a total of more than 60 individuals selected (more than 10 boars and more than 50 sows). At the same time, 5-10 healthy boars of the Wuyun Gaixue line will be retained as a reserve population for external bloodlines.
[0059] Each individual was given a unique number, and an electronic pedigree file was established to record information such as coat color, weight, body size, and health status. The KIT genotype of the base population was tested and found to be GG genotype.
[0060] 1.2 Selection and mating of F0 generation (foundation population)
[0061] Selection criteria: Only white individuals will be selected, with pure white individuals given priority. A small number of black spots are allowed, but the number and size of the black spots must be recorded. Individuals with many black spots will be gradually eliminated. Physical appearance requirements include a small and long head, small and erect ears, a pointed and slightly curved mouth, a straight back and waist, and thin and short limbs. Individuals must be free of genetic defects (umbilical hernia, scrotal hernia, imperforate anus, etc.) and have normal growth and development.
[0062] Sixty selected individuals underwent SSR locus testing at 32 sites, and He, PIC, and Fis were calculated to establish a genetic distance matrix between individuals. The mating program was based on this genetic distance matrix, prioritizing pairings of individuals with large genetic distances and avoiding full-sib and half-sib matings. Each boar was mated with 5-8 sows.
[0063] 1.3 F1 generation breeding
[0064] F1 generation piglets were obtained through conventional natural mating or artificial insemination according to the breeding plan. At birth, piglets were recorded for coat color, number of teats, and health status. Initial selection criteria included white coat (white area ≥80%), no deformities, and 6-7 pairs of teats. Ear tissue was collected at 2 weeks of age for KIT genotyping (expected to be all GG).
[0065] F1 generation selection criteria: pure white coat color is preferred, with a very small number of small black spots allowed (number of black spots ≤2, diameter <3cm), individuals with many black spots will be culled; at 4 months of age, weight and body size must meet the standards (boars: weight 15-20 kg, height 30-35 cm, length 52-62 cm, chest circumference 55-62 cm; sows: weight 14-18 kg, height 30-35 cm, length 53-63 cm, chest circumference 53-65 cm); no genetic defects, and normal growth and development.
[0066] ≥25 individuals were randomly selected from the chosen individuals for testing at 32 SSR loci. He, PIC, and Fis were calculated and compared with the F0 generation. If Fis was significantly higher than that of the F0 generation (P<0.05) or He < 0.50, the outcrossing procedure was initiated; if the genetic parameters were normal, a mating plan was formulated based on the genetic distance matrix, and crossbreeding continued.
[0067] 1.4 F2 generation breeding
[0068] Continue crossbreeding the individuals selected from the F1 generation. Selection criteria: Coat color requirement raised to pure white (no obvious black spots allowed);
[0069] Everything else is the same as the F1 generation.
[0070] The SSR testing and mating plan are the same as before.
[0071] 1.5 F3 generation and later
[0072] Repeat the F2 generation process.
[0073] The breeding is considered successful when all of the following conditions are met:
[0074] 100% pure white fur (without any black spots);
[0075] He ≥ 0.60, PIC ≥ 0.55, Fis showed no significant difference from the previous generation (P>0.05);
[0076] Then it enters a closed breeding phase to maintain population stability.
[0077] 1.6 Procedure for Introducing External Blood Relationships
[0078] Triggering conditions: FIS is significantly higher than the previous generation in any generation (P<0.05), or He < 0.50, or no new alleles appear in two consecutive generations.
[0079] Operational steps: Select 3-5 healthy boars from the Wuyun Gaixue strain (all with GG KIT genotype, black on top and white on the bottom) and breed them with white sows (GG type) selected from this generation. After the offspring are born, only individuals with white coat color are selected (the black-on-top-white-on-bottom phenotype is culled). After crossing the Wuyun Gaixue strain with the white strain, the proportion of white offspring is approximately 50%. Perform KIT genotyping (expected to be all GG) and SSR testing on the white offspring, and include the selected white individuals in the core breeding group to participate in the next generation of breeding.
[0080] Post-introduction processing: The first generation after introducing foreign bloodlines (W1 generation) still requires strict coat color selection and SSR testing, with the goal of gradually moving towards a pure white coat while maintaining genetic diversity. Within 2-3 generations after introduction, the population's genetic diversity should be restored, and the homozygosity of the white coat should not decrease.
[0081] 1.7 Selection Criteria for Each Generation
[0082] F0 generation: White coat (a few black spots are allowed), KIT genotype GG (monitoring background), body size and weight requirements meet the standards.
[0083] F1 generation: pure white coat preferred, very few small black spots, KIT genotype GG, weight and body size meet standards at 4 months of age, control mutations, SSR monitoring He, PIC, Fis, crossbreeding.
[0084] F2 generation: pure white coat (no obvious black spots), KIT genotype male, weight and body size strictly controlled at the median at 6 months of age, SSR test, crossbreeding.
[0085] F3 generation and above: 100% pure white coat color, KIT genotype GG, weight and body size meet breed standards at 8-12 months of age and physical maturity, SSR parameters He≥0.6, PIC≥0.55, and closed breeding after achieving the target.
[0086] Out-of-breed generation: white coat (a few black spots are acceptable), KIT genotype GG, body size meets standards, SSR monitoring shows He recovery, after introducing the Black Cloud Covering Snow lineage, only white offspring remain.
[0087] 1.8 Progress and Feeding Management
[0088] 1.8.1 Schedule
[0089] Year 0 Preparation Period (3 months): Basic population establishment, individual numbering, KIT+SSR background testing. Year 0-1: F1 generation production, testing, and selection. Year 1-2: F2 generation production, testing, and selection. Year 2-3: F3 generation production, testing, and selection. Year 3-4: F4 generation reaches the target, closed-loop breeding verification.
[0090] 1.8.2 Nutritional Standards
[0091] Compound feeds are formulated according to the nutritional needs of piglets at different growth stages. For piglets (41-90 days old): crude protein not less than 16%, digestible energy not less than 3.00 Mcal / kg, crude fiber not more than 8.0%, calcium 0.8-1.0%, and available phosphorus not less than 0.50%. For medium-sized pigs (91-150 days old): crude protein not less than 14%, digestible energy not less than 2.90 Mcal / kg, crude fiber not more than 9.0%, calcium 0.6-0.8%, and available phosphorus not less than 0.35%. For large pigs (over 151 days old): crude protein not less than 13%, digestible energy not less than 2.95 Mcal / kg, crude fiber not more than 10.0%, calcium 0.4-0.6%, and available phosphorus not less than 0.35%.
[0092] 1.8.3 Environmental Requirements
[0093] The temperature in the piglet heat lamp should be 28-32℃, and the temperature for growing pigs should be 18-25℃; the humidity should be 60%-75%; the air should be kept fresh, and the ammonia concentration should be below 20ppm; each pen should house 4-6 pigs, with each pig occupying 0.8-1.2 square meters.
[0094] 1.9 Weight Requirements
[0095] At 4 months of age, boars weigh 15–20 kg, are 30–35 cm tall, 52–62 cm long, and have a chest circumference of 55–62 cm; sows weigh 14–18 kg, are 30–35 cm tall, 53–63 cm long, and have a chest circumference of 53–65 cm.
[0096] At 6 months of age, boars should weigh 20-25 kg, be 33-40 cm tall, and be 62-67 cm long; sows should weigh 17-25 kg, be 33-39 cm tall, and be 62-67 cm long.
[0097] At 8 months of age, boars should weigh 30-40 kg, be 40-50 cm tall, and be 70-85 cm long; sows should weigh 25-35 kg, be 40-50 cm tall, and be 70-85 cm long.
[0098] When they reach physical maturity at 24 to 36 months of age, their weight stabilizes at 40–60 kg.
[0099] Example 2: Evaluation of the effect of newly bred Wuzhishan white pig population
[0100] 2.1 SSR Genetic Diversity Analysis
[0101] 2.1.1 Materials
[0102] Ear tissue samples of the original Wuzhishan pig white line (B control group) were preserved by our laboratory. Samples of the newly bred Wuzhishan pig white line generation F0 (W-F0) and generation F1 (W-F0) were collected from the Laboratory Animal Breeding Farm of Yongfa Base of Hainan National Wuzhishan Pig Conservation Farm (Production License No. SCXQ (Qiong) 2014-0006), placed in 1.5 mL sterilized centrifuge tubes, brought back to the laboratory, and stored in a -80°C refrigerator for later use.
[0103] 2.1.2 Methods
[0104] Genomic DNA of Wuzhishan pigs was extracted according to the method provided in the Tiangen DNA Extraction Kit, dissolved in TE, and stored at -20°C. The purity and concentration of DNA were detected by the combination of agarose gel electrophoresis and NanoDrop 2000. The electrophoresis results of partial genomic DNA samples are shown in Figure 1 .
[0105] Thirty-two pairs of microsatellite primers selected in this experiment (nucleotide sequences are shown in SEQ ID NO: 1 to SEQ ID NO: 64) and fluorescent labels were all synthesized by Sangon Biotech (Shanghai) Co., Ltd. with reference to the design. When fluorescent primers are used for PCR amplification, the upstream primer with a fluorescent group at the 5' end and the downstream primer directly amplify the DNA template. The PCR amplification program was set as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, gradient annealing at 62~52°C for 30 s, extension at 72°C for 30 s, 10 cycles of operation; denaturation at 95°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 30 s, 25 cycles of operation; extension at 72°C for 20 min, and final storage at 4°C. After the PCR reaction was completed, the amplification products were detected by fluorescence capillary electrophoresis. GeneMarker software was used to analyze the results, and the number of alleles, peak maps and genotypes of each sample were obtained. The PCR amplification operation is shown in Table 1 below, and the fluorescent group-labeled PCR products were obtained.
[0106] Table 1 PCR amplification procedure
[0107]
[0108] To ensure the specificity of fluorescent PCR amplification and the uniformity of sample concentration for sequencing, after fluorescent PCR amplification, 2 μL of PCR product was subjected to agarose gel electrophoresis (1% concentration). The band pattern of the PCR product was used to determine the amplification specificity of each SSR primer, and the brightness of the PCR product bands was used to determine the amplification efficiency of each SSR primer. The fluorescent PCR products were diluted according to the required concentration for sequencing to obtain a uniform concentration, which was then used for sequencing. Because agarose gel electrophoresis has low resolution and the SSR amplified fragments are relatively small, this step is assumed to be a random sampling test. Below are some gel images from the electrophoresis results. Figure 1 As can be seen, each band is clean and clear, indicating that the primers have high specificity.
[0109] Fluorescent capillary electrophoresis detection
[0110] Following the experimental protocol in the experimental information management system, the fluorescent PCR products diluted to a uniform concentration were added to the PCR plate, and the detection reagents were added according to the system in Table 2 below. After centrifuging the plate containing the samples and reagents, the plate was placed on the PCR instrument and the denaturation program was run (95℃, 3 min). After denaturation, the plate was immediately cooled. Referring to the ABI 3730xl instrument operation procedure, the detection file corresponding to the plate name was selected, and the SSR sample analysis detection program was run. Raw data in .fsa format was exported from the ABI 3730xl instrument, categorized and archived according to the detection sites, and then imported into the GeneMarker analysis software to read the genotype data. Excel genotype raw data and PDF genotyping peak plot files were then exported according to the site names.
[0111] Table 2 Sample Analysis and Testing Procedures
[0112]
[0113] 2.1.3 Experimental Results
[0114] 2.1.3.1 Allele frequency and allele distribution
[0115] A total of 240 alleles (Na) were detected in 100 samples from three Wuzhishan white pig populations using 32 primer pairs. The minimum number of alleles was 4, the maximum number of alleles was 14, and the average number of alleles per locus was 7.5, indicating that the selected 32 SSR primer pairs are extremely sensitive and have very high resolution. 166, 140, and 146 alleles were detected at the 32 loci in the three Wuzhishan white pig populations, respectively. The total number of effective alleles was 117.621, ranging from 1.46 (P102) to 6.186 (S0226), with an average of 3.676 effective alleles per locus. The kinship distribution among the families was very even, as shown in Table 3 below.
[0116] Table 3. Allele frequencies and their distribution
[0117]
[0118] 2.1.3.2 Genetic diversity indicators
[0119] The apparent homozygosity of the 32 microsatellite loci in the WZSP closed group ranged from a minimum of 0.10 to a maximum of 0.82, with an average of 0.34; the apparent heterozygosity ranged from 0.22 to 0.90, with an average of 0.63. The expected homozygosity ranged from a minimum of 0.16 to a maximum of 0.69; the expected heterozygosity ranged from a minimum of 0.31 to a maximum of 0.84, with an average of 0.66. The observed heterozygosity (Ho) ranged from 0.2 (P102) to 0.81 (S0008), with an average of 0.59331. The expected heterozygosity (He) ranged from 0.315 (P102) to 0.838 (S0226), with an average of 0.69613. The polymorphic information content (PIC) ranged from 0.298 (P102) to 0.821 (S0226), with an average of 0.659. The average inbreeding coefficient is 0.025, with values ranging from -0.261 (S0155) to 0.685 (SW268). The Shannon index (I) ranges from 0.651 (P102) to 2.144 (S0087), with an average of 1.48206, as shown in Tables 4 and 5.
[0120] Table 4 Polymorphism of 32 SSR primer pairs
[0121]
[0122]
[0123] Table 5 Genetic diversity among populations
[0124]
[0125] After adopting the breeding method of this invention, the expected heterozygosity (He) of the newly bred W-F0 and W-F1 generations was maintained at around 0.60, and the polymorphism information index (PIC) reached 0.55 or higher. Meanwhile, the inbreeding coefficient (F = 0.003) of the W-F1 generation was extremely low. This indicates that the "molecular marker-assisted mating" and "timely introduction of foreign bloodlines" strategies adopted in this invention successfully avoided the risk of inbreeding depression and maintained rich population genetic diversity and population vitality during the closed breeding process aimed at achieving coat color purification.
[0126] 2.1.3.3 Population genetic structure and differentiation evaluation
[0127] (1) Analysis of molecular variance and genetic distance
[0128] Analysis of molecular variance is a method for measuring and calculating genetic variation between haplotypes (or genotypes) by using evolutionary distance. Molecular variance analysis showed that 18% of the genetic variation was present in the population and 82% in the individual. Individual variation was the main source of total variation in the Wuzhishan white pig line, as shown in Table 6. As shown in Table 7, the genetic differentiation coefficients between the original protected population (B) and the newly bred populations (W-F0 and W-F1) reached 0.125 and 0.144, respectively, which are at a significant level of moderate to high differentiation (>0.05). This indicates that through the breeding method described in this invention, the newly bred white line population has established a significant genetic distance from the original historical protected population at the genomic level, successfully forming an independent genetic branch. The genetic differentiation coefficient between the newly bred basic population (W-F0) and the newly bred first generation (W-F1) was only 0.037 (at a weak differentiation level), while the gene flow between the two was as high as 6.567 (far greater than 1). This indicates that the W-F1 generation not only perfectly inherited the excellent genetic foundation of the W-F0 generation, but also that the breeding process was free of heterogeneous contamination, and the population genetic structure showed high generational stability and controllability.
[0129] Table 6. Analysis of molecular variance (AMOVA) of the population
[0130]
[0131] Source: Origin of variation; df: Degrees of freedom; SS: Total variance; MS: Mean squared error; Est. Var.: Estimated variance; %: Percentage of variation; Among Pops: Between populations; Among Indiv: Between individuals; Within Indiv: Within an individual. Intra-individual variation refers to genetic differences caused by heterozygous alleles, and its magnitude is related to the number of heterozygous loci in an individual, i.e., the genetic diversity of an individual.
[0132] Table 7. Gene flow (upper triangle) and genetic differentiation coefficient (lower triangle) between populations
[0133]
[0134] (2) Principal coordinate analysis
[0135] Principal Coordinate Analysis (PCoA) presents a visual coordinate system representing the similarity or difference of research data. It is a non-constrained dimensionality reduction analysis method and can also be used to study the similarity or dissimilarity of sample group composition. PCoA analysis reflects the differences between two or more samples by intuitively comparing the linear distances between samples on the coordinate axes. Closer linear distances between two samples or groups indicate smaller differences; conversely, larger linear distances indicate greater differences. PCoA analysis is performed using GenAIex software, such as... Figure 2 As shown, individuals from the original protected population (B) are concentrated on one side of the coordinate axis, while individuals from the newly bred populations (W-F0 and W-F1) are highly aggregated and distributed on the other side of the coordinate axis. The boundaries between the two are clear and they do not overlap.
[0136] (3) Population genetic structure analysis
[0137] STRUCTURE analysis
[0138] The population structure of 100 samples was evaluated using 32 molecular markers. Based on the principle of maximizing likelihood, the optimal K value was determined to be 2, which allows the 100 samples to be divided into two subpopulations, such as... Figure 3 and Figure 4 As shown.
[0139] (4) Genetic distance and cluster analysis
[0140] Genetic distances between populations were calculated in PowerMarker (Nei, 1983). The largest genetic distance among the three populations was 0.39651 (B / W-F1), and the smallest was 0.155637 (W-F0 / W-F1). Cluster analysis was performed using the unweighted group average method (UPGMA) based on Nei genetic distance, as shown in Table 8. The genetic distance between the original population B and the new populations (F0, F1) was relatively large, while F0 and F1 were very close.
[0141] Table 8 Genetic distance between populations
[0142]
[0143] In summary, the above analysis demonstrates that the breeding method described in this invention not only successfully purified the pure white coat color of Wuzhishan pigs phenotypically, but also disrupted the genetic structure of the original population at the genomic level. A clear and deep family differentiation has emerged between the newly bred white lineage and the original protected population, successfully solidifying entirely new genetic characteristics, resulting in a breakthrough in breeding achievements.
Claims
1. A method for breeding pure white Wuzhishan pigs based on phenotypic and molecular marker-assisted selection, characterized in that: Includes the following steps: (1) Establishment of the basic population: Select Wuzhishan pigs with white coat color and allow the number of black spots ≤2 and the diameter of the black spots <3cm as the basic population, and retain Wuzhishan pigs of the Wuyun Gaixue line as the external bloodline reserve population; (2) Molecular genetic background monitoring: KIT genotyping was performed on selected individuals to monitor the dominant white hair major mutation background; at the same time, SSR microsatellite markers were used to detect genetic diversity and calculate population genetic parameters; (3) Selecting offspring piglets by phenotypic traits: screening offspring piglets by coat color and body shape, raising the standard for pure white coat color, and eliminating individuals with black spots; (4) Closed breeding: When the genetic parameters of the population reach the target threshold, the closed breeding stage is entered.
2. The breeding method as described in claim 1, characterized in that: After step (3) ends, the population genetic parameters are detected. When the population genetic parameters are lower than the set threshold, boars from the ecto-bloodline reserve population are introduced to mate with white sows of the current generation, and only individuals with white coats are selected from their offspring to be included in the core breeding group. When the population genetic parameters reach the target threshold, the introduction of ecto-bloodlines is stopped, and the closed breeding stage begins.
3. The breeding method as described in claim 1, characterized in that: In (2): the KIT genotype detection specifically involves detecting the 17 G>A site of the KIT gene intron, and the genotypes of the basic population and the selected offspring individuals are all GG wild type; the SSR microsatellite marker detection specifically involves PCR amplification and capillary electrophoresis detection using 32 fluorescently labeled microsatellite primer pairs, and the calculated population genetic parameters include: expected heterozygosity, polymorphism information content, and inbreeding coefficient.
4. The breeding method as described in claim 2, characterized in that: The set threshold is any one of the following: (A) The inbreeding coefficient of any generation was significantly higher than that of the previous generation, P<0.05; (B) Expected heterozygosity < 0.50; (C) Polymorphic information content < 0.
50.
5. The breeding method as described in claim 2, characterized in that: The specific steps for introducing foreign bloodlines are as follows: Select boars with the KIT genotype GG and black coat color (black on top and white on the bottom) from the Wuyun Gaixue line, and breed them with GG-type white sows selected in this generation. After the offspring are born, only individuals with white coat color are selected, and the black-on-top-white phenotype is culled. Only individuals with white coat color are selected, and the selected individuals are tested for KIT genotype and SSR before being included in the breeding group of the next generation.
6. The breeding method as described in claim 1, characterized in that: In (3), the criteria for selecting representative types are specifically as follows: F1 generation selection: pure white coat color is preferred, with ≤2 black spots allowed and diameter <3cm; F2 generation selection: The coat color must be pure white and no black spots are allowed; F3 generation and beyond: 100% pure white coat color, without any black spots; and each generation must cull individuals with umbilical hernia, scrotal hernia or imperforate anus genetic defects and their entire litter of siblings.
7. The breeding method as described in claim 1, characterized in that: In (4), the target threshold is specifically: Expected heterozygosity (He) ≥ 0.60; polymorphic information content (PIC) ≥ 0.55; inbreeding coefficient (Fis) was not significantly different from the previous generation (P > 0.05).
8. The breeding method as described in claim 1, characterized in that: The basic population and all generations of offspring must meet the following body size standards: at 4 months of age, boars should weigh 15-20 kg, be 30-35 cm tall, 52-62 cm long, and have a chest circumference of 55-62 cm; sows should weigh 14-18 kg, be 30-35 cm tall, 53-63 cm long, and have a chest circumference of 53-65 cm. At 6 months of age, boars should weigh 20-25 kg, be 33-40 cm tall, and be 62-67 cm long; sows should weigh 17-25 kg, be 33-39 cm tall, and be 62-67 cm long. At 8 months of age, boars should weigh 30-40 kg, be 40-50 cm tall, and be 70-85 cm long; sows should weigh 25-35 kg, be 40-50 cm tall, and be 70-85 cm long. When they reach physical maturity at 24-36 months of age, their weight should be stable at 40-60 kg.
9. The breeding method as described in claim 3, characterized in that: The site names, allele regions, and upstream and downstream primer sequences of the 32 fluorescently labeled microsatellite primer pairs are shown in the table below: 。 10. A pure white Wuzhishan pig bred using the breeding method described in any one of claims 1-9.